Nghiên cứu ảnh hưởng của Glycyl Funtumin lên mức độ phiên mã gen Xiap trên dòng tế bào BT474

51 21 0
  • Loading ...
1/51 trang

Thông tin tài liệu

Ngày đăng: 30/07/2019, 11:24

BỘ Y TẾ TRƢỜNG ĐẠI HỌC DƢỢC HÀ NỘI ĐỖ THỊ THANH HOA NGHIÊN CỨU ẢNH HƢỞNG CỦA GLYCYL FUNTUMIN LÊN MỨC ĐỘ PHIÊN MÃ GEN XIAP TRÊN DÒNG TẾ BÀO BT474 KHÓA LUẬN TỐT NGHIỆP DƢỢC SĨ HÀ NỘI - 2019 BỘ Y TẾ TRƢỜNG ĐẠI HỌC DƢỢC HÀ NỘI BỘ MƠN HĨA SINH ĐỖ THỊ THANH HOA MSV: 1401227 NGHIÊN CỨU ẢNH HƢỞNG CỦA GLYCYL FUNTUMIN LÊN MỨC ĐỘ PHIÊN MÃ GEN XIAP TRÊN DÒNG TẾ BÀO BT474 KHÓA LUẬN TỐT NGHIỆP DƢỢC SĨ Người hướng dẫn: PGS TS Đỗ Hồng Quảng Nơi thực hiện: Bộ mơn Hóa Sinh – Trƣờng ĐH Dƣợc HN Viện Công nghệ sinh học - Viện Hàn lâm Khoa học - Công nghệ Việt Nam HÀ NỘI – 2019 LỜI CẢM ƠN Để khóa luận tốt nghiệp hồn thiện, em nhận động viên, hỗ trợ giúp đỡ nhiệt tình đến từ thầy cơ, anh chị, bạn bè người thân thời gian qua.Trước tiên, em xin gửi lời cảm ơn chân thành tới tồn thể thầy, giáo – giảng viên trường Đại học Dược Hà Nội, môn, phòng ban ln giảng dạy, truyền đạt kiến thức quý báu tạo điều kiện tốt cho em học tập, rèn luyện suốt năm học ngồi ghế nhà trường Em xin cảm ơn thầy cô, anh chị bạn nghiên cứu khoa học Bộ mơn Hóa Sinh, thầy cô, anh chị bạn cơng tác phòng Cơng nghệ tế bào động vật phòng Ứng dụng ADN thuộc Viện hàn lâm Khoa học Công nghệ Việt Nam tạo điều kiện, giúp đỡ bảo tận tình cho em suốt trình làm nghiên cứu Em xin bày tỏ lòng biết ơn sâu sắc tới PGS TS Đỗ Hồng Quảng - giảng viên Bộ mơn Hóa sinh, cán phòng Sau Đại học trường Đại học Dược Hà Nội Thầy người truyền đạt cho em kiến thức, kỹ năng, phương pháp tác phong làm việc nghiêm túc, cẩn thận cần có người làm nghiên cứu Hơn nữa, thầy hướng dẫn, giúp đỡ động viên em, tạo điều kiện thuận lợi để em hồn thành khóa luận tốt nghiệp Em xin gửi lời cảm ơn chân thành đến TS Lê Thị Thùy Dƣơng - cán phòng Ứng dụng ADN thuộc Viện hàn lâm Khoa học Công nghệ Việt Nam, người hỗ trợ nhiều mặt chuyên môn suốt thời gian em nghiên cứu Cuối cùng, em xin cảm ơn gia đình bạn vè động viên, cổ vũ giúp đỡ em suốt thời gian qua Xác nhận GV hướng dẫn Hà Nội, ngày 20 tháng năm 2019 Sinh viên Đỗ Thị Thanh Hoa i MỤC LỤC DANH MỤC CÁC KÍ HIỆU, CÁC CHỮ VIẾT TẮT v DANH MỤC CÁC HÌNH VẼ, ĐỒ THỊ vii DANH MỤC CÁC BẢNG viii ĐẶT VẤN ĐỀ CHƢƠNG TỔNG QUAN 1.1 Tổng quan XIAP…………………………………………………… 1.1.1 Cấu trúc phân tử………………………………………………………… 1.1.2 Chức sinh học XIAP…………………………………………… 1.1.2.1 Vai trò ức chế chết tế bào theo chu trình……………………………… 1.1.2.2 Vai trò vận chuyển tín hiệu tế bào……………………… 1.1.3 Vai trò XIAP ung thư………………………………………… 1.1.3.1 Biểu XIAP ung thư……………………………………… 1.1.3.2 Ứng dụng………………………………………………………………… 1.2 Tổng quan phƣơng pháp đánh giá biểu gen…………………… 1.2.1 Quá trình biểu gen………………………………………………… 1.2.2 Các phương pháp đánh giá mức độ biểu gen…… ………………… 1.2.2.1 Kỹ thuật PCR đánh giá biểu gen mức độ phiên mã……………… 1.2.2.2 Kỹ thuật Western Blot đánh giá biểu gen mức độ dịch mã……… 12 1.2.2.3 Phương pháp đánh giá mức độ biểu gen XIAP…………………… 13 1.3 Tổng quan glycyl funtumin………… ……………………………… 14 1.3.1 Cấu tạo phân tử glycyl funtumin………………………………………… 14 1.3.2 Tác dụng dược lý glycyl funtumin… …………………… ……… 15 ii CHƢƠNG ĐỐI TƢỢNG VÀ PHƢƠNG PHÁP NGHIÊN CỨU 16 2.1 Đối tƣợng nghiên cứu, trang thiết bị nghiên cứu 16 2.1.1 Đối tượng nghiên cứu………………………………………………… 16 2.1.2 Nội dung nghiên cứu 17 2.2 Phƣơng pháp nghiên cứu 2.2.1 Nuôi cấy tế bào………………………………………………………… 18 2.2.2 Tách chiết ARN………………………………………………………… 18 2.2.3 Xác định độ tinh đo phổ hấp thụ máy NanoDrop…………18 2.2.4 Phản ứng tổng hợp cDNA từ ARN………………………………………18 2.2.5 Phản ứng realtime PCR phát gen XIAP……………………………… 20 2.2.6 Điện di gel agarose……………………………………………… …22 2.2.7 Giải trình tự ADN……………………………………………………… 22 2.2.8 Đánh giá ảnh hưởng Glycyl funtumin lên mức độ phiên mã gen 18 XIAP…………………………………………………………… 22 2.2.9 Xử lý thống kê……………………………………………………… … 23 CHƢƠNG THỰC NGHIỆM, KẾT QUẢ VÀ BÀN LUẬN 24 3.1 Kết 3.1.1 Kết nuôi cấy thử thuốc Aslem tế bào BT474………… …… 24 3.1.2 Kết tách chiết xác định độ tinh quang phổ hấp thụ… 25 3.1.2.1 Kết quét phổ hấp thụ mẫu sau tách chiết…………………… 25 3.1.2.2 Kết đo nồng độ số OD260/280……………………………………….…………… 25 3.1.3 Kết phát gen XIAP…………………………………………… 26 3.1.3.1 Kết điện di sản phẩm realtime RT-PCR………………………… 26 3.1.3.2 Kết giải trình tự gen thu sau phản ứng khuếch đại gen……… 27 3.1.4 Kết đánh giá tác dụng glycyl funtumin lên mức độ phiên mã 24 iv gen XIAP……………………………………………………………… 28 3.2 Bàn luận 31 3.2.1 Về q trình ni cấy tách chiết ARN…………………………… 31 3.2.2 Về đánh giá mức độ biểu gen XIAP…………………………….…31 3.2.3 Về ảnh hưởng glycyl funtumin lên mức độ phiên mã gen XIAP dòng tế bào BT474…………… ………………………………….…….32 KẾT LUẬN 35 KIẾN NGHỊ 36 TÀI LIỆU THAM KHẢO iv DANH MỤC CÁC KÍ HIỆU, CÁC CHỮ VIẾT TẮT Viết tắt Tên đầy đủ Tiếng Anh ADN Acid deoxyribonucleic ARN Acid ribonucleic Tên Tiếng Việt AS3 Aslem 3,0µg/mL AS6 Aslem 6,0µg/mL Chuỗi lặp IAP BIR Baculoviral IAP repeat BIRC4 Baculoviral IAP repeat-containing protein bp Base pairs Cặp base nitơ cDNA Complementary ADN ADN bổ sung CT Threshold cycle Chu kì ngưỡng F Forward primer Mồi xi R Reverse primer Mồi ngược FBS Fetal bovine serum Huyết bào thai bò GF Glycyl-funtumin IAP Inhibitors of Apoptosis Chất ức chế chết theo chương trình tế bào IARC The International Agency Cơ quan nghiên cứu Ung for Research on Cancer thư quốc tế IL Interleukin IFN Interferon LD50 Median lethal dose Liều gây chết trung bình MAPK Mitogen-activated protein kinase Protein kinase hoạt hóa mARN Message ARN ARN thông tin NF-kB Yếu tố hạt nhân kappa B NST Nhiễm sắc thể OD Mật độ quang Optical Density v PBS Phosphate buffer saline Dung dịch đệm phosphate PCD Programmed cell death Sự chết tế bào theo chu trình PCR Polymerase Chain Reaction Phản ứng chuỗi trùng hợp Reverse transcription Phiên mã ngược RT RT-PCR snARN Reverse transcription Phản ứng PCR phiên mã polymerase chain reaction ngược Small Nuclear ARN ARN nhỏ nhân Đệm Tris - Acetate - EDTA TAE tARN ARN vận chuyển Transfer RNA Protein kinase hoạt hóa TAK XIAP X-linked Inhibitor of apoptosis protein v DANH MỤC CÁC HÌNH VẼ, ĐỒ THỊ Hình 1.1 Vị trí gen XIAP nhiễm sắc thể X người Hình 1.2 Sơ đồ cấu trúc phân tử protein họ IAPs [22] Hình 1.3 Cấu trúc phân tử protein XIAP Hình 1.4 Cơ chế ức chế apoptosis XIAP cách ức chế caspase-3,7,9 Hình 1.5 Cơ chế tác dụng XIAP vận chuyển tín hiệu tế bào [30] Hình 1.6 Nguyên tắc phản ứng PCR nhân ADN theo chu kỳ nhiệt 10 Hình 1.7 Nguyên tắc tiến hành RT-PCR 10 Hình 1.8 Cơ chế phát huỳnh quang SYBR Green I 12 Hình 1.9 Hình ảnh bao bì thuốc tiêm Aslem [24]…………………… …………… 14 Hình 2.1 Sơ đồ nghiên cứu ảnh hưởng glycyl funtumin lên mức độ phiên mã gen XIAP dòng tế bào BT474 17 Hình 2.2 Kết kiểm tra khả bắt cặp cặp mồi XIAP 21 Hình 3.1 Hình ảnh tế bào BT474 sau 24 thử thuốc nồng độ 3,0 µg/mL 6,0 µg/mL 24 Hình 3.2 Phổ hấp thụ UV mẫu ARN chiết từ dòng tế bào BT474 25 Hình 3.3 Kết điện di sản phẩm phản ứng realtime RT-PCR gel agarose 1% 26 Hình 3.4 Kết so sánh trình tự đoạn gen khuếch đại với trình tự gen công bố ngân hàng gen Genbank 28 Hình 3.5 Hình ảnh đồ thị huỳnh quang thu từ phản ứng realtime PCR 29 vii DANH MỤC CÁC BẢNG Bảng 1.1 Một số thuốc, hoạt chất tác dụng hướng đích XIAP Bảng 2.1 Thành phần hỗn hợp mix 19 Bảng 2.2 Thành phần phản ứng thêm vào hỗn hợp mix 19 Bảng 2.3 Thành phần hỗn hợp phản ứng realtime PCR 20 Bảng 2.4 Chu trình nhiệt phản ứng realtime PCR 20 Bảng 2.5 Trình tự cặp mồi XIAP, β-actin sử dụng phản ứng 21 Bảng 3.1 Kết đo nồng độ, độ tinh mẫu ARN dòng tế bào BT474 26 Bảng 3.2 Kết giá trị chu kỳ ngưỡng phát từ mẫu 29 Bảng 3.3 Kết giá trị 2-∆Ct trung bình phát giá trị p, 95%CI so sánh với mẫu đối chứng 30 Bảng 3.4 Kết so sánh tương đối theo công thức Livak 30 viii Nhận xét: Hình ảnh chụp điện di cho thấy mẫu thử (mẫu sản phẩm realtime RT-PCR thu được) xuất vết gần với vết tương ứng với đoạn gen 200 bp DNA marker Điều chứng tỏ sản phẩm thu sau phản ứng khuếch đại gen đoạn gen có độ dài khoảng gần 200 bp – phù hợp với kích thước đoạn gen cần khuếch đại XIAP 184 bp Tuy nhiên, để chắn sản phẩm khuếch đại sau phản ứng realtime RTPCR đoạn gen XIAP dự đoán, cần tiến hành giải trình tự đoạn gen khuếch đại sau phản ứng Sau đó, xử lý so sánh trình tự nucleotid với trình tự gen công bố ngân hàng gen 3.1.3.2 Kết giải trình tự gen thu sau phản ứng khuếch đại gen Sau phản ứng khuếch đại Realtime RT-PCR bước, sản phẩm làm tinh đọc trình tự đoạn gen khuếch đại Tiến hành xử lý phần mềm BioEdit Sequence Alignment Editor so sánh trình tự thu với trình tự gen cơng bố ngân hàng gen quốc tế Genbank NCBI (The National Center for Biotechnology Information) cung cấp dựa công cụ BLAST (Basic Local Alignment Search Tool) NCBI cung cấp Kết đọc trình tự đoạn gen khuếch đại sau xử lý phần mềm Bioedit Sequence Alignment Editor 7.0.5 sau: TTTTTGATAAAGTAAAGTGCTTTCACTGTGGAGGAGGGCTAACTGATTGGAAGCCCAGTG AAGACCCTTGGGAACAACATGCTAAATGGTATCCAGGGTGCAAATATCTGTTAGAACAG AAGGGACAAGAATATATAAACAATATTCATTTAACTCATTCACTTGAGGAGTGTCTGGTA AGAACTACAAA 27 Hình 3.5 Kết so sánh trình tự đoạn gen khuếch đại với trình tự gen công bố ngân hàng gen Genbank Nhận xét: Kết đối chiếu trình tự đoạn gen khuếch đại hoàn toàn trùng khớp (100%) với đoạn gen XIAP công bố Genbank với mã số: NR 037916.1, NM 001204401.1, NM 001167.3 Điều cho thấy cặp mồi sử dụng thí nghiệm bắt cặp khuếch đại đoạn gen đích dự đốn 3.1.4 Kết đánh giá tác dụng glycyl funtumin lên mức độ phiên mã gen XIAP Thực phản ứng realtime RT-PCR hai bước với mẫu thử thuốc nồng độ GF 3,0μg/mL 6,0μg/mL có sử dụng đối chứng âm mẫu nước mẫu đối chứng dương mẫu gen nội chuẩn actin, tín hiệu huỳnh quang thu từ mẫu biểu thị đồ thị hình 3.4 28 Hình 3.6 Hình ảnh đồ thị huỳnh quang thu từ phản ứng realtime PCR Nhận thấy, tín hiệu huỳnh quang tất mẫu vượt ngưỡng phát Như vậy, gen XIAP gen Actin biểu tất mẫu nhóm chứng nhóm thử dòng tế bào BT474 hai mức nồng độ Bảng 3.2 Kết giá trị chu kỳ ngƣỡng phát đƣợc từ mẫu Lần Lần Lần Đối chứng (XIAP) 25.77 25.7 26.16 Đối chứng (Actin) 23.05 22.16 23.13 AS3 (XIAP) 25.89 26.06 26.09 AS3 (Actin) 20.31 20.11 21.20 AS6 (XIAP) 25.92 26.20 25.67 AS6 (Actin) 25.76 25.17 25.13 Chu kỳ ngưỡng (CT) giá trị số chu kỳ khuếch đại phản ứng PCR mà từ chu kỳ đó, số lượng đủ lớn để thu nhận tín hiệu huỳnh quang vượt ngưỡng phát Giá trị CT nhỏ nghĩa số lượng mẫu ban đầu lớn, ngược lại, giá trị CT lớn nghĩa số lượng mẫu ban đầu nhỏ Kết giá trị chu kỳ ngưỡng thu từ mẫu đươc thể bảng 3.2 Theo công thức Livak (2001), kết đánh giá biểu gen đích so với biểu gen nội chuẩn tính thơng qua giá trị Kết phân tích thống kê so sánh tương đối phát 29 khác biệt biểu gen (gen đích XIAP gen nội chuẩn β-actin) hai nhóm đối chứng thử thuốc Aslem dòng tế bào BT474 thể bảng 3.3 Bảng 3.3 Kết giá trị trung bình phát đƣợc giá trị p, 95%CI so sánh với mẫu đối chứng Giá trị Mẫu Giá trị p, trung bình 95% CI XIAP 0.9202 0.7792 1.0497 0.9144 ± 0.1913 p = 0.0170 Actin 6.6807 4.1411 3.8106 3.9758 ± 0.2337 < 0.05 XIAP 0.9013 0.7071 1.4044 1.0558 ± 0.4931 p = 0.1031 Actin 0.1528 14.9285 7.7812 11.3549 ± 5.0539 > 0.05 AS AS Áp dụng cơng thức tính Livak (2001) để so sánh tác dụng thuốc Aslem nồng độ 3,0µg/mL nồng độ 6,0µg/mL sau 24 biểu gen XIAP so với gen tham chiếu β-actin dòng tế bào ung thư vú BT474, ta thu kết sau: Bảng 3.4 Kết so sánh tƣơng đối theo công thức Livak Giá trị trung bình AS3 0.1377 AS6 5.8971 0.1882 0.2755 0.0474 0.1805 0.2318 ± 0.0617 0.1139 ± 0.0941 Nhận xét: - Một là, sau 24 thử thuốc Aslem 3,0 µg/mL, gen XIAP cho thấy với độ tin cậy 95% nhóm thử có biểu trung bình 0.2318 ± 0.0617 lần, tức thấp trung bình 4.3141 lần so với nhóm đối chứng Ngồi ra, kết so sánh T-test: Two-sample Assuming Equal Variances (bảng 3.3.) nhóm kết nhóm thử thuốc Aslem 3,0 µg/mL nhóm đối chứng cho p = 0,0170 < 0.05 Điều chứng tỏ Glycyl-funtumin 3,0µg/mL có tác dụng làm giảm biểu gen XIAP tế bào ung thư vú BT474 có ý nghĩa thống kê, trung bình 4.3141 lần sau 24 30 thử thuốc - Hai là, sau 24 thử thuốc Aslem 6,0µg/mL, gen XIAP với độ tin cậy 95% cho thấy nhóm thử có biểu thấp trung bình 8.7796 lần so với nhóm đối chứng Tuy nhiên, kết so sánh T-test: Two-sample Assuming Equal Variances (bảng 3.3.) nhóm kết nhóm thử thuốc Aslem 6,0 µg/mL nhóm đối chứng cho p = 0,1031 > 0.05 Điều chứng tỏ Glycyl-funtumin 6,0 µg/mL có xu hướng làm giảm biểu gen XIAP tế bào ung thư vú BT474 sau 24 thử thuốc nhiên ý nghĩa thống kê 3.2 Bàn luận 3.2.1 Về q trình ni cấy tách chiết ARN Dòng tế bào BT474 dòng tế bào ung thư vú thường sử dụng nghiên cứu Chúng tiếp tục tiến hành nuôi cấy, thử thuốc, tách chiết ARN tổng số chạy phản ứng realtime RT-PCR hai bước để định lượng mức độ biểu gen XIAP tác động thuốc Aslem (glycyl funtumin hydroclorid) mức nồng độ khác sau 24 Sau tách chiết ARN tổng số dung mơi TRIzol, mẫu bị nhiễm ADN hay protein sót lại dịch chiết Do vậy, cần tiến hành quét phổ hấp thụ, đo nồng độ độ OD260, OD280 để xác định mức độ tinh mẫu để đảm bảo cho bước thí nghiệm Vì lý protein hấp thụ mạnh bước sóng 280nm acid nucleic có cực đại hấp thụ bước sóng 260nm quan hơn, bước sóng 280nm, độ hấp thụ acid nucleic giảm nửa protein có độ hấp thụ không thay đổi nhiều nên mẫu ARN coi tinh có tỷ lệ OD260/OD280 nằm khoảng 1,8 đến 2,2 Trong thí nghiệm chúng tơi, tất mẫu đảm bảo độ tinh dựa tỷ lệ OD260/OD280 Ngoài ra, ARN dễ bị phân hủy điều kiện nhiệt độ, enzym hay hóa chất,… nên q trình tách chiết cần đảm bảo thao tác cẩn thận, an toàn, bảo quản nitơ lỏng -80oC sau tách để giảm thiểu phân hủy ARN nâng cao suất tách chiết Trong khuôn khổ điều kiện phòng thí nghiệm, chúng tơi cố gắng chuẩn hóa điều kiện thí nghiệm, thao tác đảm bảo bảo quản sản phẩm tủ 80oC để tạo điều kiện tốt cho thí nghiệm sau 3.2.2 Về đánh giá mức độ biểu gen XIAP 31 Có nhiều phương pháp đánh giá biểu mARN, đó, phương pháp realtime RT-PCR Northern Blot thường hay sử dụng nhất.Tuy nhiên, lựa chọn phương pháp realtime RT-PCR để đánh giá biểu gen XIAP mức độ phiên mã Nguyên nhân phương pháp có độ nhạy cao, cho phép định lượng xác mức độ biểu mẫu Trong đó, Northern Blots cho phép phát định tính biểu gen có độ nhạy thấp, khó khăn việc phát đoạn ARN ngắn đồng thời lại đòi hỏi thời gian dài để thực Do vậy, lựa chọn realtime RT-PCR để đánh giá biểu gen XIAP nghiên cứu Và qua trình thử nghiệm đánh giá, xây dựng thành cơng quy trình đánh giá biểu gen XIAP mức độ phiên mã dòng tế bào BT474 sử dụng phương pháp realtime RT-PCR hai bước trình bày chương Định lượng realtime RT-PCR lại có hai loại định lượng tương đối định lượng tuyệt đối Định lượng tuyệt đối sử dụng cách xây dựng đường chuẩn để từ quy đổi xác định nồng độ biểu gen cần phân tích Trong đó, định lượng tương đối lại yêu cầu sử dụng thêm gen nội chuẩn hay gọi gen tham chiếu như: actin, GADPH, ubiquitin,… Các gen nội chuẩn gen cấu trúc điển hình, phiên mã liên tục để đảm bảo trì sống cho tế bào Sự biểu gen không chịu ảnh hưởng điều kiện thí nghiệm việc thử thuốc lên tế bào Vì lý này, gen nội chuẩn định lượng song song với gen cần phân tích điều kiện để hiệu chỉnh (normalize) làm kết đối chiếu phân tích kết [7, 29] Nghiên cứu Bala Gur-Dedeoglu cộng (2009) phân tích, xác định gen nội chuẩn thích hợp sử dụng định lượng tương đối biểu gen ung thư vú phản ứng realtime RT-PCR Kết cho thấy, số 18 gen nội chuẩn nghiên cứu, gen β – actin SDHA cho phù hợp lựa chọn gen tham chiếu để định lượng tương đối biểu gen ung thư vú phân tích số liệu từ phản ứng realtime RT-PCR [7] Vì lý đây, tiến hành đánh giá biểu gen XIAP mức độ phiên mã dòng tế bào BT474 sử dụng phương pháp realtime RT-PCR hai bước với gen nội chuẩn β-actin 3.2.3 Về ảnh hưởng glycyl funtumin lên mức độ phiên mã gen XIAP dòng tế bào BT474 Glycyl funtumin dạng muối hydroclorid hoạt chất thuốc 32 tiêm biệt dược Aslem – thuốc có định hỗ trợ điều trị ung thư sản xuất Việt Nam Tuy nhiên chế tác động tế bào ung thư thuốc chưa rõ ràng đòi hỏi nghiên cứu thêm Bước đầu nghiên cứu, tiến hành đánh giá ảnh hưởng glycyl funtumin lên phiên mã gen XIAP dòng tế bào ung thư vú BT474 hai mức nồng độ 3,0µg/mL 6,0µg/mL Sau 24 thử thuốc, tế bào có dấu hiệu sinh trưởng khơng bình thường Điều phần cho thấy thuốc (glycyl funtumin) có gây ảnh hưởng đến nhân lên, sinh trưởng tế bào ung thư vú Để xác định mức độ biểu gen XIAP giai đoạn phiên mã, tiến hành định lượng mARN XIAP phương pháp realtime RT-PCR hai bước quy trình xây dựng sử dụng gen β-actin làm gen nội chuẩn Kết cho thấy nồng độ 3,0µg/mL sau 24 giờ, thuốc làm giảm biểu mARN XIAP lần, có ý nghĩa thống kê (p0,05) so với gen nội chuẩn điều kiện Kết nghiên cứu cho thấy glycyl funtumin (thuốc Aslem) có ảnh hưởng định lên mức độ phiên mã gen XIAP tế bào ung thư vú BT474 nhiên chưa rõ ràng cần tiếp tục mở rộng nghiên cứu Mặc dù vậy, kết nghiên cứu tương đồng với kết nghiên cứu trước ảnh hưởng glycyl funtumin lên mức độ phiên mã gen survivin – gen thuộc họ gen ức chế trình apoptosis dòng tế bào ung thư khác Năm 2017, nghiên cứu TS.Đỗ Hồng Quảng cho kết glycyl funtumin 6,0µg/mL sau 24 làm giảm biểu gen survivin mức độ phiên mã dòng tế bào ung thư vú BT474 Glycyl futumin cho làm giảm mức độ phiên mã gen survivin dòng tế bào BT474 A549 - theo nghiên cứu Đường Hồng Nhung (2018) dòng tế bào HCT116 A549 – theo nghiên cứu Nguyễn Huyền Nhung (2017) Như vậy, thấy glycyl funtumin nồng độ thích hợp làm giảm mức độ phiên mã hai gen khác họ gen ức chế apoptosis survivin XIAP Hơn nữa, theo kết nghiên cứu công bố trước đây, gen thuộc họ IAPs biểu cao tế bào ung thư mà không bị ảnh hưởng tế bào lành [16, 17] Vì vậy, thuốc có tác dụng ức 33 chế IAPs tác động đích tế bào ung thư mà khơng gây độc tế bào lành, chứng tỏ IAPs đích tác dụng hoàn hảo phác đồ điều trị ung thư Glycyl funtumin, qua nghiên cứu dược động học thử nghiệm độc tính, liều LD50 cao gấp khoảng 12000 lần so với liều điều trị cho thấy glycyl funtumin có cửa sổ điều trị rộng, nay, chưa có báo cáo liên quan đến liều Aslem; liệu an toàn quan trọng liên quan đến sử dụng thuốc Aslem Vì vậy, chứng minh qua nhiều nghiên cứu tới ảnh hưởng tồn IAPs glycyl funtumin mở lối rẽ nghiên cứu sử dụng thuốc hướng đích IAPs điều trị ung thư lâm sàng tương lai Tóm lại, nghiên cứu chúng tơi bước đầu cung cấp quy trình đánh giá biểu mức độ phiên mã gen XIAP dòng tế bào ung thư vú BT474 cho thấy kết ban đầu, cung cấp nhìn tổng quan kết hạn chế nhiều nguyên nhân Việc tiếp tục thực nghiên cứu rộng nhiều mức nồng độ khác thuốc khoảng thời gian thử thuốc khác giúp đánh giá tổng quan hóa tương quan nồng độ thuốc mức độ tác động thuốc lên phiên mã gen XIAP tế bào ung thư vú BT474 Đồng thời, cần tiến hành nghiên cứu mở rộng ảnh hưởng glycyl funtumin lên biểu tất gen có họ gen ức chế q trình apoptosis để từ giải thích chế gây độc tế bào ung thư thuốc tiêm Aslem mở hướng nghiên cứu phát triển thuốc, hoạt chất điều trị ung thư hướng đích IAPs 34 KẾT LUẬN Qua q trình thực nghiệm đánh giá ảnh hưởng glycyl funtumin sau 24 lên mức độ phiên mã gen XIAP β-actin, thu kết quả:  Sau 24 thử thuốc Aslem 3,0 µg/mL, gen XIAP cho thấy nhóm thử thuốc biểu trung bình 0,2318 ± 0,0617 lần, tức thấp trung bình 4.3141 lần so với nhóm đối chứng có ý nghĩa thống kê (p = 0,01700,05) với độ tin cậy 95% 35 KIẾN NGHỊ Tiến hành mở rộng nghiên cứu ảnh hưởng glycyl funtumin lên biểu gen XIAP mức nồng độ khác khoảng thời gian nuôi cấy khác dòng tế bào ung thư vú BT474 số tế bào ung thư khác Ứng dụng mơ hình nghiên cứu kỹ thuật realtime RT-PCR để đánh giá ảnh hưởng glycyl funtumin lên mức độ biểu gen họ gen ức chế q trình apoptosis dòng tế bào ung thư khác 36 TÀI LIỆU THAM KHẢO Tiếng Việt [1] Đào Kim Chi (2006), Tổng kết đề tài thuốc kích thích miễn dịch Aslem, Tạp chí Dược học, số 367, 11A - 2016, tr 124-127 [2] Đào Thi Kim Chi (1984), Tổng hợp Funtumin, số peptidyl funtumin thăm dò tác dụng kích thích miễn dịch khơng đặc hiệu chúng, Luận án Phó Tiến sĩ Dược học, Trường Đại học Dược Hà Nội, Hà Nội [3] Lê Thị Thu Huyền (2011), Bước đầu nghiên cứu Dược Động Học Glycyl funtumin động vật thí nghiệm LC-MS/MS, Tr 3-4, Luận văn Thạc Sỹ Dược học, Trường Đại học Dược Hà Nội, Hà Nội [4] Lê Hà Phương (2016), Nghiên cứu mức độ biểu gen survivin số dòng tế bào ung thư, Khóa luận tốt nghiệp Dược sĩ, Hà Nội [5] Đỗ Hồng Quảng (2017), Ảnh hưởng glycyl-funtumin lên mức độ phiên mã gen survivin dòng tế bào ung thư phổi A549, Tạp chí Dược học, số 497, tr 5-6, 10 Tiếng Anh [6] A.D Schimmer, Shadi Dalili, RA Batey, SJ Riedl (2006), “Targeting XIAP for the treatment of malignancy”, Cell Death and Differentiation 13(2):179-88 [7] Bala Gur-Dedeoglu, Ozlen Konu, Betul Bozkurt, Gulusan Ergul, Selda Seckin, Isik G Yulug (2009), “Identification of Endogenous Reference Genes for qRT-PCR Analysis in Normal Matched Breast Tumor Tissues”, Oncology Research, Vol 17, pp 1–100 [8] Berthelet Jean, Laurence Dubrez (2013), "Regulation of apoptosis by inhibitors of apoptosis (IAPs)", Cells 2(1), pp 163-187 [9] Brentnall M, Rodriguez-Menocal L, De Guevara RL, Cepero E, Boise LH (2013), "Caspase-9, caspase-3 and caspase-7 have distinct roles during intrinsic apoptosis", BMC cell biology.14(1), pp 1-9 [10] Carrie E G et al., “Clinical Flow Cytometric Screening of SAP and XIAP Expression Accurately Identifies Patients with SH2D1A and XIAP/BIRC4 Mutations” [11] Chao Chen, Tian Shu Liu, Si Cong Zhao, Wen Zheng Yang, Zong Ping Chen, Yong Yan (2018), “XIAP impairs mitochondrial function during apoptosis by regulating the Bcl-2 family in renal cell carcinoma”, EXPERIMENTAL AND THERAPEUTIC MEDICINE 15: pp 4587-4593 [12] Christine Lukacs, Charles Belunis, Robert Crother, Waleed Danho, Lin Gao, Barry Goggin, Cheryl A.Janson, Shirley Li, Stacy Remiszewski, Andrew Schutt, Manish K Thakur, Saroj K.Singh, Srinivasan Swaminathan, Rajat Pandey, Rajiv Tyagi, Ramachandraiah Gosu, Ajith V Kamath, Andreas Kuglstatter (2013), “The structure of XIAP BIR2: understanding the selectivity of the BIR domains”, Acta Cryst D69, pp 1717–1725 [13] Daniela P de C T et al (2017), “High expression of XIAP and Bcl-2 may inhibit programmed cell death in glioblastomas”, Arq Neuropsiquiatr, 75(12), pp.875-880 [14] Deveraux Q L et al (1999), "IAP family proteins-suppressors of apoptosis", Genes & development 13(3), pp 239-252 [15] Devi G R (2004), “XIAP as target for therapeutic apoptosis in prostate cancer”, Drug News Perspect 17(2):127-34 [16] Dooreen Kunze, Daniela Wuttig, Susanne Fuessel, Kai Kraemer, Matthias Kotzsch, Axel Meye, Marc-Oliver Grimm, Oliver W Hakenberg, Manfred P Wirth (2008), “Multitarget siRNA Inhibition of Antiapoptotic Genes (XIAP, BCL2, BCL-XL) in Bladder Cancer Cells”, ANTICANCER RESEARCH 28, pp 2259-2264 [17] Dooreen Kunze et al (2012), “Simultaneous siRNA-mediated knockdown of antiapoptotic BCL2, Bcl-xL, XIAP and survivin in bladder cancer cells”, INTERNATIONAL JOURNAL OF ONCOLOGY 41: 1271-1277, pp.1-7 [18] Evans M.K et al (2016), “X-linked inhibitor of apoptosis protein mediates tumor cell resistance to antibody-dependent cellular cytotoxicity”, Citation: Cell Death and Disease 7, pp 1-11 [19] Gesche Frohwitter, Horst Buerger, Eberhard Korsching, Paul J van Diest, Johannes Kleinheinz, Thomas Filies (2017), “Site-specific gene expression patterns in oral cancer”, Head & Face Medicine 13:6, pp 1-9 [20] Giesen E M et al (1981), "The effect of LH1, an aminoacyl - steroid, on cultured hepatoma cells", Cancer Biochem, Byophys 5, pp 233-238 [21] James B Jaquith (2014), “Targeting the Inhibitor of Apoptosis Protein BIR3 Binding Domains”, Pharm Pat Anal 3(3), pp 297–312 [22] Jason B G et al, “Apoptosis: Physiology and Pathology”, Cambridge University Press, pp.11-21 [23] Jie-He W (2014), “20(s)-ginsenoside Rg3 promotes apoptosis in human ovarian cancer HO-8910 cells through PI3K/Akt and XIAP pathways”, Tumor Biol 35: pp 11985–11994 [24] Jijie Chai, Eric Shiozaki, Srinivasa M Srinivasula, Qi Wu, Pinaki Dataa, Emad S Alnemri, Yigong Shi (2001), “Structural Basis of Caspase-7 Inhibition by XIAP”, Cell Press, Vol 104, pp 769–780 [25] J.L.Marshall (2013), “Cancer Therapeutic Target”, Xiap Chapter , New York Springer Science Business Media [26] John Silke, Domagoj Vucic (2014), “XIAP - Caspase inhibitor”, Methods in Enzymology 2(2) [27] Kenneth J Livak, D Schmittgen (2001), “Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and CT the Method”, METHODS 25, pp 402–408 [28] Laurence D (2015), “IAP and cell migration”, Seminars in Cell & Developmental Biology, pp 1-8 [29] Naill S Kenneth, Colin S Duckett (2012), “IAP proteins: regulators of cell migration and development”, Current Opinion in Cell Biology 24, pp 871–875 [30] S Fulda (2014), “Regulation of cell migration, invasion and metastasis by IAP proteins and their antagonists”, Oncogene 33, pp 671–676 [31] S Ghavami, M Hashemi, S R Ande, B Yeganeh, W Xiao, M Eshraghi, C J Bus, K Kadlkhoda, E Wiechec, A J Halayko, M Los (2009), “Apoptosis and cancer: mutations within caspase Genes”, J Med Genet 46, pp 497-510 [32] Sida Q et al (2016), “XIAP inhibits mature Smac-induced apoptosis by degrading it through ubiquitination in NSCLC”, International Journal of Oncology [33] Steven M Chirieleison, Joseph K Rathkey, Derek W Abbott (2018), “Unique BIR domain sets determine inhibitor of apoptosis protein–driven cell death and NOD2 complex signal specificity”, Science Signaling 11, pp.1-10 [34] Tao Q et al (2015), “Characterization of an inhibitor of apoptosis protein in Crassostrea gigas clarifies its role in apoptosis and immune defense”, Developmental and Comparative Immunology 51, pp 74-75 [35] TK Oberoi-Khanuja, A Murali, Rajalingam (2013), “IAPs on the move: role of inhibitors of apoptosis proteins in cell migration”, Cell Death and Disease 4, pp 784 [36] Wright M E et al (2000), "Caspase-3 and inhibitor of apoptosis protein(s) interations in Saccharomyces cerevisiae and mammalian cells", FEBS letters.481(1), pp 13-18 [37] Yong Yang, Kun Liu, Libo Yang, Guoying Zhang (2017), “Bladder cancer cell viability inhibition and apoptosis induction by baicalein through targeting the expression of anti-apoptotic genes”, Saudi Journal of Biological Sciences Trang Web [38] University of Leicester, “Gene expression and regulation”: https://www2.le.ac.uk/projects/vgec/highereducation/topics/geneexpression-regulation [39] https://www.vinphaco.com.vn/product/b [40] The Global Cancer Observatory: https://gco.iarc.fr/ [41] wikipedia ... nucleotid Bảng 2.5 Trình t cặp mồi XIAP, β-actin đƣợc dùng phản ứng Trình t Gen XIAP β-actin Mồi xuôi 5’-GTGATAAAGTAAAGTGCTTTCACTGT-3’ Mồi ngược 5’-GTAGTTCTTACCAGACACTCCTCAA-3’ Mồi xuôi 5’-TCATGAAGTGTGACGTGGACATC-3’... NF-κB MAPK gián tiếp thông qua yếu t TGF-β thụ thể BMP có t ơng t c trực tiếp miền BIR-1 protein kinase ho t hóa TGF-β (TAK) liên k t với TAB-1, dẫn đến ho t hóa TAK-1, kích ho t NF-κB MAPK [27,... thấy vai trò đặc bi t quan trọng có t m ảnh hưởng rộng nhiều t bào khác 1.1.2.1 Vai trò ức chế ch t tế bào theo chu trình Apoptosis trình t bào ch t theo chu trình lập trình gen, phần ho t động
- Xem thêm -

Xem thêm: Nghiên cứu ảnh hưởng của Glycyl Funtumin lên mức độ phiên mã gen Xiap trên dòng tế bào BT474, Nghiên cứu ảnh hưởng của Glycyl Funtumin lên mức độ phiên mã gen Xiap trên dòng tế bào BT474

Gợi ý tài liệu liên quan cho bạn