Australian ant mimicking spiders

35 10 0
  • Loading ...
1/35 trang

Thông tin tài liệu

Ngày đăng: 13/07/2019, 06:31

Journal of of the the Linnean LinneanSociety, Society,2017, 2016.179, With 16 figures Zoological Journal 642–676 With figures Revision of eastern Australian ant-mimicking spiders of the genus Myrmarachne (Araneae, Salticidae) reveals a complex of species and forms rska 2, 611 37 Department of Botany and Zoology, Faculty of Sciences, Masaryk University, Kotla Brno, Czech Republic Queensland Museum, PO Box 3300, South Brisbane QLD, 4101, Australia Received 24 September 2015; revised 18 February 2016; accepted for publication 21 March 2016 Populations of many taxa are polymorphic as a result of interactions between different evolutionary processes One such taxon is the salticid spider genus Myrmarachne, which is under strong selection for myrmecomorphy resulting in an accurate mimetic resemblance to various ant species In revising eastern Australian Myrmarachne, we provide descriptions of four new species (Myrmarachne helensmithae sp nov., Myrmarachne macaulayi sp nov., Myrmarachne milledgei sp nov., and Myrmarachne zabkai sp nov.) and redescriptions of seven species [Myrmarachne bicolor (L Koch, 1879), Myrmarachne erythrocephala (L Koch, 1879), Myrmarachne luctuosa (L Koch, 1879), Myrmarachne lupata (L Koch, 1879), Myrmarachne macleayana (Bradley, 1876), Myrmarachne smaragdina Ceccarelli, 2010, and Myrmarachne striatipes (L Koch, 1879)] Myrmarachne jugularis Simon, 1900 is a junior synonym of M macleayana; Myrmarachne cognata (L Koch, 1879) and Myrmarachne simoni (L Koch, 1879) are synonyms of M luctuosa; Myrmarachne rubra Ceccarelli, 2010 is a junior synonym of M bicolor; and Myrmarachne cuprea (Hogg, 1896) is considered nomen dubium In a few species (M erythrocephala, M luctuosa, M macleayana, M milledgei sp nov., and M striatipes) we recognized at least two (discrete) forms that differ only in colour pattern Our phylogenetic analysis supports the existence of species groups and forms, but contradicts the designation of some species At present we find the eastern Australian fauna is thus composed of 11 Myrmarachne species, five of which have forms © 2017 2016 The Linnean Society of London, Zoological Journal of the Linnean Society, 2017 2016 doi: 10.1111/zoj.12439 ADDITIONAL KEYWORDS: Batesian mimicry – description – distribution – jumping spiders – myrmecomorphy – taxonomy INTRODUCTION Many taxa are polytypic, composed of populations showing subdivision into contiguous or discrete units (Mayr & Ashlock, 1991) Differences within populations, or intraspecific variation, is a result of interactions between many evolutionary processes, such as natural selection, geographic isolation, genetic drift, sexual selection, etc (Winston, 1999) Whether these populations represent species or lower taxonomic levels (subspecies, varieties, or forms) depends on *Corresponding author E-mail: pekar@sci.muni.cz the level of differentiation, which can be assessed by many criteria, including morphological differences, geographic distribution, genetic divergence, hybridization along contact zones, and the fertility of hybrids It is therefore important to know about the ecology and biology of taxa when deciding upon their taxonomic status Unfortunately, such knowledge is scarce, which is why few intraspecific taxa have been recognized and named (Winston & Metzger, 1998) Intraspecific variation has been reported in spiders (Araneae), but has rarely been evaluated taxonomically (Kraus, 2002) Contiguous or discrete geographic clines or units have been reported only for abundant and well-studied species, including Gasteracantha 2016 The The Linnean Linnean Society Societyof ofLondon, London,Zoological ZoologicalJournal Journalofofthe theLinnean LinneanSociety, Society,2017, 2016179, 642–676 © 2017 642 Downloaded from https://academic.oup.com/zoolinnean/article-abstract/179/3/642/3058146 by guest on 25 January 2019  1*, LENKA PETRAKOV   1, GUADALUPE CORCOBADO1 and STANO PEKAR A ROBERT WHYTE � ET AL S PEKAR 643 descriptions, however, lacked sufficient clarity, accuracy, and detail, resulting in many misidentifications (e.g Jackson, 1982, 1986) Recently, Ceccarelli (2010) described four new species from Queensland To date, 14 species have been reported to occur in Australia (World Spider Catalog, 2015) We compared Australian taxa with species described in Borneo (Yamasaki & Ahmad, 2013) and Indonesia (Yamasaki & Edwards, 2013), and found them to differ Intensive sampling of Myrmarachne specimens over several months along the eastern coast of Australia and detailed analysis of museum material allowed us to distinguish intraspecific from interspecific variation Our investigations revealed that Myrmarachne forms a complex of species and forms A form is characterized by small morphological difference, sympatry, little genetic divergence, and obligate hybridization with complete fertility (Winston, 1999) Four of the species that we found are new and described herein We also provide redescriptions of seven species treated in previous works We performed phylogenetic analysis to evaluate support for the results of morphological examination MATERIAL AND METHODS M ORPHOLOGICAL EXAMINATION All fresh specimens (> 400) included in this study were collected at various places across Australia, mainly along the eastern coast in recent years prior to 2015 Museum specimens from the Australian Museum in Sydney, the Queensland Museum in Brisbane, and the Queen Victoria Museum in Launceston were also studied In species that have been described recently (Ceccarelli, 2010), we provide a re-description that includes characters that have not been treated at all or have been treated improperly Diagnostic characters used to distinguish Myrmarachne species include habitus, shape of chelicera (basal segment, fang), and the shape of sexual organs (Wanless, 1978; Ceccarelli, 2010; Yamasaki & Ahmad, 2013) Diagnostic characters for males include the morphology of the retrolateral tibial apophysis (RTA), embolus and size of bulbus (depicted from ventral and retrolateral views) of the male palp (typically the left palp), and chelicera (depicted from ventral and dorsal side) Diagnostic characters in females include the morphology of the epigynal plate, atria, median pocket, copulatory ducts, and spermathecae In order to obtain illustrations of vulvae, dissected epigynes were cleared in 10% KOH at 60 °C for 15 Drawings emphasize important structures and remove distracting detail: for example, the dense © 2016 The Linnean Society of London, © 2017 The Linnean Society of London, Zoological Journal of the Linnean Society, Zoological 2017, 179, Journal 642–676 of the Linnean Society, 2016 Downloaded from https://academic.oup.com/zoolinnean/article-abstract/179/3/642/3058146 by guest on 25 January 2019 (Araneidae) (Kemp, Holmes & Congdon, 2013), Pholcus (Pholcidae) (Sch€ afer, Hille & Uhl, 2001), and Servaea (Salticidae) (Richardson & Gunter, 2012), where large quantities of material have been available to distinguish the units of subdivision So far the immensely rich araneofauna of Australia has been inadequately studied, and so it is expected that many species are yet to be discovered (Yeates, Harvey & Austin, 2003) Australia is rich in salticid spiders (Salticidae), with more than 400 species described to date (World Spider Catalog, 2015) One of the most enigmatic is the ant-mimicking Myrmarachne, which is also one of the most speciose salticid genera, with more than 220 species described worldwide (World Spider Catalog, 2015) Myrmarachne occurs on almost all continents, mainly in the tropical zone, with a few species extending to temperate zones Myrmarachne belongs to the Astoida clade (Maddison, 2015), which also includes several other antmimicking genera The genus Myrmarachne is not strongly supported by phylogenetic analysis (Edwards & Benjamin, 2009), and many taxonomic changes are expected Although species within Myrmarachne have been classified into groups on the basis of copulatory organ morphology, with ten groups having been distinguished so far (Wanless, 1978; Edwards & Benjamin, 2009), the classification of groups is still incomplete The taxonomy of this genus is complicated by myrmecomorphy, sexual dimorphism, transformational mimicry, and colour polymorphism With Batesian mimicry resulting in accurate myrmecomorphy in both morphology and behaviour, these spiders are often overlooked and thus undersampled Many factors, including sexual dimorphism, specifically the enlarged chelicerae in males of most species, make it difficult to match sexes Transformational mimicry (the imitation of different ant species during ontogenetic development; McIver & Stonedahl, 1993) makes it difficult to match juvenile stages with adults Many species possess colour variations where they imitate different ant species, resulting in the determination of different taxonomic units (e.g Nelson, 2010; Yamasaki & Ahmad, 2013) The first comprehensive treatment of Australian Myrmarachne spiders dates back to late 19th century when seven species were described by Koch (1879), one species was described by Bradley (1876), and another species was described by Simon (1900) These nine species were assigned to four different genera (Leptorchestes, Myrmarachne, Salticus, and Synemosyna) Later they were found to all belong to _ Myrmarachne (Zabka, 1991a,b) Early authors provided written descriptions and in most cases supplementary drawings The REVISION OF AUSTRALIAN MYRMARACHNE  644  S PEKÁR ET AL REVISION OF AUSTRALIAN MYRMARACHNE hair cover on cymbia is not shown Shading is used to indicate the coloration Scanning electron miscroscopy (SEM) pictures of genitals were obtained for most species The body part was dried by dipping it into ml of hexamethyldisilazane for 30 min, then mounted on a stub, and coated with gold prior to investigation under SEM Jeol JSM 648OLA and TESCAN VEGA TS 5136 XM Pictures of live specimens were taken by a Canon Legria HF G10 video camera Dead specimens were photographed by an Olympus ColorView digital camera attached to an Olympus SZX stereomicroscope Multi-focus montage images were composed using ANALYSIS software (Olympus) Colour is described from live specimens Specimens stored in ethanol lose their colour As colour is a very important character for the delineation of species and forms, some old museum material could not be adequately determined Measurements of carapace length and width (at the position of the posterior lateral eyes), abdomen length (excluding spinnerets), chelicera length, and total body length (including chelicera and spinnerets) are given as means with minimum and maximum values in parentheses ANOVA was used to compare measurements among forms of species, and was run in the R environment (R Core Team, 2013) product was mixed with lL of ExoSap (1 : diluted) and incubated at 37 °C for 15 min, followed by incubation at 80°C for 15 Purified products were sequenced in both directions with the BigDye Terminator v3.1 Sequence Kit (Life Technologies) Sequencing was carried out on an ABI 3730xl DNA Analyzer (Applied Biosystems) All sequences were assembled in SEQUENCHER 4.8 (Gene Codes Corporation, Ann Arbor, MI, USA) and aligned using ClustalW (Thompson, Higgins & Gibson, 1994), implemented in MEGA 5.1 (Tamura et al., 2011) Bayesian phylogenetic analysis based on the Markov chain Monte Carlo algorithm was performed in MrBayes 3.1.2 (Ronquist & Huelsenbeck, 2003), with the aim of obtaining a consensus tree assigning posterior probabilities of tree topology The data set was partitioned into four sets (COI, 16S rRNA, tRNALeu (CUN) , and NAD1 fragments) and the most appropriate model of nucleotide substitutions (for each partition and codon position separately) was selected using MrModeltest 2.2 (Nylander, 2004), based on the Akaike information criterion and hierarchical likelihood ratio tests Two runs with four chains were performed for 25 million generations under the general time reversible plus gamma (GTR + G) model of nucleotide substitution The GTR + G shape parameter was termed as the best model for each gene fragment Cosmophasis micarioides (L Koch, 1880) was selected as an out-group species [sequences were downloaded from the National Center for Biotechnology Information (NCBI) database: accession numbers EU815580 and EU815540] The first 25% of the sampled trees were discarded as burn-in The minimal effective sample size (ESS) highly exceeded the recommended threshold of 200 (Ronquist, Huelsenbeck & Teslenko, 2011), the potential scale reduction factor (PSRF) was equal to 1, and the plot of generation versus log likelihood values showed no trend (no increase or decrease over time), and thus the proper set up of the parameters was verified Phylogenetic trees were edited in FigTree 1.4.2 (Rambaut, 2014) Haplotype networks were constructed in TCS 1.21 (Clement, Posada & Crandall, 2000) Each gene fragment was analysed separately using the 95% parsimony cut-off (the probabilities of parsimony for pairwise differences ANALYSIS DNA was extracted from the legs of 50 individual spiders (kept in pure ethanol) using the prepGEMTM DNA Extraction – Insect kit (TATAA Biocenter), following the manufacturer’s protocol Two gene fragments, cytochrome c oxidase subunit I (COI) and 16S rRNA–tRNALeu(CUN)–NAD1, were amplified by polymerase chain reaction (PCR) using the primers presented in Table The reaction mixture contained lL of DNA template, 0.5 lL of each primer (10 lM), 6.3 lL of MyTaq Mix 29 (Bioline), and 3.2 lL of DNA-free water The PCR cycle conditions were as follows: initial denaturation at 94 °C for min; 35 cycles of 94 °C for 30 s, 40 °C (for COI) or 46 °C (for NAD1) for 30 s, 72 °C for 90 s, and a final extension at 72 °C for PCR products were purified with ExoSap: lL of the PCR Table List of gene fragments (primer name, sequence) used in the molecular analysis Gene fragment Primer name Primer sequence Reference Cytochrome c oxidase subunit I C1-J-1751 C1-N-2191 N1-J-12261 Faw16s2 50 –GGATCACCTGATATAGCATTCCC–30 50 –CCCGGTAAAATTAAAATATAAACTTC–30 50 –TCRTAAGAAATTATTTGAGC–30 50 –GCACCTCGATGTTGGATTAA–30 Simon et al (1994) Simon et al (1994) Hedin (1997a,b) Simon et al (1994) 16S rRNA–tRNALeu(CUN)–NAD1 © 2016 The Linnean Society©of2017 London, Zoological Journal of the Linnean Society, 2016of the Linnean Society, 2017, 179, 642–676 The Linnean Society of London, Zoological Journal Downloaded from https://academic.oup.com/zoolinnean/article-abstract/179/3/642/3058146 by guest on 25 January 2019 P HYLOGENETIC � ET AL S PEKAR REVISION OF AUSTRALIAN MYRMARACHNE  were calculated until the probability exceeded 95%) In the case of 16S rRNA–tRNALeu(CUN)–NAD1, the fragment was trimmed to obtain a data set of sequences without any missing nucleotides A BBREVIATIONS RESULTS T AXONOMY According to the shape of the sexual organs (of both sexes) and male chelicerae, all species treated below belong to four species groups: (1) Myrmarachne bicolor (L Koch, 1879), Myrmarachne macleayana (Bradley, 1876), and Myrmarachne milledgei sp nov.; (2) Myrmarachne helensmithae sp nov., Myrmarachne lupata (L Koch, 1879), Myrmarachne macaulayi sp nov., and Myrmarachne smaragdina Ceccarelli, 2010; (3) Myrmarachne erythrocephala (L Koch, 1879), Myrmarachne luctuosa (L Koch, 1879), Myrmarachne striatipes (L Koch, 1879); and (4) Myrmarachne zabkai sp nov We used the following criteria to distinguish species from forms: if a taxon differs in a combination of characters, namely colour pattern, body size, shape of prosoma, shape and dentition of chelicerae, shape of sexual organs (embolus and RTA in males; epigyne and spermathecase in females) we consider it a species; if it differs only in colour pattern and has sympatric distribution we consider it a form Taxa are arranged alphabetically below M YRMARACHNE BICOLOR (L KOCH, 1879) Salticus bicolor L Koch, 1879: 1055; pl 93, fig (D♂) Myrmarachne bicolor Rainbow (1911): 282 Myrmarachne rubra Ceccarelli, 2010: 246; figs 1–9 (D♂♀) syn nov _ ‘Myrmarachne spp.’ Davies & Zabka (1989): 203, fig 10, drawings of ♂ (habitus, palp, chelicera, leg) Type material Australia QLD: 1♂ holotype (ZMH, 16506), Peak Downs (23°040 S, 148°190 E) Material examined Australia QLD: 1♀ (QMB, S100144) (20 March 2013; I Macaulay) Ingham (18°390 16.27″S, 146°90 11.06″E); 1♂ (QMB, S100146) (11 November 2013; I Macaulay) same locality (18°390 18.39″S, 146°90 12.67″E); 1♀ (QMB, S100145) (1 March 2012; I Macaulay) same locality; 1♀ (QMB, S100147) (15 November 2012; I Macaulay) same locality; 1♂ (QMB, S100148) (15 November 2012; I Macaulay) same locality; 1♂ (MUB) (21 April 2014; I Macaulay) same locality; 1♂ (MUB) (21 April 2014; I Macaulay) same locality; 1♂ (QMB, S100131) (5 November 2014; I Macaulay) same locality (18°390 18.39″S, 146°90 12.67″E); 1♂ (QMB, S100149) (22 March 2013; I Macaulay) near Townsville (19°240 28.32″S, 146°440 3.53″E); 1♂ (AMS, KS.22137) (11 May 1975; N.C Coleman) Gordonvale (17°060 S, 145°470 E); 1♀ (AMS, KS.103148) (3 March 2008; G Milledge, H Smith) Emerald Creek Falls, picnic area (17°030 11″S, 145°320 29″E); 1♂ (QMB, S44254) (19 December 1997; G Monteith, D.J Cook) Expedition Ra NP, ‘Amphitheatre’ yards, open forest (25°130 0.012″S, 149°10 0.12″E); 3♂♂, 4♀♀ (QMB, S41398) (December 1971–January 1972; N Clyde, N Coleman) Trinity Beach (16°460 59.988″S, ar) 145°420 E); 1♀ (MUB) (25 March 2014; S Pek� Cairns, Cairns Botanic Gardens (16°530 57.563″S, 145°440 59.953″E); 1♂ (QMB, S66648) (11 March 200; F.S Ceccarelli) Townsville (19°190 39″S, 146°450 32″E); 1♀ (QMB, S73296) (5 June 1993; B.M Baehr) km south of Dimbulah (17°100 S, 145°060 E); 1♀ (AMS, _ KS.81341) (18 October 2002; M Zabka) Atherton area (17°160 S, 145°290 E); 1♂ (AMS, KS.5770) (15 June 1970; N.C Coleman) Wolfram (17°050 S, 144°570 E) NT, 1♂ (QMB, 73289) (5 November 1984; B Baehr) Fog Dam (12°340 10.9″S, 131°180 23 6″E) Diagnosis For details, see Ceccarelli (2010) Myrmarachne bicolor is most closely related to M macleayana Both sexes differ from this species by smaller body size and red/black body coloration Males of M bicolor further differ in the absence of apophysis on chelicera, wider and shorter RTA, longer and S–shaped embolus, and females in the presence of appendices on spermathecae This species is not diagnosable using DNA data (see below) © 2016 The Linnean Society of London, © 2017 The Linnean Society of London, Zoological Journal of the Linnean Society, Zoological 2017, 179, Journal 642–676 of the Linnean Society, 2016 Downloaded from https://academic.oup.com/zoolinnean/article-abstract/179/3/642/3058146 by guest on 25 January 2019 AME, anterior median eyes; AMS, Australian Museum, Sydney; CRW, private collection of Robert Whyte; CT, Capital Territory; Cx, coxa; F, adult female; Fe, femur; J, juvenile; M, adult male; MUB, collection of the Department of Botany and Zoology, Masaryk University, Brno; Mt, metatarsus; NSW, New South Wales; NT, Northern Territory; PLE, posterior lateral eyes; Pt, patella; PTB, ratio of length of palpal tibia to bulbus width; QLD, Queensland; QMB, Queensland Museum, Brisbane; RTA, retrolateral tibial apophysis; SA, South Australia; Ta, tarsus; TAS, Tasmania; Ti, tibia; Tr, trochanter; VIC, Victoria; QVM, Queen Victoria Museum and Art Gallery, Launceston; WA, Western Australia; ZMH, Zoological Museum, Hamburg 645 646  S PEKÁR ET AL REVISION OF AUSTRALIAN MYRMARACHNE Description Male: For a detailed description, see Ceccarelli (2010) Measurements: PTB = 0.79 Colour (Fig S1A): chelicera black, carapace yellow–brown, wedge of white hairs laterally on prosoma at the constriction; leg segments Cx I and II pale; abdomen red to black laterally, with white band Morphology: chelicereae on prolateral margin with five strong teeth, one small tooth near the base; fangs slightly sinusoid, tip curved (Fig 1A, B); leg spines Ti I and Mt I each with two ventral pairs; palpal cymbium oval, tegulum large, embolus long, coiled twice, distantly S–shaped, can be extending out of cymbium (Figs 1C, 2A); RTA narrow, slightly sinusoid, flange of RTA developed, rectangular (Figs 1D, 2B) Female: For a detailed description, see Ceccarelli (2010) Colour (Fig S1B): as in males Morphology: epigyne with oval, pale atria, two times wider than septum; spermathecae elongate, situated above septum (Figs 1E, 3A); spermathecae oval, anteriorly each with an appendix, copulatory ducts not twisted (Fig 1F) Natural history This species seems to imitate the ant Opisthopsis haddoni Emery, 1893 Remarks In all characters males of M bicolor and M rubra are identical According to Ceccarelli (2010), Myrmarachne gurgulla Ceccarelli, 2010 differs from Figure Myrmarachne bicolor: A, right male chelicera, dorsal view; B, left male chelicera, ventral view; C, left male palp, ventral view; D, male palpal tibia, dorsal view; E, epigyne, ventral view; F, vulva Scale barss: 0.2 mm © 2016 The Linnean Society©of2017 London, Zoological Journal of the Linnean Society, 2016of the Linnean Society, 2017, 179, 642–676 The Linnean Society of London, Zoological Journal Downloaded from https://academic.oup.com/zoolinnean/article-abstract/179/3/642/3058146 by guest on 25 January 2019 Distribution Australia: QLD, NT (Fig 4A)  ET AL S PEKAR REVISION OF AUSTRALIAN MYRMARACHNE  B C D E F G H I J K L M N © 2016 The Linnean Society of London, © 2017 The Linnean Society of London, Zoological Journal of the Linnean Society, Zoological 2017, 179, Journal 642–676 of the Linnean Society, 2016 Downloaded from https://academic.oup.com/zoolinnean/article-abstract/179/3/642/3058146 by guest on 25 January 2019 A 647 648  S PEKÁR ET AL REVISION OF AUSTRALIAN MYRMARACHNE Figure Scanning electron microscopy (SEM) of males: A, Myrmarachne bicolor, left male palp, ventral view; B, M bicolor, left male palpal tibia, dorsal view; C, Myrmarachne erythrocephala f erato, left male palp, ventral view; D, M erythrocephala, f ornata, left male palpal tibia, dorsal view; E, Myrmarachne helensmithae sp nov., right male palp, ventral view; F, M helensmithae sp nov., left male palpal tibia, dorsal view; G, Myrmarachne luctuosa f aeneopilosa, left male palp, ventral view; H, M luctuosa f aeneopilosa, left male palpal tibia, dorsal view; I, Myrmarachne macleayana f foreli, left male palp, ventral view; J, M macleayana f robsoni, right male palpal tibia, dorsal view; K, Myrmarachne smaragdina, left male palp, ventral view; L, M smaragdina, left male palpal tibia, dorsal view; M, Myrmarachne zabkai sp nov., left male palp, ventral view; N, M zabkai sp nov., left male palpal tibia, dorsal view B C D E Figure Scanning electron microscopy (SEM) of females: A, Myrmarachne bicolor, epigyne, ventral view; B, Myrmarachne erythrocephala f erato, epigyne, ventral view; C, Myrmarachne helensmithae sp nov., epigyne, ventral view; D, Myrmarachne luctuosa f aeneopilosa, epigyne, ventral view; E, Myrmarachne macleayana f robsoni, epigyne, ventral view M rubra only in the size of chelicera and in coloration A lack of material prevented more detailed comparative analysis We suggest that M gurgulla _ is most likely a form of M bicolor Davies & Zabka (1989) provide drawings of an unidentified species (M sp.) Based on the shape of chelicera and structures of palp we identified it as M bicolor In the _ same illustration Davies & Zabka (1989) combined a male of this species with a female of M luctuosa f aurea (see below) M YRMARACHNE CUPREA (HOGG, 1896) Leptorchestes cupreus Hogg, 1896: 352; figs 16–17 (D♀) Myrmarachne cuprea Rainbow (1911): 283 pl 24, © 2016 The Linnean Society©of2017 London, Zoological Journal of the Linnean Society, 2016of the Linnean Society, 2017, 179, 642–676 The Linnean Society of London, Zoological Journal Downloaded from https://academic.oup.com/zoolinnean/article-abstract/179/3/642/3058146 by guest on 25 January 2019 A  ET AL S PEKAR REVISION OF AUSTRALIAN MYRMARACHNE  649 Remarks Hogg (1896) provides a detailed description of the body colour and a drawing of a female epigyne, but the transfer to Myrmarachne by Rainbow (1911) appears erroneous, as the described colour, morphology, and epigyne not correspond to any known Myrmarachne spp Leptorchestes cupreus is thus considered nomen dubium M YRMARACHNE ERYTHROCEPHALA (L KOCH, 1879) Leptorchestes erythrocephalus L Koch, 1879: 1057; pl 93, fig (D♀) – forma erato Myrmarachne erythrocephala Simon (1901): 525 Leptorchestes simoni L Koch, 1879: pl 93, fig – new synonym, forma erato, only drawings of habitus Type material Australia QLD: 1♀ holotype forma erato (ZMH, 16507), Peak Downs (23°040 S, 148°190 E) Material examined Australia Forma erato: NSW, 1♀ (MUB) (7 February 2014; G Corcobado, S Pek ar) North Ryde, Macquarie University Campus (33°460 22.38″S, 151°60 51.056″E); juv (MUB) (26 February 2014; G Corcobado, S Pek ar) same locality; juv (MUB) (4 March 2014; © 2016 The Linnean Society of London, © 2017 The Linnean Society of London, Zoological Journal of the Linnean Society, Zoological 2017, 179, Journal 642–676 of the Linnean Society, 2016 Downloaded from https://academic.oup.com/zoolinnean/article-abstract/179/3/642/3058146 by guest on 25 January 2019 Figure Maps of distribution: A, Myrmarachne bicolor; B, Myrmarachne erythrocephala; C, Myrmarachne helensmithae sp nov.; D, Myrmarachne luctuosa; E, Myrmarachne lupata; Myrmarachne milledgei sp nov.; F, Myrmarachne macaulayi sp nov.; G, Myrmarachne macleayana; H, Myrmarachne smaragdina; I, Myrmarachne striatipes; J, Myrmarachne zabkai sp nov The size of the points is scaled according to abundance: 1–3 individuals (small); 4–10 individuals (medium); > 10 individuals (large) 650  S PEKÁR ET AL REVISION OF AUSTRALIAN MYRMARACHNE G Corcobado, S Pek ar) same locality; 1♀ (QMB, S100137) (28 October 2014; I Macaulay) Kyogle (28°360 55″S, 152°590 54″E); 2♀♀, juv (MUB) (9 July 2014; S Pek ar) Macquarie Port, Glebe city park (31°260 2.04″S, 152°540 32.068″E); 1F (MUB) (2 November 2012; I Macaulay) Uki, near Murwillunbah (28°240 42″S, 153°200 21″E) QLD: juv (MUB) (14 July 2014; S Pek ar) Hervey Bay, Scarness, city park (25°170 19.324″S, 152°510 34.513″E); 4♀♀, juv (MUB) (18 July 2014; S Pek ar) Marchoochydore, park along river (26°380 39.563″S, 153°40 47.125″E); 1♀, juv (MUB) (12 July 2014; S Pek ar) Duranbah, Tropical Fruit World (28°170 6.583″S, 153°310 42.729″E); 1♂ (QMB, S41390) (5 October 1980; V Salanitri) Redcliffe, Brisbane (27°130 59.988″S, 153°30 E); 1♀ (AMS) (16 July 2014; S Pek ar) Agnes Water, park (24°120 38.02″S, 151°540 18.432″E); 1♂ (QMB, S100130) (5 November 2004; I Macaulay) Ingham (18°390 18.39″S, 146°90 12.67″E); 1♀ (QMB, S100152) (22 November 2013; I Macaulay) Barron Gorge National Park, car park (16°500 10.55″S, 145°380 34.20″E); 1♀ (QMB, S100156) (10 March 2014; I Macaulay) same locality; 1♀ (QMB, S100155) (4 March 2012; I Macaulay) same locality; 1♀ (QMB, S100153) (1 November 2013; I Macaulay) Brisbane, Nudgee (27°220 21.59″S, 153°50 36.11″E); 1♂ (QMB, S100120) (9 January 2013; I Macaulay) Emerald (23°300 49.69″S, 148°90 35.58″E); 1♀ (QMB, S100118) (24 November 2011; I Macaulay) Stradbroke Island, Flinders Beach (27°250 08″S, 153°290 09″E); 1♀ (QMB, S100154) (26 December 2011; I Macaulay) Townsville (19°150 11.64″S, 146°480 36.24″E); juv (QMB, S100151) (19 February 2013; I Macaulay) Ingham (18°390 18.94″S, 146°90 12.37″E) WA: 1♀ (QMB, S73287) (28 November 1987; B Baehr, M Baehr) Stirling Range, Nth (34°220 56.3″S, 117°590 53.4″E); 1♀ (CRW) (24 October 2013; I Macaulay) Perth (31°570 43.70″S, 115°500 17.83″E) Forma daemeli: QLD, 1♂ (MUB) (18 July 2014; S Pek ar) Marchoochydore, park along river 153°40 47.125″E); 1♂ (MUB) (26°380 39.563″S, (16 July 2014; S Pek ar) Agnes Water, park (24°120 38.02″S, 151°540 18.432″E); 1♂, juv (MUB) (14 July 2014; S Pek ar) Hervey Bay, Scarness, city park (25°170 19.324″S, 152°510 34.513″E); 1♂ (QMB, S100150) (5 November 2013; I Macaulay) Torbanlea, near Marchyborough (25°200 43.52″S, 152°350 58.63 E); 1♂ (QMB, S100139) (30 October 2014; I Macaulay) Beerwah (26°510 27.69″S, 152°560 24.24″E) NSW: 1♂ (MUB) (9 July 2014; S Pek ar) Macquarie Port, Glebe city park (31°260 2.04″S, 152°540 32.068″E) Forma ornata: NSW: 4♂♂, 1♀, juv (MUB) (21 February 2014; G Corcobado, S Pek ar) North Ryde, Macquarie University Campus (33°460 22.38″S, 151°60 51.056″E); 1♀, juv (MUB) (18 March 2014; G Corcobado, S Pek ar) same locality; 1♂ (MUB) (9 July 2014; S Pek ar) Macquarie Port, Glebe City Park (31°260 2.04″S, 152°540 32.068″E); 1♂, juv (MUB) (12 July 2014; S Pek ar) Duranbah, Tropical Fruit World (28°170 6.583″S, 153°310 42.729″E) QLD: 2♂♂ (MUB) (18 July 2014; S Pek ar) Marchoochydore, park along river (26°380 39.563″S, 153°40 47.125″ E); 1♂ (QMB, S100132) (13 December 2014; I Macaulay) Ingham (18°390 18.39″S, 146°90 12.67″E) Diagnosis Most similar to M luctuosa It can be distinguished from M luctuosa by a smaller body size, centrally situated yellow patch on the dorsal side of abdomen, and the presence of lateral white stripes on the abdomen Furthermore, males can be distinguished by pointed apophyses on chelicera, narrow palpal Ti, straight RTA, and straight embolus Females can be recognized by oval atria Description Male: Measurements (N = 28): total body length 5.7 mm (4.1–7.5 mm), carapace length 2.6 mm (2.0– 3.2 mm), carapace width 1.3 mm (1.0–1.6 mm), chelicera length 0.9 mm (0.6–1.1 mm), abdomen length 2.7 mm (2.1–3.5 mm), PTB = 0.60 Colour (forma erato): overall body colour dark brown to black, in a few specimens red–brown; dorsal chelicerae and cephalic part of carapace reticulated with a metallic shine, thoracic part dark brown to black, covered with sparse yellow hairs; clypeus with white hairs, carapace covered with white or yellow hairs giving whitish or golden appearance in live specimen; endites and palps brown, labium and sternum dark brown; leg segments dark brown to black, except for Cx I, II, and IV, pale, Pt I, II, and IV, Ta II, Ti I, Tr II and IV, pale with longitudinal dark-brown to black lateral and retrolateral stripes; Pt IV with lateral white spot; abdomen dorsally with a yellow area in the middle, laterally with a white stripe so that ventrally there are stripes near to epigastric furrow (Fig 5F), anteriorly and posteriorly with yellow hairs: entire abdomen has golden shine with two black transverse stripes Morphology: chelicerae small, slightly protruding, with an apophysis on the prolateral side, three teeth on prolateral margin, and three or four teeth on retrolateral margin of chelicerae (Fig 5H, I); prosoma elongate dorsally with a shallow constriction (Fig 5A, E), cephalic part of carapace flat, as high as thoracic part (Fig 5E) leg spines: Ti I and II with two or three ventral pairs, Mt I and II each with two ventral pairs; abdomen © 2016 The Linnean Society©of2017 London, Zoological Journal of the Linnean Society, 2016of the Linnean Society, 2017, 179, 642–676 The Linnean Society of London, Zoological Journal Downloaded from https://academic.oup.com/zoolinnean/article-abstract/179/3/642/3058146 by guest on 25 January 2019 Etymology The forma names are derived from ant species they imitate (see Natural history) 10  ET AL S PEKAR REVISION OF AUSTRALIAN MYRMARACHNE  651 elongate with a shallow constriction (Fig 5A); palpal cymbium oval, with two apical spines, tegulum large and round, embolus coiled twice, tip of embolus straight (Figs 2C, 5J); RTA rather long, slightly sinusoid, flange of RTA not developed (Figs 2D, 5K) Female: Measurements (N = 17): total body length 6.0 mm (5.3–6.8 mm), carapace length 2.6 mm (2.3– 3.0 mm), carapace width 1.3 mm (1.2–1.5 mm), chelicera length 0.8 mm (0.5–1.3 mm), abdomen length 3.1 mm (2.6–3.7 mm) Colour (Fig S1C): as in males, but dorsal side of palpal Pt, Ta, and chelicera metallic Morphology: as in males (Fig 5G), but carapace and abdomen dorsally with more prominent constriction; epigyne with oval, whitish atria, separated with a septum, atria ~1.5 times wider than septum (Figs 3B, 5L); median pocket situated at base of septum so that the upper rim of the pocket is far below the lower rim of atria; spermathecae round, situated above atria, copulatory ducts not twisted (Fig 5M) Variation Forma ornata is represented by both sexes of a similar colour pattern (Fig S1E): chelicerae, legs, sternum, labium, palps, and venter of abdomen as in forma © 2016 The Linnean Society of London, © 2017 The Linnean Society of London, Zoological Journal of the Linnean Society, Zoological 2017, 179, Journal 642–676 of the Linnean Society, 2016 Downloaded from https://academic.oup.com/zoolinnean/article-abstract/179/3/642/3058146 by guest on 25 January 2019 Figure Myrmarachne erythrocephala: A, forma erato, female habitus, dorsal view; B, forma ornata, male habitus, dorsal view; C, forma daemeli, male habitus, dorsal view; D, forma ornata, female habitus, dorsal view; E, forma erato, male habitus, lateral view; F, forma erato, female abdomen, ventral view; G, forma erato, female habitus, lateral view; H, right male chelicera, dorsal view; I, left male chelicera, ventral view; J, left male palp, ventral view; K, male palpal tibia, dorsal view; L, epigyne, ventral view; M, vulva Scale bars: A–G, mm; H–M, 0.2 mm 662  S PEKÁR ET AL REVISION OF AUSTRALIAN MYRMARACHNE 21 most closely matches M macleayana: therefore, we consider M jugularis a junior synonym M YRMARACHNE MILLEDGEI  PEKAR SP NOV Type material Australia QLD: 1♂ holotype, forma rufithorax (AMS) (14 July 2014; S Pek ar) Hervey Bay, Scarness, city park (25°170 19.324″S, 152°510 34.513″E); 1♂ paratype, forma obtusa (AMS) (14 July 2014; S Pek ar) Hervey Bay, Scarness, 152°510 34.513″E) city park (25°170 19.324″S, Material examined Australia Forma rufithorax: QLD: subadult ♀ (MUB) (14 July 2014; S Pek ar) Hervey Bay, Scarness, city park (25°170 19.324″S, 152°510 34.513″E) Forma obtusa: QLD: subadult ♀ (MUB) (14 July 2014; S Pek ar) Hervey Bay, Scarness, city park (25°170 19.324″S, 152°510 34.513″E) © 2016 The Linnean Society©of2017 London, Zoological Journal of the Linnean Society, 2016of the Linnean Society, 2017, 179, 642–676 The Linnean Society of London, Zoological Journal Downloaded from https://academic.oup.com/zoolinnean/article-abstract/179/3/642/3058146 by guest on 25 January 2019 Figure 10 Myrmarachne macleayana: A, forma robsoni, male habitus, dorsal view; B, forma foreli, male habitus, dorsal view; C, forma robsoni, female habitus, dorsal view; D, forma foreli, female habitus, lateral view; E, forma foreli, female abdomen, dorsal view; F, forma robsoni, male habitus, lateral view; G, forma robsoni, female habitus, lateral view; H, right male chelicera, dorsal view; I, left male chelicera, ventral view; J, left male palp, ventral view; K, male palpal tibia, dorsal view; L, epigyne, ventral view; M, vulva Scale bars: A–G, mm; H–M, 0.2 mm 22  ET AL S PEKAR Etymology The species name is a patronym in honour of Graham Milledge for his kind help with the material deposited in AMS The forma names are derived from the ant species they seem to imitate (see Natural history) Description Male: Measurements (N = 2): total body length 8.6 mm, carapace length 3.1 mm, carapace width 1.6 mm, chelicera length 2.3 mm, abdomen length 663 3.4 mm, PTB = 0.46 Colour (forma rufithorax): chelicerae brown, dorsally reticulated, metallic; carapace orange to brown, but cephalic part dorsally black, a small orange patch in front of fovea; endites, labium, and palpal segments brown; Cx I and IV, pale; sternum, Fe I–Ta I, black, all other leg segments yellow– orange to brown; abdomen dorsally with proximal one-quarter orange, followed by transverse band of white hairs, rest black with a small orange patch in the middle (Fig 11A), ventrally black behind epigastric furrow Morphology: chelicerae protruding, with four strong and one small teeth, fangs straight with curved tip (Fig 11G, H); prosoma elongate (Fig 11A), carapace with a constriction behind PLE (Fig 11E), cephalic part of carapace flat, higher than thoracic part (Fig 11E); Cx I–IV with a ventral Figure 11 Myrmarachne milledgei sp nov.: A, forma rufithorax, male habitus, dorsal view; B, forma obtusa, male habitus, dorsal view; C, forma rufithorax, female habitus, dorsal view; D, forma obtusa, female habitus, dorsal view; E, forma A, male habitus, lateral view; F, forma A, female habitus, lateral view; G, right male chelicera, dorsal view; H, left male chelicera, ventral view; I, left male palp, ventral view; J, male palpal tibia, dorsal view Scale bars: A–F, mm; G–J, 0.2 mm © 2016 The Linnean Society of London, © 2017 The Linnean Society of London, Zoological Journal of the Linnean Society, Zoological 2017, 179, Journal 642–676 of the Linnean Society, 2016 Downloaded from https://academic.oup.com/zoolinnean/article-abstract/179/3/642/3058146 by guest on 25 January 2019 Diagnosis Most closely related to M macleayana Males can be distinguished by the rectangular flange of RTA, hooked RTA, and long sinusoid embolus REVISION OF AUSTRALIAN MYRMARACHNE  664  S PEKÁR ET AL REVISION OF AUSTRALIAN MYRMARACHNE Variation Both sexes of forma obtusa have chelicerae dark brown, carapace dark brown with a small orange patch in front of fovea, abdomen in proximal onequarter brown, followed by transverse band of white hairs, brown band, and a golden patch posteriorly (Fig 11B, D) Fe I–Ta I, endites, labium, and palpal segments brown; Cx I and IV, pale; sternum and all other leg segments, yellow–orange to brown Abdomen ventrally black behind epigastric furrow Distribution Known only from the type locality in QLD (Fig 4E) Natural history The spider hides under the bark of gum trees Forma rufithorax seems to imitate the ant Opisthopsis rufithorax Emery, 1895, whereas forma obtusa seems to imitate Polyrhachis obtusa Emery, 1897 M YRMARACHNE SMARAGDINA CECCARELLI, 2010 Myrmarachne smaragdina Ceccarelli, figs 28–36 (D♂♀) ‘Myrmarachne sp.’ Ceccarelli (2008) 2010: 250, Type material Australia QLD: 1♂ holotype (QMB, S66652, as designated by Ceccarelli, 2010) (28 August 2003; F.S Ceccarelli) Magnetic Island (19°090 11″S, 146°500 52″E); 1♀ paratype (AMS, KS.5771, as designated by Ceccarelli, 2010) (27 August 1970; R.E Mascord) Edmonton area (17°010 S, 145°450 E) NT: 1♂ paratype (AMS, KS.44998, as designated by Ceccarelli, 2010) (28 April 1938; D Citin) Berrimah Research Farm (12°260 S, 130°550 E); 1♂ paratype (AMS, KS.44999, as designated by Ceccarelli, 2010) (24 March 1988; D Citin) same locality Material examined Australia NT: 1♂ (QMB, S100092) (21 January 2013; I Macaulay) Darwin (12°270 58.41″S, 130°500 23.22″E); 1♂ (MUB) (26 September 2014; I Macaulay) Jarred Friday (12°270 58.41″S, 130°50 23.22 E); 1♂ (QMB, S100128) (3 December 2014; I Macaulay) same locality; 1♂ (QMB, S100127) (21 January 2013; I Macaulay) same locality QLD: 1♂ (QMB, S100091) (23 December 2011; I Macaulay) Cairns (16°540 49.72″S, 145°460 0.45 E); juv (CRW) (21 April 2014; I Macaulay) same locality; 1♂ (QMB, S100090) (23 February 2013; I Macaulay) Crystal Cascades (16°570 51.30″S, 145°390 58.06″E); 1♀ (AMS, KS.18235) (29 July 1969; N.C Coleman) Cairns (16°550 S, 145°460 E); 1♀ (AMS, KS.18969) (6 February 1972; N.C Coleman) Dundula (21°120 S, 149°090 E); 1♂, 1♀, juv (MUB) (23�25 March 2014; G Corcobado, S Pek ar) Cairns, Cairns Botanic Gardens (16°530 57.563″S, 145°440 59.953″E) 2♀, juv (MUB) (27 March 2014; G Corcobado) Townsville, James Cook University Campus (19°190 46.525 S, 146°450 39.265 E) Diagnosis See Ceccarelli (2010) This species is most closely related to M helensmithae sp nov., M lupata, and M macaulayi sp nov Both sexes of this species can be distinguished from the other species by the greenish body coloration and larger body size Males can be further differentiated by large chelicerae, heterogenous cheliceral dentition, robust apophysis on the fang, and shallow groove below RTA Females can be recognized by densely twisted copulatory ducts This species is not diagnosable using DNA data (see below) Description Male: Measurements: for details, see Ceccarelli (2010); PTB = 0.82 Colour (Fig S1Q): see Ceccarelli (2010) Morphology: cheliceral prolateral margin with three robust and two smaller teeth, retrolateral margin with nine smaller teeth (the number of teeth varies); fangs straight with a robust bent ventral apophysis near to base (Fig 12A, B), tips curved; palpal cymbium oval, with one apical spine; tegulum small and round; embolus coiled 1.5 times, sinusoid, pointing forwards (Fig 12C); RTA tiny, hooked at the tip, pointing dorsally, flange developed (Fig 12D, E) Female: Measurements and colour (Fig S1R): see Ceccarelli (2010) Morphology: epigyne with two round atria separated by a septum, atrium 1.2 times wider than septum; median pocket triangular, situated below septum with the upper rim almost at the level of lower rim of atria (Fig 12F); spermathecae elongate, copulatory ducts twisted above atria (Fig 12G) © 2016 The Linnean Society©of2017 London, Zoological Journal of the Linnean Society, 2016of the Linnean Society, 2017, 179, 642–676 The Linnean Society of London, Zoological Journal Downloaded from https://academic.oup.com/zoolinnean/article-abstract/179/3/642/3058146 by guest on 25 January 2019 process towards sternum; leg spines: Mt I and II, Ti I and II, with two ventral spines; abdomen elongate with a slight constriction (Fig 11E); palpal cymbium almost oval, tegulum large and round, embolus coiled almost twice, strongly sinusoid at tip (Fig 11I); RTA tiny and curved apically, with a large rectangular flange (Fig 11J) Female: Known only at subadult stage Measurements (N = 3): total body length 7.0 mm (6.0– 7.8 mm), carapace length 2.8 mm (2.6–2.8 mm), carapace width 1.4 mm (1.3–1.5 mm), chelicerae length 0.9 mm (0.6–1.1 mm), abdomen length 3.3 mm (2.8– 3.7 mm) Colour (forma rufithorax): as in males Morphology: as in males (Fig 11C, F), but palpal Pt–Ta flattened; chelicerae with seven teeth each on prolateral and retrolateral margins 23 24  ET AL S PEKAR REVISION OF AUSTRALIAN MYRMARACHNE  665 Distribution Australia: QLD, NT (Fig 4H) Remarks This species is very similar to Myrmarachne macrognatha (Thorell, 1894) from Flores, Indonesia (Yamasaki & Edwards, 2013), originally described from Java It differs only in the shape of prosoma and colour Myrmarachne smaragdina might be a form of M macrognatha, but more material of both species would be needed to resolve the status M YRMARACHNE STRIATIPES (L KOCH, 1879) Leptorchestes striatipes L Koch, 1879: 1059; pl 93, fig (D♀) Type material Australia NSW, QLD: 1♀ holotype forma striatipes (ZMH, 16508) (Daemel) Sydney and Rockhampton TAS: 1♂ paratype forma urens (AMS, KS.111025) (23 February 1987; J.L Hickman) Rufus Canal Rd (42°070 S, 146°070 E) 2♀♀ paratypes forma urens (QVM, 2014:13:125) (October 2013; S Fear) Launceston, Riverside, Denis Drive, Eucalyptus foliage (41°250 18.18″S, 147°060 28.39″E) Material examined Australia Forma striatipes: NSW: 1♀ (AMS, KS.34768) (15 February 1987; E.A Sugden) Nadgee Reserve, km south of Newton’s Beach (37°220 S, 149°550 E); 1♀ (AMS, KS.65516) (3 May 1998; L Wilkie) Wyrrabalong National Park (33°160 47″S, 151°320 40″E); 1♀ (AMS, KS.108226) (22 May 2009; G.A Milledge, H.M Smith) Gulaga NP, road to Mount Dromedary (36°170 13″S, 150°020 24″E); 1♀ (AMS, KS.101326) (12 December 2000; C.A Car) Wagga Wagga, edge of Murrumbidgee River (35°150 S, 144°040 E) Forma urens: TAS: juv (QVM, 2014:13:125) (October 2013; S Fearn) Launceston, Riverside, Denis Drive, Eucalyptus foliage (41°250 18.18″S, 147°060 28.39″E); 1♀ (QVM, 2014:13:122) (3 December 2013; S Fearn) Riverside, on gum trees © 2016 The Linnean Society of London, © 2017 The Linnean Society of London, Zoological Journal of the Linnean Society, Zoological 2017, 179, Journal 642–676 of the Linnean Society, 2016 Downloaded from https://academic.oup.com/zoolinnean/article-abstract/179/3/642/3058146 by guest on 25 January 2019 Figure 12 Myrmarachne smaragdina: A, right male chelicera, dorsal view; B, left male chelicera, ventral view; C, left male palp, ventral view; D, male palpal tibia, dorsal view; E, male palpal tibia, lateral view; F, epigyne, ventral view; G, vulva Scale bars: 0.2 mm 666  S PEKÁR ET AL (41°250 13.50″S, 147°060 26.80″E); 1♂ (QVM, 2014:13:123) (3 December 2013; S Fearn) same locality (41°250 12.18″S, 147°060 28.39″E); 1♀ (AMS, KS.70275) (20 February 1976; J.A Friend) at top of hill, west of Ropeway Creek (42°410 S, 145°480 E); 1♂ (AMS, KS.31070) (February 1964; J.L Hickman) Sandy Bay (42°540 S, 47°200 E) VIC: 1♂ (QMB, S100133) (6 February 2015; I Macaulay) Halls Gap (37°080 06.9″S, 142°310 11.3″E) Diagnosis Most similar to M luctuosa Differs from M luctuosa in brown body, golden patch at tip of abdomen Males further differ in wide bulbus, sinusoid tip of embolus, and elongate RTA Females differ in the distal position of the spermathecae This species is not diagnosable using DNA data (see below) Description Male: Measurements (N = 3): total body length 5.8 mm (4.6–7.9 mm), carapace length 2.4 mm (2.0– 3.0 mm), carapace width 1.3 mm (1.1–1.8 mm), chelicera length 0.9 mm (0.7–1.4 mm), abdomen length 2.9 mm (2.5–3.6 mm), PTB = 0.61 Colour (forma urens): chelicerae brown, carapace and sternum brown to black, carapace with whitish transverse stripe at the constriction; endites brown, palps brown to yellow; Cx I, Tr I, II, and IV, pale, Cx III, Tr III, brown, Fe I and II, yellow to brown, with longitudinal black bands on sides, Fe III and IV, brown, other leg segments yellow; abdomen brown, dorsally and laterally with three transverse whitish widely separated bands (Fig 13A), the distal quarter of abdomen golden Morphology: chelicera small, slightly protruding anteriorly with a lateral massive protuberance; fang semicircular, three teeth on prolateral margin, and four teeth on retrolateral margin of chelicerae (Fig 13F, G); prosoma elongate (Fig 13A), cephalic part of carapace dorsally flat, separated from thoracic part by a shallow constriction, cephalic part as high as thoracic part; leg spines: Ti I with three ventral pairs, Mt I, Mt II, Mt III, and Ti II each with two ventral pairs; abdomen elongate with a slight constriction; palpal bulbus wider than cymbium, embolus distally sinusoid (Fig 13H); RTA almost straight, elongate, flange of RTA developed (Fig 13I) Female: Measurements (N = 8): total body length 6.3 mm (4.5–8.1 mm), carapace length 2.4 mm (1.7–3.1 mm), carapace width 1.2 mm (0.9–1.7 mm), chelicera length 0.7 mm (0.4– 25 0.9 mm), abdomen length 3.4 mm (2.3–4.4 mm) Colour (forma striatipes) (Fig S1J): as in males, but legs are brown to yellow, abdomen brown, and laterally with white transverse stripes (Fig 13B, C, E), dorsoposteriorly with a small yellow patch Morphology: as in males, but chelicerae small (Fig 13B, C, E), with five teeth each on prolateral and retrolateral margins; leg spines: Ti I and Ti III with three ventral pairs, Mt I and Mt II with two ventral pairs; epigyne with two large oval whitish atria separated with a septum, the atria placed at a rather diverging angle (Fig 13J); median pocket situated below septum; spermathecae distantly separated from atria (Fig 13K) Variation The two forms differ only in coloration Males of forma striatipes are not known Females of forma urens (Fig 13D) lack the lateral white stripes on abdomen, but have golden distal part of abdomen Natural history It is not known which ant species forma striatipes imitates Forma urens was found on gum trees It occurs in the vicinity of the ant Myrmecia urens Lowne, 1865, which it imitates Distribution Australia: NSW (forma striatipes), VIC, TAS (forma urens) (Fig 4E) Remarks Although the type series includes only a single female, the label states two different places, far away from each other: one in NSW and the other in QLD We suggest that the specimen comes from NSW M YRMARACHNE ZABKAI  PEKAR SP NOV Type material Australia NSW: 1♂ holotype (AMS, KS.92295) (23 November�9 December 2004; J Gollan) Upper Hunter River, Keys Bridge at Muswellbrook (32°170 29″S, 150°500 49″E) QLD: 1♂ paratype (QMB, S100093) (17 December 2011; I Macaulay) Mossman (16°270 S, 145°220 E) NSW: 1♀ paratype (AMS, KS.92294) (23 November�9 December 2004; J Gollan) Upper Hunter River, Keys Bridge at Muswellbrook (32°170 29″S, 150°500 49″E) Material examined Australia QLD: 1♂ (MUB) (22 November 2013; I Macaulay) Barron Gorge National Park, dam © 2016 The Linnean Society©of2017 London, Zoological Journal of the Linnean Society, 2016of the Linnean Society, 2017, 179, 642–676 The Linnean Society of London, Zoological Journal Downloaded from https://academic.oup.com/zoolinnean/article-abstract/179/3/642/3058146 by guest on 25 January 2019 Etymology The forma names are derived either from the species name or from an ant species it imitates (see Natural history) REVISION OF AUSTRALIAN MYRMARACHNE 26  ET AL S PEKAR REVISION OF AUSTRALIAN MYRMARACHNE  667 (16°510 4.34″S, 145°380 48.67″E); 1♂ (QMB, S100095) (29 November 2013; I Macaulay) Marcheeba (17°00 9.14″S, 145°240 40.21″E); 1♂ (QMB, S100094) (27 February 2014; I Macaulay) same locality; 1♂ (MUB) (2 March 2012; I Macaulay) Cairns, Cattana Wetlands near University campus (16°490 S, 145°42 E); 1♀ (AMS, KS.22138) (28 August 1976; R.E Mascord) Marcheeba (17°000 S, 145°260 E); 1♂ (QMB, S100143) (11 December 2014; I Macaulay) same locality (17°00 36.84″, 145°250 30.09″); 1♂ (AMS, KS.18228) (11 August 1969; N.C Coleman) Cairns (16°550 S, 145°460 E); 1♂ (AMS, KS.18229) (18 October 1970; N.C Coleman) Cairns, Davis Creek (16°550 S, 145°460 E) NSW: 1♀ (AMS, KS.92289) (23 November December 2004; J Gollan) Upper Hunter River, Keys Bridge at Muswellbrook (32°170 29″S, 150°500 49″E); 1♀ (AMS, KS.92290) (23 November�9 December 2004; J Gollan) Kayuga Bridge at Muswellbrook (32°150 12″S, 150°530 16″E); 1♂ (AMS, KS.92293) (23 November�9 December 2004; J Gollan) Keys Bridge at Muswellbrook (32°170 29″S, 150°500 49″E); 1♀ (AMS, KS.92291) (23 November�9 December 2004; J Gollan) Jerrys Plains (32°310 04″S, 150°560 22″E); 1♀ (AMS, KS.92292) (23 November�9 December 2004; J Gollan) Jerrys Plains (32°310 05″S, 150°560 24″E); 1♀ (AMS, KS.98317) (17 January�1 February 2006; J Gollan) Metulla at Bureen (32°270 07″S, 150°440 09″E); 1♂ (QMB, S25340) © 2016 The Linnean Society of London, © 2017 The Linnean Society of London, Zoological Journal of the Linnean Society, Zoological 2017, 179, Journal 642–676 of the Linnean Society, 2016 Downloaded from https://academic.oup.com/zoolinnean/article-abstract/179/3/642/3058146 by guest on 25 January 2019 Figure 13 Myrmarachne striatipes: A, forma urens, male habitus, dorsal view; B, forma striatipes, female habitus, lateral view; C, forma striatipes, female habitus, dorsal view; D, forma urens, female habitus, dorsal view; E, forma striatipes, female abdomen, ventral view; F, forma urens, right male chelicera, dorsal view; G, left male chelicera, ventral view; H, forma urens, left male palp, ventral view; I, forma urens, male palpal tibia, dorsal view; J, forma striatipes, epigyne, ventral view; K, forma urens, vulva Scale bars: A–E, mm; F–K, 0.2 mm Photo D by J Douglass 668  S PEKÁR ET AL (1 February 1993; E Zillman) Bundaberg, Baldwins Swamp (24°520 0.012″S, 152°210 E) Etymology The species name is a patronym in honour of Marek _ Zabka, for his kind help with the literature Description Male: Measurements (N = 4): total body length 5.5 mm (5.3–5.6 mm), carapace length 2.0 mm (1.9– 2.1 mm), carapace width 1.2 mm (1.1–1.2 mm), chelicera length 1.5 mm (1.4–1.7 mm), abdomen length 1.9 mm (1.7–2.1 mm), PTB = 0.43 Colour (Fig S1S): chelicerae reticulated with metallic shine; clypeus with white hairs; carapace orange to brown, sparsely covered with white hairs; cephalic part dorsally dark brown to black, with black patches around eyes; sternum and endites light brown, palpal segments brown; leg segments yellow to brown, but Cx I and II, Pt I and II, Ti I and II, and Ta I–IV with black stripes on sides; abdomen dorsally dark brown with a white stripe on lateral sides in the constriction, ventrally light brown Morphology: chelicerae protruding, dorsally flat, with five strong retromarginal teeth and four smaller teeth, decreasing in size (Fig 4E, F); fangs sinuous with a single ventral strong apophysis and two tiny ones, curved tips (Fig 14F); prosoma elongate (Fig 14A, B), carapace with a shallow constriction behind PLE (Fig 14B), cephalic part of carapace higher than thoracic part; leg spines: Ti I with five ventral pairs, Mt I and II, Ti II with two ventral pairs; abdomen elongate with a constriction and two dorsal scuta (Fig 14D); palpal cymbium oval, tegulum large and round, embolus long, slender, straight at tip, coiled almost twice (Figs 2M, 14G); RTA narrow, sinusoid, flange not developed (Figs 2N, 14H) Female: Measurements (N = 2): total body length 5.2 mm (5.0–5.4 mm), carapace length 2.2 mm (2.1– 2.2 mm), carapace width 1.1 mm, chelicera length 0.5 mm, abdomen length 2.4 mm (2.1–2.6 mm) Colour: as in males Morphology: as in males, but chelicera small, cephalic part as high as thoracic part (Fig 14C, D); epigyne with atria kidney shaped, separated by a septum, atria 1.2 times wider than septum (Fig 14I); median pocket below septum; spermathecae elongate, copulatory ducts massively twisted above atria (Fig 14J) 27 Natural history This species seems to imitate the ant Opisthopsis haddoni Emery, 1893 Distribution Australia: QLD, NSW (Fig 4J) P HYLOGENETIC ANALYSIS Leu(CUN) The 16S rRNA–tRNA –NAD1 gene fragment (633 bp) was successfully amplified in 45 individuals, whereas the COI fragment (471 bp) was amplified in just 32 individuals Amplification of that fragment was not successful for the whole macleayana group, and partly also for M milledgei sp nov., M bicolor, and the luctuosa group The obtained sequences are available in the GenBank database (Table 2) Bayesian analysis resulted in five main clades, all which were very well supported (Fig 15) Myrmarachne erythrocephala, M luctuosa, and M striatipes are sister species, together forming a monophyletic group, distantly related to the rest Myrmarachne bicolor is closely related to M macleayana Myrmarachne milledgei sp nov can be placed in the macleayana clade, but its position was assessed based on a single individual and on the 16S rRNA–tRNALeu(CUN)–NAD1 gene fragment alone Myrmarachne helensmithae sp nov and M macaulayi sp nov are closely related species, differing at most by a single nucleotide in the case of both sequenced gene fragments Myrmarachne smaragdina was placed in the same clade as M macaulayi sp nov.; however, it has relatively high within-species divergence Although they came from the same site, the two individuals of M smaragdina differed by 2.3% in COI and 2.8% in the 16S rRNA–tRNALeu(CUN)–NAD1 fragment Within-group and within-species mean differences (p–distances) show clear delimitation of the species, with the exception of several inconsistencies in the luctuosa/striatipes clade (Table 3) Myrmarachne luctuosa f aurea collected at a Townsville site differed distinctly from M luctuosa f aurea collected at Brisbane and Scarness sites, although both gene fragments were amplified successfully in their whole lengths In the COI gene these samples differed by 4.67%, and even by 5.5% in the 16S rRNA–tRNALeu (CUN) –NAD1 fragment On the other hand, M luctuosa f aurea from Brisbane was very similar to M luctuosa f aeneopilosa from Sydney Myrmarachne luctuosa f aurea from Scarness was very similar to M luctuosa f aeneopilosa from Port Macquarie (both differing by just three bases within the concatenated fragments) Among the striatipes individuals (f urens from Tasmania and f striatipes from Wyrrabalong) only the 16S rRNA–tRNALeu © 2016 The Linnean Society©of2017 London, Zoological Journal of the Linnean Society, 2016of the Linnean Society, 2017, 179, 642–676 The Linnean Society of London, Zoological Journal Downloaded from https://academic.oup.com/zoolinnean/article-abstract/179/3/642/3058146 by guest on 25 January 2019 Diagnosis This species is related to M bicolor Males can be distinguished by the apophyses on fangs, longer teeth on chelicera, and tiny RTA Females can be distinguished by the kidney-shaped atria of the epigyne REVISION OF AUSTRALIAN MYRMARACHNE 28  ET AL S PEKAR REVISION OF AUSTRALIAN MYRMARACHNE  669 (CUN) –NAD1 gene was involved in the final data set Myrmarachne striatipes f striatipes differed from f urens by 4.4% Differences among the forms of Myrmarachne erythrocephala could not be revealed using the two molecular markers Haplotype networks (Fig 16) show the detailed relationships among the taxa studied, in terms of the exact number of mutation steps All specimens of three forms of M erythrocephala differ in less than five mutations in both genes Similarly, specimens of two forms of M macleayana differ in just two mutations But specimens of M luctuosa and M striatipes show quite a large variation in the number of mutations, particularly in the 16S rRNA–tRNALeu(CUN)– NAD1 gene And there is a big difference among M smaragdina specimens also DISCUSSION The complex of Myrmarachne taxa occurring in Australia is widespread and diverse Of the 14 species reported for Australia before this study and the newly described taxa treated here, none has been reported to occur outside Australia We consider it © 2016 The Linnean Society of London, © 2017 The Linnean Society of London, Zoological Journal of the Linnean Society, Zoological 2017, 179, Journal 642–676 of the Linnean Society, 2016 Downloaded from https://academic.oup.com/zoolinnean/article-abstract/179/3/642/3058146 by guest on 25 January 2019 Figure 14 Myrmarachne zabkai sp nov.: A, male habitus, dorsal view; B, male habitus, lateral view; C, female habitus, dorsal view; D, female habitus, lateral view; E, right male chelicera, dorsal view; F, left male chelicera, ventral view; G, left male palp, ventral view; H, male palpal tibia, dorsal view; I, epigyne, ventral view; J, vulva Scale bars: A– D, mm; E–J, 0.2 mm 670  S PEKÁR ET AL REVISION OF AUSTRALIAN MYRMARACHNE 29 Table List of genotyped Myrmarachne specimens and their accession numbers for two genes Accession no Species Sex Stage Locality COI 16S tRNA NAD1 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M M ♀ ♂ ♂ ♂ ♂ ♂ ♂ ♀ ♀ ♀ ♀ ♀ ♀ ♂ ♂ ♂ ♂ ♀ ♂ ♀ ♂ ♂ ♀ ♀ ♂ ♂ ♀ ♂ ♂ ♀ ♀ ♀ ♀ ♂ ♀ ♀ ♀ ♂ ♀ ♀ ♀ ♂ ♂ ♂ adult adult adult adult adult adult adult adult adult adult adult adult juvenile adult adult adult adult adult adult adult adult adult adult adult adult adult adult adult adult adult adult juvenile adult adult adult adult adult adult adult juvenile adult adult adult adult Cairns Port Macquarie Port Macquarie Marchoochydore Marchoochydore Brisbane Brisbane North Ryde North Ryde Marchoochydore Marchoochydore Port Macquarie Port Macquarie North Ryde North Ryde Marchoochydore Marchoochydore Duranbah Duranbah Cairns Cairns Townsville Townsville North Ryde Port Macquarie Townsville Townsville Scarness Brisbane Wyrrabalong Wagga Wagga Tasmania Cairns Cairns Cairns Cairns Cairns Cairns Cairns Scarness Cairns Cairns Cairns Cairns – KT364816 KT364817 KT364818 KT364819 KT364820 KT364821 KT364810 KT364811 KT364812 KT364813 KT364814 KT364815 KT364822 KT364823 KT364824 – KT364825 KT364826 KT364794 KT364795 KT364800 KT364801 KT364806 KT364808 KT364799 KT364798 KT364807 KT364809 – – – KT364802 KT364803 – – – – – – KT364796 KT364797 KT364804 KT364805 KT364840 KT364858 KT364859 KT364860 KT364861 KT364862 KT364863 KT364853 KT364854 KT364855 – KT364856 KT364857 KT364864 KT364865 KT364866 KT364867 KT364868 KT364869 KT364832 KT364833 KT364838 KT364839 KT364846 KT364848 KT364836 KT364837 KT364847 KT364849 KT364851 KT364852 KT364850 KT364841 KT364842 KT364827 KT364828 KT364829 KT364830 KT364831 KT364843 KT364834 KT364835 KT364844 KT364845 bicolor erythrocephala f daemeli erythrocephala f daemeli erythrocephala f daemeli erythrocephala f daemeli erythrocephala f daemeli erythrocephala f daemeli erythrocephala f erato erythrocephala f erato erythrocephala f erato erythrocephala f erato erythrocephala f erato erythrocephala f erato erythrocephala f ornata erythrocephala f ornata erythrocephala f ornata erythrocephala f ornata erythrocephala f ornata erythrocephala f ornata helensmithae sp nov helensmithae sp nov helensmithae sp nov helensmithae sp nov luctuosa f aeneopilosa luctuosa f aeneopilosa luctuosa f aurea luctuosa f aurea luctuosa f aurea luctuosa f aurea striatipes f striatipes striatipes f striatipes striatipes f urens macaulayi sp nov macaulayi sp nov macleayana f foreli macleayana f robsoni macleayana f robsoni macleayana f foreli macleayana f foreli milledgei sp nov f obtusa smaragdina smaragdina zabkai sp nov zabkai sp nov not unlikely that some Australian species may also occur in nearby neighbouring places, including Indonesia and Papua New Guinea Thirty Myrmarachne species have been reported to occur in the regions surrounding Australia (World Spider Catalog, 2015); however, the descriptions of one-third of these species either possess only habitus drawings or lack drawings altogether As the diagnostic characters for Myrmarachne species relate to sexual organs, these cannot be used for species identification Only the remaining two-thirds of the species, having modern, rigorous taxonomic treatment © 2016 The Linnean Society©of2017 London, Zoological Journal of the Linnean Society, 2016of the Linnean Society, 2017, 179, 642–676 The Linnean Society of London, Zoological Journal Downloaded from https://academic.oup.com/zoolinnean/article-abstract/179/3/642/3058146 by guest on 25 January 2019 No 30  ET AL S PEKAR REVISION OF AUSTRALIAN MYRMARACHNE  671 (Wanless, 1978; Edmunds & Proszy nski, 2003; Proszy nski & Deeleman-Reinhold, 2010; Yamasaki, 2012; Yamasaki & Ahmad, 2013; Yamasaki & Edwards, 2013), could be used for comparison with described species In doing this it was found that two species described from Indonesia appear very closely related to the Australian species: M acutidens is closely related to M lupata, and M macrognatha is very similar to M smaragdina In museum collections we came across taxa from NT resembling some species found in Indonesia These have not been included in the revision, as more and freshly collected material is needed This also applies to material from other states of Australia There are specimens in Australian museum collections that are not well preserved enough (particularly lacking coloration) to be used for diagnosis Specimens need to be collected in greater numbers to © 2016 The Linnean Society of London, © 2017 The Linnean Society of London, Zoological Journal of the Linnean Society, Zoological 2017, 179, Journal 642–676 of the Linnean Society, 2016 Downloaded from https://academic.oup.com/zoolinnean/article-abstract/179/3/642/3058146 by guest on 25 January 2019 Figure 15 Bayesian hypothesis for relationships among Australian Myrmarachne taxa based on DNA sequence data (cytochrome c oxidase subunit I and 16S rRNA–tRNALeu(CUN)–NAD1 gene fragments, concatenated data set, 1112 characters) Node number = posterior probability over 0.5 672  S PEKÁR ET AL REVISION OF AUSTRALIAN MYRMARACHNE 31 Table Average within-group and within-species p-distances among DNA sequences of Australian Myrmarachne COI NAD1 Forma M erythrocephala 0.0041 0.0053 M luctuosa 0.0235 0.0364 M smaragdina 0.0067 0.0107 M macleayana – 0.0033 (0.0270) M zabkai sp nov 0.0042 M M M M M M M M M M M M M M M erythrocephala f daemeli erythrocephala f erato erythrocephala f ornata luctuosa f aurea luctuosa f aeneopilosa striatipes f striatipes striatipes f urens helensmithae macaulayi smaragdina macleayana f foreli macleayana f robsoni bicolor milledgei zabkai COI NAD1 0.0057 0.005 0.0013 0.0308 0.0064 – – 0 0.0234 – – – – 0.0042 0.0056 0.0036 0.0037 0.0346 0.0017 0.0437 0.0017 0.0324 0.0052 0 0 COI, cytochrome c oxidase subunit I; NAD1, 16S rRNA–tRNALeu(CUN)–NAD1 gene fragments Numbers in bold highlight large distances A B Figure 16 Haplotype networks showing the number of mutation steps among mitochondrial DNA haplotypes of Australian Myrmarachne taxa: A, cytochrome c oxidase subunit I gene fragment, 468 bp long; B, 16S rRNA–tRNALeu(CUN)– NAD1 gene fragment, trimmed to 564 nucleotides Ovals represent single haplotypes; the numbers correspond to Myrmarachne samples (see Table 2); commas across lines connecting haplotypes represent the mutation steps Separated groups differed by more than 40 nucleotides © 2016 The Linnean Society©of2017 London, Zoological Journal of the Linnean Society, 2016of the Linnean Society, 2017, 179, 642–676 The Linnean Society of London, Zoological Journal Downloaded from https://academic.oup.com/zoolinnean/article-abstract/179/3/642/3058146 by guest on 25 January 2019 Clade 32  ET AL S PEKAR 673 to Nesticus carolinensis (Bishop, 1950) when using those gene fragments Masta (2000) noted that the last 553 bases at the 30 end of the 16S rRNA gene represent a highly conserved region Indeed, the primers that we have used amplified the last 158 bases of that gene only Huber et al (1993) postulated that the 16S gene is better suited for studying relationships at the family level and among higher taxa In contrast, Hedin (1997b) reported great differences among populations of a single species in the ND1 gene Forms of Myrmarachne species have already been noticed recently (e.g Yamasaki & Ahmad, 2013) Here we emphasize the existence of forms because of their ecological importance Future researchers may, when studying the ecology and biology of the taxa, find differences that could later be used to elevate forms into higher taxonomic ranks The forms here are not truly polymorphic, but discrete The forms are likely to be biotypes that may completely diverge and become a separate species in the future (e.g Pek ar et al., 2012); however, at present their differentiation is difficult and we assume that their segregation is incomplete This is in agreement with the phylogenetic species concept (Winston, 1999), yet we adhere to the biological species concept here for pragmatic reasons Overall, the taxa reviewed here differ in their appearance (mainly in coloration) more than in the morphology of their sexual organs For example, M macrognatha is identical to M smaragdina in the structure of sexual organs, but differs in the shape of prosoma and abdomen At present, it is difficult to say whether such somatic differences also indicate genetic divergence Identical morphology of sexual organs may allow hybridization (Croucher et al., 2007) Sibling species seem to have allopatric distribution, however, and are therefore reproductively isolated If the taxa have sympatric occurrence, as is the case for some forms, then it is more likely for them to hybridize It might be possible that different forms designated here (e.g those of macleayana or erythrocephala) are already reproductively isolated, and thus represent a different biospecies Although they occur sympatrically and syntopically, the pre-reproductive isolation may already be strong Salticid spiders have very good vision (Foelix, 2011), so the coloration may play a significant role in mate choice, which can lead to prezygotic reproductive isolation All Myrmarachne taxa covered here are myrmecomorphic Their diverse coloration and habitus is most likely a result of strong selection pressure from predators and success by mimicry to avoid falling prey to them Colour variation in Australian species is clearly discrete, not continuous, allowing us to © 2016 The Linnean Society of London, © 2017 The Linnean Society of London, Zoological Journal of the Linnean Society, Zoological 2017, 179, Journal 642–676 of the Linnean Society, 2016 Downloaded from https://academic.oup.com/zoolinnean/article-abstract/179/3/642/3058146 by guest on 25 January 2019 make it possible to disentangle intraspecific from interspecific variation Certainly, more species and forms are likely to be described in future One species described previously has not been tracked down Hogg (1900: 77) listed two species of Myrmarachne, M cognata and M sp nov., from central Australia, but did not provide any description of M sp nov., leaving this to Simon and the Peckhams; however, they did not publish any descriptions of Australian Myrmarachne after 1900 The results of the phylogenetic analysis only partially agree with the results of morphological analysis: with respect to classification into clades the two approaches produced congruent results, whereas in terms of species delimination the two methods are largely incongruent Whereas in some clades the genetic divergence was small and supported the existence of forms (the erythrocephala clade), in other clades (the luctuosa/striatipes clade) the genetic divergence was quite large, although morphological differences were small Unlike other clades, the luctuosa/striatipes clade is composed of individuals from a wide geographic area, which will have contributed to the divergence Yet in other clades, clear morphological differences are coupled with negligible genetic distances These divergent results could arise for many reasons, such as poor quality of sequence data (errors or contaminations), incomplete lineage sorting, inappropriate selection of gene fragments (see below), incorrect taxonomy, etc Such a high degree of incongruence between the taxonomy and phylogeny is unusual in spider research, and therefore requires further attention This spider group is, however, unusual among spiders in that all species are Batesian mimics Thus the short distances between, e.g M helensmithae sp nov., M macaulayi sp nov., and M smaragdina, could result from the recent origin of these taxa Indeed, in the tropics the selection for Batesian mimicry is strong and the speciation rate is high (Jablonski, Roy & Valentine, 2006) Results of the phylogenetic analysis are affected by the selected gene fragments We selected these two gene fragments because they were used by Ceccarelli (2010) Yet it appears that the combination of these gene fragments was not optimal, as only one of them was successfully amplified for some species We were not able to reveal differences among closely related species using 16S rRNA– tRNALeu(CUN)–NAD1 gene fragments alone (i.e without the COI gene) In M bicolor, M macleayana, M luctuosa, and M striatipes, only those gene fragments were used in the Bayesian analysis The phylogenetic relationships among these species are thus incomplete and not well supported Hedin (1997a,b) revealed the paraphyly of Nesticus mimus Gertsch, 1984 with respect REVISION OF AUSTRALIAN MYRMARACHNE  674  S PEKÁR ET AL 33 however, and are thus more often exposed to predators during mate searching, and it therefore appears that more than just mimicry is involved in male survival Nelson & Jackson (2006) suggested that males imitate an ant carrying a parcel in the chelicerae Although ants often carry nest mates, it is not clear whether imitating this would provide effective protection, or even whether ants carrying nest mates are more vulnerable to predation than those not doing so Chelicerae being used in male–male combat (Pollard, 1994) would suggest that large chelicerae appear to result from an interaction between at least two selection forces: sexual selection, which would lead to enlarged chelicerae, and selection for Batesian mimicry which, in turn, would lead to smaller chelicerae Sexual selection seems to be stronger than selection for Batesian mimicry in Myrmarachne males In this study we show that the taxonomic status of the genus Myrmarachne in Australia is complex, being composed of species groups that include forms In future it will be necessary to test the current taxonomical hypothesis using more Myrmarachne species, more specimens from different locations, more genes, and life-history data in order to resolve this enigmatic puzzle ACKNOWLEDGEMENTS We would like to thank: Debra Birch from the microscopy unit at the Faculty of Science, Macquarie University, and Ladislav Ilkovics from the Department of Histology and Embryology at the Medical Faculty, Masaryk University, for help take SEM pictures; R Raven and Owen Seeman for access to material deposited in the Queensland Museum, Brisbane; G Milledge for access to material deposited in the Australian Museum, Sydney; Judy Rainbird for access to material deposited in the Queen Victoria Museum and Art Gallery, Launceston; A Wessel, M Mistera, and S Toussaint from Zoologisches Museum, Hamburg, for taking pictures of the type material, and for access to Koch’s material; O H� ajek for drawing maps of the distribution; M Herberstein for providing financial support, covering some travel expenses; J Douglas and I Macaulay for providing photos of spiders; Eurofins Medigenomix GmbH (Ebersberg, Germany) for genotyping specimens; and _ M Rix and M Zabka for sharing their knowledge on Myrmarachne Igor Malenovrsk� y is thanked for advice on the taxonomic treatment of forms, and two reviewers and the editor are thanked for their useful comments G.C was supported by the program ‘Employment of newly graduated doctors of science for scientific excellence’ (CZ.1.07/2.3.00/30.009), © 2016 The Linnean Society©of2017 London, Zoological Journal of the Linnean Society, 2016of the Linnean Society, 2017, 179, 642–676 The Linnean Society of London, Zoological Journal Downloaded from https://academic.oup.com/zoolinnean/article-abstract/179/3/642/3058146 by guest on 25 January 2019 determine forms in M luctuosa, M erythrocephala, M milledgei sp nov., M macleayana, and M striatipes The forms can sometimes be distinguished even at later juvenile stages The early instars, in turn, imitate a different ant species (of smaller size, and often of different coloration) For example, early instars of M luctuosa seem to imitate the ant Rhytidoponera spp It was interesting to find that several Myrmarachne species from different clades have converged to the same ant model Specifically, Opisthopsis haddoni ants are mimicked by M helensmithae sp nov., M bicolor, and M zabkai sp nov Two of these species even occur syntopically Golden ants of the genus Polyrhachis (e.g P ammon, P aurea, P cupreata, P obtusa, and P ornata), Camponotus (e.g C aeneopilosus), and Myrmecia (e.g M piliventris) are imitated by forms of M macleayana, M luctuosa, M milledgei sp nov., and M erythrocephala This may indicate that certain ant species are more suitable models, in terms of abundance or noxiousness, than others In attempting to answer the question as to why colour polymorphism is so frequent in Myrmarachne, we considered the classical explanation based on frequency-dependent selection exerted by visually oriented ant-avoiding predators, such as birds, skinks, wasps, and some spiders A certain mimetic form may be selected when the abundance of the noxious model is higher than that of the mimic (Ruxton, Sherratt & Speed, 2004) If the mimic becomes relatively more abundant, attacks by predators on mimics would increase and the advantage provided by Batesian mimicry would be reduced Specimens imitating another sympatrically occurring and abundant ant model would then be selected for the lower attack rate; however, the fact that several species have converged on the same ant model does not support this explanation, as it would increase the likelihood of predator attacks on the model An alternative hypothesis, such as a greater noxiousness of the new ant model, might then explain the polymorphism Most Australian Myrmarachne species, like species of this genus on other continents, feature sexual dimorphism, most noticeable in the massively enlarged chelicerae in males In comparison with females, at least to the human eye, males seem to be less accurate mimics than females, which appear to be highly accurate (e.g M macleayana, M helensmithae sp nov., or M smaragdina) It is interesting, therefore, to consider whether males and females are under equally strong selection from predators (which should result in smaller chelicerae if larger chelicerae are seen as less successful mimicry) Males are generally the more active sex, REVISION OF AUSTRALIAN MYRMARACHNE 34 � ET AL S PEKAR co-financed from the European Social Fund and the state budget of the Czech Republic REFERENCES 675 Jackson RR 1982 The biology of ant-like jumping spiders: intraspecific interactions of Myrmarachne lupata (Araneae, Salticidae) Zoological Journal of the Linnean Society 76: 293–319 Jackson RR 1986 The biology of ant-like jumping spiders (Araneae, Salticidae): prey and predatory behaviour of Myrmarachne with particular attention to M lupata from Queensland Zoological Journal of the Linnean Society 88: 179–190 Kemp DJ, Holmes C, Congdon BC 2013 Color polymorphism in spiny spiders (Gasteracantha fornicata): testing the adaptive significance of a geographically clinal lure Ethology 119: 1126–1137 € Koch L 1879 Die Arachniden Australiens Nurnberg 1: 1045–1156 Kraus O 2002 Why no subspecies in spiders? In: Toft S, Scharff N, eds European Arachnology 2000: Proceedings of the 19th European Colloquium of Arachnology Aarhus: Aarhus University Press, 303–314 Maddison WP 2015 A phylogenetic classification of jumping spiders (Araneae: Salticidae) Journal of Arachnology 43: 231–292 Masta SE 2000 Mitochondrial sequence evolution in spiders: intraspecific variation in tRNAs lacking the TwC arm Molecular Biology and Evolution 17: 1091–1100 Mayr E, Ashlock PD 1991 Principles of systematic zoology, 2nd edn New York: McGraw-Hill McIver M, Stonedahl G 1993 Myrmecomorphy: morphological and behavioral mimicry of ants Annual Review of Entomology 38: 351–379 Nelson XJ 2010 Polymorphism in an ant mimicking jumping spider Journal of Arachnology 38: 139–141 Nelson XJ, Jackson RR 2006 Compound mimicry and trading predators by the males of sexually dimorphic Batesian mimics Proceedings of the Royal Society B 273: 367– 372 Nylander JAA 2004 MrModeltest v2 Program distributed by the author Evolutionary Biology Centre, Uppsala University � � Pek� ar S, Smerda J, Hru�skov� a M, Sedo O, Muster C, Cardoso P, Zdr� ahal Z, Korenko S, Bure�s P, L�ıznarov� a E, Sentensk� a L 2012 Prey-race drives differentiation of biotypes in ant-eating spiders Journal of Animal Ecology 81: 838–848 Pollard SD 1994 Consequences of sexual selection on feeding in male jumping spiders (Araneae: Salticidae) Journal of Zoology 234: 203–208 Pr� oszy� nski J, Deeleman-Reinhold CL 2010 Description of some Salticidae (Araneae) from the Malay Archipelago I Salticidae of the Lesser Sunda Islands, with comments on related species Arthropoda Selecta 19: 153–188 R Core Team 2013 R: a language and environment for statistical computing Vienna: R Foundation for Statistical Computing Available at: http://www.R-project.org/ Rainbow WJ 1911 A census of Australian Araneidae Records of the Australian Museum 9: 107–319 Rambaut A 2014 FigTree v1.4.2: Tree figure drawing tool Available at: http://treebioedacuk/software/figtree/ © 2016 The Linnean Society of London, © 2017 The Linnean Society of London, Zoological Journal of the Linnean Society, Zoological 2017, 179, Journal 642–676 of the Linnean Society, 2016 Downloaded from https://academic.oup.com/zoolinnean/article-abstract/179/3/642/3058146 by guest on 25 January 2019 Bradley HB 1876 On some new forms of Arachnidae Proceedings of the Linnean Society of New South Wales 1: 220– 224 Ceccarelli FS 2008 Behavioral mimicry in Myrmarachne species (Araneae, Salticidae) from North Queensland, Australia Journal of Arachnology 36: 344–351 Ceccarelli FS 2010 New species of ant-mimicking jumping spiders of the genus Myrmarachne MacLeay, 1839 (Araneae: Salticidae) from north Queensland, Australia Australian Journal of Entomology 49: 245–255 Clement M, Posada D, Crandall KA 2000 TCS: a computer program to estimate gene genealogies Molecular Ecology 9: 1657–1660 Clyne D 1977 A guide to Australian spiders Their collection and identification West Melbourne: Thomas Nelson Croucher PJ, Jones RM, Searle JB, Oxford GS 2007 Contrasting patterns of hybridization in large house spiders (Tegenaria atrica group, Agelenidae) Evolution 61: 1622– 1640 _ Davies VT, Zabka M 1989 Illustrated keys to the genera of jumping spiders (Araneae: Salticidae) in Australia Memoirs of the Queensland Museum 27: 189–266 Edmunds M, Pr� oszy� nski J 2003 On a collection of Myrmarachne spiders (Araneae: Salticidae) from peninsular Malaya Bulletin of the British Arachnological Society 12: 297–323 Edwards GB, Benjamin SP 2009 A first look at the phylogeny of the MyrMarchachninae, with rediscovery and redescription of the type species of Myrmarachne (Araneae: Salticidae) Zootaxa 2309: 1–29 Foelix RF 2011 Biology of spiders, 3rd edn Oxford: Oxford University Press Hedin M 1997a Molecular phylogenetics at the population/ species interface in cave spiders of the southern Appalachians (Araneae: Nesticidae: Nesticus) Molecular Biology and Evolution 14: 309–324 Hedin MC 1997b Speciational history in a diverse clade of habitat-specialized spiders (Araneae: Nesticidae: Nesticus): inferences from geographic-based sampling Evolution 51: 1929–1945 Hogg HR 1896 Araneidae In: Spencer B, ed Report of the Horn expedition to central Australia Zoology, 309–356 Hogg HR 1900 A contribution to our knowledge of the spiders of Victoria; including some new species and genera Proceedings of the Royal Society of Victoria 13: 68–123 Huber KC, Haider TS, Muller MW, Huber BA, Schweyen RJ, Barth FG 1993 DNA-sequence data indicates the polyphyly of the family Ctenidae (Araneae) Journal of Arachnology 21: 194–201 Jablonski D, Roy K, Valentine JW 2006 Out of the tropics: evolutionary dynamics of the latitudinal diversity gradient Science 314: 102–106 REVISION OF AUSTRALIAN MYRMARACHNE  676  S PEKÁR ET AL REVISION OF AUSTRALIAN MYRMARACHNE specific gap penalties and weight matrix choice Nucleic Acids Research 22: 4673–4680 Wanless FR 1978 On the identity of the spider Emertonius exasperans Peckham & Peckham (Araneae: Salticidae) Bulletin of the British Museum of Natural History (Zoology) 33: 235–238 Winston JE 1999 Describing species Practical taxonomic procedure for biologists New York: Columbia University Press Winston JE, Metzger KS 1998 Trends in taxonomy revealed by published literature BioScience 48: 125–128 World Spider Catalog 2015 World Spider Catalog Natural History Museum Bern Available at: http://wsc.nmbe.ch, version 16, accessed on 15 June 2015 Yamasaki T 2012 Taxonomy of the genus Myrmarachne of Sulawesi, based on the Thorell’s types and additional specimens (Araneae, Salticidae) Annali del Museo Civico di Storia Naturale Giacomo Doria 104: 153–180 Yamasaki T, Ahmad AH 2013 Taxonomic study of the genus Myrmarachne of Borneo (Araneae: Salticidae) Zootaxa 3710: 501–556 Yamasaki T, Edwards GB 2013 The genus Myrmarachne (Araneae, Salticidae) in Flores, Indonesia ZooKeys 299: 1–20 Yeates DK, Harvey MS, Austin AD 2003 New estimates for terrestrial arthropod species-richness in Australia Records of the South Australian Museum Monograph Series 7: 231–241 _ Zabka M 1991a Salticidae (Arachnida: Araneae) of Oriental, Australian and Pacific regions, VII Mopsolodes, Abracadabrella and Pseudosynagelides – new genera from Australia Memoirs of the Queensland Museum 30: 621–644 _ Zabka M 1991b Taxonomical and zoogeographical study of _ Salticidae (Arachnida: Araneae) in Australia Wyzsza Szkola Rolniczo-Pedagogiczna W Siedlcach Rozprawa Naukowa 32: 1–110 [in Polish] SUPPORTING INFORMATION Additional supporting information may be found online in the supporting information tab for this article: Figure S1 A Myrmarachne bicolor, male; B, Myrmarachne bicolor, female; C, Myrmarachne erythrocephala f erato, female; D, Myrmarachne erythrocephala f daemeli, male; E, Myrmarachne erythrocephala f ornata, male; F, Myrmarachne helensmithae sp nov., male; G, Myrmarachne helensmithae sp nov., female; H, Myrmarachne luctuosa f aeneopilosa, female; I, Myrmarachne luctuosa f aurea, male; J, Myrmarachne striatipes f urens, female; K, Myrmarachne macaulayi sp nov., male; L, Myrmarachne macaulayi sp nov., female; M, Myrmarachne macleayana f robsoni, male; N, Myrmarachne macleayana f robsoni, female; O, Myrmarachne macleayana f foreli, male; P, Myrmarachne macleayana f foreli, female; Q, Myrmarachne smaragdina, male; R, Myrmarachne smaragdina, female; S, Myrmarachne zabkai sp nov., male All photos by I Macaulay, except for (D), by J Douglass © 2016 The Linnean Society©of2017 London, Zoological Journal of the Linnean Society, 2016of the Linnean Society, 2017, 179, 642–676 The Linnean Society of London, Zoological Journal Downloaded from https://academic.oup.com/zoolinnean/article-abstract/179/3/642/3058146 by guest on 25 January 2019 Richardson BJ, Gunter NL 2012 Revision of Australian jumping spider genus Servaea Simon 1887 (Araneae: Salticidae) including use of DNA sequence data and predicted distributions Zootaxa 350: 1–33 Ronquist F, Huelsenbeck JP 2003 MrBayes 3: Bayesian phylogenetic inference under mixed models Bioinformatics 19: 1572–1574 Ronquist F, Huelsenbeck JP, Teslenko M 2011 Draft MrBayes version 3.2 manual: tutorials and model summaries Available at: http://mrbayes.sourceforge.net/mb3.2_ manual.pdf Ruxton GD, Sherratt TN, Speed MP 2004 Avoiding attack The evolutionary ecology of crypsis, warning signals and mimicry Oxford: Oxford University Press Sch€ afer MA, Hille A, Uhl GB 2001 Geographical patterns of genetic subdivision in the cellar spider Pholcus phalangioides (Araneae) Heredity 86: 94–102 Simon E 1900 Descriptions d’Arachnides nouveaux de la famille des Attidæ Annales de la Soci� et� e Entomologique de Belgique 44: 381–407 Simon E 1901 Histoire naturelle des araign�ees Paris 2: 381–668 Simon C, Frati F, Beckenbach A, Crespi B, Liu H, Flook P 1994 Evolution, weighting and phylogenetic utility of mitochondrial gene sequences and a comparison of conserved polymerase chain reaction primers Annals of the Entomological Society of America 87: 651–701 Tamura K, Peterson D, Peterson N, Stecher G, Nei M, KuMarch S 2011 MEGA5: molecular genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods Molecular Biology and Evolution 28: 2731–2739 Thompson JD, Higgins DG, Gibson TJ 1994 CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position- 35 ... Australia is rich in salticid spiders (Salticidae), with more than 400 species described to date (World Spider Catalog, 2015) One of the most enigmatic is the ant- mimicking Myrmarachne, which... different ant species, resulting in the determination of different taxonomic units (e.g Nelson, 2010; Yamasaki & Ahmad, 2013) The first comprehensive treatment of Australian Myrmarachne spiders. .. either from the species name or from an ant species it imitates (see Natural history) REVISION OF AUSTRALIAN MYRMARACHNE 26  ET AL S PEKAR REVISION OF AUSTRALIAN MYRMARACHNE  667 (16°510 4.34″S,
- Xem thêm -

Xem thêm: Australian ant mimicking spiders, Australian ant mimicking spiders

Gợi ý tài liệu liên quan cho bạn