Nghiên cứu dịch tễ học bệnh viêm phế quản truyền nhiễm (Infectious Bronchitis – IB) ở gà nuôi tại một số tỉnh miền Bắc Việt Nam (Luận án tiến sĩ)

159 13 0
  • Loading ...
1/159 trang
Tải xuống

Thông tin tài liệu

Ngày đăng: 15/03/2019, 00:49

Nghiên cứu dịch tễ học bệnh viêm phế quản truyền nhiễm (Infectious Bronchitis – IB) ở gà nuôi tại một số tỉnh miền Bắc Việt NamNghiên cứu dịch tễ học bệnh viêm phế quản truyền nhiễm (Infectious Bronchitis – IB) ở gà nuôi tại một số tỉnh miền Bắc Việt NamNghiên cứu dịch tễ học bệnh viêm phế quản truyền nhiễm (Infectious Bronchitis – IB) ở gà nuôi tại một số tỉnh miền Bắc Việt NamNghiên cứu dịch tễ học bệnh viêm phế quản truyền nhiễm (Infectious Bronchitis – IB) ở gà nuôi tại một số tỉnh miền Bắc Việt NamNghiên cứu dịch tễ học bệnh viêm phế quản truyền nhiễm (Infectious Bronchitis – IB) ở gà nuôi tại một số tỉnh miền Bắc Việt NamNghiên cứu dịch tễ học bệnh viêm phế quản truyền nhiễm (Infectious Bronchitis – IB) ở gà nuôi tại một số tỉnh miền Bắc Việt NamNghiên cứu dịch tễ học bệnh viêm phế quản truyền nhiễm (Infectious Bronchitis – IB) ở gà nuôi tại một số tỉnh miền Bắc Việt NamNghiên cứu dịch tễ học bệnh viêm phế quản truyền nhiễm (Infectious Bronchitis – IB) ở gà nuôi tại một số tỉnh miền Bắc Việt NamNghiên cứu dịch tễ học bệnh viêm phế quản truyền nhiễm (Infectious Bronchitis – IB) ở gà nuôi tại một số tỉnh miền Bắc Việt Nam HỌC VIỆN NÔNG NGHIỆP VIỆT NAM NGUYỄN THỊ LOAN NGHIÊN CỨU DỊCH TỄ HỌC BỆNH VIÊM PHẾ QUẢN TRUYỀN NHIỀM (INFECTIOUS BRONCHITIS - IB) NI TẠI MỘT SỐ TỈNH PHÍA BẮC VIỆT NAM LUẬN ÁN TIẾN SĨ NHÀ XUẤT BẢN HỌC VIỆN NÔNG NGHIỆP - 2018 HỌC VIỆN NÔNG NGHIỆP VIỆT NAM NGUYỄN THỊ LOAN NGHIÊN CỨU DỊCH TỄ HỌC BỆNH VIÊM PHẾ QUẢN TRUYỀN NHIỄM (INFECTIOUS BRONCHITIS - IB) NI TẠI MỘT SỐ TỈNH PHÍA BẮC VIỆT NAM Chuyên ngành: Dịch tễ học thú y Mã số: 9.64.01.08 Người hướng dẫn khoa học: PGS TS Lê Văn Phan TS Lê Huỳnh Thanh Phương HÀ NỘI - 2018 LỜI CAM ĐOAN Tôi xin cam đoan cơng trình nghiên cứu riêng tơi, kết nghiên cứu trình bày luận án trung thực, khách quan chưa dùng để bảo vệ lấy học vị Tôi xin cam đoan giúp đỡ cho việc thực luận án cảm ơn, thơng tin trích dẫn luận án rõ nguồn gốc Hà Nội, ngày 18 tháng 12 năm 2018 Tác giả luận án Nguyễn Thị Loan i LỜI CẢM ƠN Trong suốt thời gian học tập, nghiên cứu hoàn thành luận án, nhận hướng dẫn, bảo tận tình thầy giáo, giúp đỡ, động viên bạn bè, đồng nghiệp gia đình Nhân dịp hồn thành luận án, cho phép tơi bày tỏ lòng kính trọng biết ơn sâu sắc tới PGS TS Lê Văn Phan TS Lê Huỳnh Thanh Phương, Học viện Nông nghiệp Việt Nam tận tình hướng dẫn, dành nhiều cơng sức, thời gian tạo điều kiện cho tơi suốt q trình học tập thực đề tài Tôi xin bày tỏ lòng biết ơn chân thành tới Ban Giám đốc, Ban Quản lý đào tạo, Bộ môn Vi sinh vật - Truyền nhiễm, Bộ môn Bệnh lý thú y, Khoa Thú y - Học viện Nông nghiệp Việt Nam tận tình giúp đỡ tơi q trình học tập, thực đề tài hồn thành luận án Tơi xin chân thành cảm ơn tập thể lãnh đạo, cán Tập đoàn DABACO Việt Nam giúp đỡ tạo điều kiện cho tơi suốt q trình thực đề tài Tôi xin gửi lời cảm ơn đến đồng nghiệp công tác Công ty TNHH MTV AVAC Việt Nam, Trung tâm Chẩn đoán Thú y DABACO hỗ trợ cung cấp tài liệu nguyên liệu cần thiết để thực nghiên cứu Xin chân thành cảm ơn gia đình, người thân, bạn bè, đồng nghiệp tạo điều kiện thuận lợi giúp đỡ mặt, động viên khuyến khích tơi hồn thành luận án Hà Nội, ngày 18 tháng 12 năm 2018 Nghiên cứu sinh Nguyễn Thị Loan ii MỤC LỤC Lời cam đoan i Lời cảm ơn ii Mu ̣c lu ̣c iii Danh mu ̣c các ký hiê ̣u các chữ viế t tắ t vi Danh mu ̣c các bảng viii Danh mu ̣c các hiǹ h ix Trích yếu luận án xi Thesis abstract xiii Phần Mở đầu 1.1 Tính cấp thiết đề tài 1.2 Mục tiêu nghiên cứu 1.3 Phạm vi nghiên cứu 1.3.1 Đối tượng nghiên cứu 1.3.2 Phạm vi nghiên cứu 1.4 Những đóng góp đề tài 1.5 Ý nghĩa khoa học thực tiễn đề tài 1.5.1 Ý nghĩa khoa học đề tài 1.5.2 Ý nghĩa thực tiễn đề tài Phần Tổng quan tài liệu 2.1 Bệnh viêm phế quản truyền nhiễm 2.1.1 Lịch sử bệnh viêm phế quản truyền nhiễm giới .4 2.1.2 Tình hình bệnh vấn đề nghiên cứu bệnh Viêm phế quản truyền nhiễm Việt Nam 2.2 Đặc tính sinh học IBV 2.2.1 Đặc điểm hình thái, cấu trúc phân loại 2.2.2 Sức đề kháng, phương thức truyền lây IBV 15 2.2.3 Đặc tính ni cấy IBV 17 2.3 Đặc điểm phân tử virus viêm phế quản truyền nhiễm 19 2.3.1 Gen Glycoprotein S 20 2.3.2 Gen Glycoprotein S1 21 2.3.3 Gen Glycoprotein S2 22 iii 2.3.4 Nghiên cứu dịch tễ học IBV dựa genotype 22 2.4 Bệnh viêm phế quản truyền nhiễm .24 2.4.1 Dịch tễ học 24 2.4.2 Phương thức truyền lây .24 2.4.3 Cơ chế gây bệnh 25 2.4.4 Triệu chứng lâm sàng 26 2.4.5 Bệnh tích .27 2.5 Vacxin phòng bệnh 32 Phần Vật liệu phương pháp nghiên cứu 34 3.1 Địa điểm nghiên cứu 34 3.2 Thời gian nghiên cứu 34 3.3 Nội dung nghiên cứu 34 3.3.1 Ứng dụng kỹ thuật RT-PCR để chẩn đoán phát IBV nghiên cứu biến đổi bệnh lý IB 34 3.3.2 Nghiên cứu số đặc điểm dịch tễ IB gà ta ̣i mô ̣t số tin̉ h miền Bắc Việt Nam .34 3.3.3 Phân lập xác định số đặc tính sinh học chủng IBV phân lập 34 3.3.4 Phân tích trình tự gen xây dựng phả hệ 35 3.4 Vật liệu nghiên cứu 35 3.4.1 Vật liệu nghiên cứu cho nội dung 35 3.4.2 Vật liệu nghiên cứu cho nội dung 36 3.4.3 Vật liệu nghiên cứu cho nội dung 36 3.4.4 Vật liệu nghiên cứu cho nội dung 36 3.5 Phương pháp nghiên cứu 37 3.5.1 Phương pháp nghiên cứu cho nội dung 37 3.5.2 Phương pháp nghiên cứu cho nội dung 40 3.5.3 Phương pháp nghiên cứu cho nội dung 44 3.5.4 Phương pháp nghiên cứu cho nội dung 46 iv Phần Kết thảo luận 49 4.1 Ứng dụng kỹ thuật rt-pcr để chẩn đoán phát IBV nghiên cứu biến đổi bệnh lý IB 49 4.1.1 Ứng dụng kỹ thuật RT-PCR chẩn đoán phát IBV 49 4.1.2 Kết nghiên cứu số biến đổi bệnh lý IB 55 4.2 Đặc điểm dịch tễ ib số tỉnh miền bắc Việt Nam 67 4.2.1 Tình hình mắc IB số tỉnh miền Bắc Việt Nam 67 4.2.2 Xác định số yếu tố liên quan đến bệnh IB 73 4.3 Phân lập xác định số đặc tính sinh học chủng IBV phân lập 82 4.3.1 Phân lập IBV trứng có phơi 82 4.3.2 Xác định số đặc tính sinh học chủng IBV phân lập .86 4.4 Phân tích trình tự gen xây dựng phả hệ 91 4.4.1 Phân tích trình tự gen S1 xây dựng phả hệ 91 4.4.2 Phân tích trình tự gen S chủng IBV phân lập từ thực địa .99 4.4.3 Phân tích đặc điểm chủng IBV lưu hành miền Bắc Việt Nam 107 Phần Kết luận đề nghị 114 5.1 Kết luận .114 5.2 Đề nghị 114 Danh mục cơng trình cơng bố liên quan đến luận án 116 Tài liê ̣u tham khảo 117 Phụ lục 133 v DANH MỤC CÁC KÝ HIỆU VÀ CÁC CHỮ VIẾT TẮT Từ viết tắt Tên đầy đủ aa Amino acid BPL Betapropiolactone BHK-21 Baby hamster kidney-21 CAM Chorioallantois membrane cDNA Complementary deoxyribonucleic acid CEK Chicken embryo kidney CEL Chicken embryo liver CI Confidence interval CK Chicken kidney CPE Cytopathic effect E Envelop E.coli Escheriachia coli EID50 Embryo infection dose 50% ELD50 Embryo lethal dose 50% ED50 Embryo (infection or lethal) dose 50% ELISA Enzyme-linked immunosorbent assay DNA Deoxyribonucleic acid HI Haemagglutination inhibition HVR Hypervariable region IB Infectious bronchitis IBV Infectious bronchitis virus IFA Indirect immunofluorescent assay kb Kilo base kDa Kilo dalton M Membrane MAb Monoclonal antibodies mRNA Messenger ribonucleic acid N Nucleocapsid nt Nucleotide vi OIE World organisation for Animal health ORF Open reading frame ORT Ornithobacterium rhinotracheale PCR Polymerase chain reaction PBS Phosphate-buffered saline RFLP Restriction fragment length polymorphism RNA Ribonucleic acid RNP Ribonucleoprotein RR Relative risk hay Risk ratio RT-PCR Reverse transcriptase Polymerase chain reaction S Spike sM Small membrane SPF Specific pathogen free TAE Tris-acetate-ethylendiamin tetraacetic acid TOC Tracheal organ culture UTR Untranslated region VN Virus neutralization VNT Virus neutralization test vii DANH MỤC CÁC BẢNG TT Tên bảng Trang 3.1 Thành phần phản ứng PCR 39 3.2 Chu trình nhiệt phản ứng PCR 39 3.3 Bảng 2x2 quan hệ yếu tố khảo sát với IB theo đàn 43 4.1 Kết chẩn đoán IB phương pháp RT-PCR 54 4.2 Kết nghiên cứu triệu chứng lâm sàng chủ yếu mắc IB 57 4.3 Kết nghiên cứu biến đổi bệnh lý đại thể mắc IB 61 4.4 Sản lượng trứng đẻ mắc IB 62 4.5 Kết nghiên cứu biến đổi bệnh lý vi thể mắc IB 64 4.6 Tỉ lệ mắc IB địa bàn nghiên cứu 68 4.7 Tỷ lệ mắc IB theo lứa tuổi địa bàn nghiên cứu 69 4.8 Tỷ lệ mắc IB theo mùa địa bàn nghiên cứu 71 4.9 Yếu tố nguy phương thức chăn nuôi 73 4.10 Yếu tố nguy quy mô chăn nuôi 75 4.11 Yếu tố nguy tiêm phòng vacxin IB 76 4.12 Yếu tố nguy nguồn gốc giống 78 4.13 Yếu tố nguy vị trí trang trại 79 4.14 Yếu tố nguy vệ sinh chuồng trại 80 4.15 Thông tin chủng IBV phân lập 85 4.16 Kết kiểm tra thích nghi chủng IBV phôi 86 4.17 Kết tổng hợp số phôi chết số phôi nhiễm IBV nồng độ gây nhiễm 89 4.18 Kết tính EID50/ml ELD50/ml 90 4.19 Các chủng IBV tham chiếu sử dụng so sánh với chủng VNUA-HN01 94 4.20 Mức độ tương đồng nucleotide amino acid chủng VNUA-HN01 so sánh với chủng tham chiếu 95 4.21 So sánh mức độ tương đồng nucleotide amino acid gen S chủng IBV phân lập Việt Nam chủng IBV tham chiếu khác 101 viii 144 Otsuki K., M.B Huggins and J.K.A Cook (1990) Comparison of the susceptibility to avian infectious bronchitis virus infection of two inbred lines of white leghorn chickens Avian Pathol 19 pp 467-475 145 Pan G C., Y H Jiang, Y I Wang, Y D Wang, Z C Zhang, J Ding, X E Liu and Y Yang (1998) Isolation and identification of glandular stomach-pathogenic type infectious bronchitis virus in Beijing area Chin J Vet Sci Tech 28 (10) pp 21-22 146 Pak S I., H M Kwon, H J Yoon, C S Song, Y H Son, I P Mo, C Y Song (2005) Risk factors for infectious bronchitis virus infection in laying flocks in three provinces of Korea: preliminary results Korean J Vet Res (2005) 45(3) : 405-410 147 Parsons D., M M Ellis, D Cavanagh and J K A Cook (1992) Characterisation of an infectious bronchitis virus isolated from vaccinated broiler breeder flocks The Veterinary Record 131 pp 408-411 148 Raggi L.G and G.G Lee (1965) Lack of correlation between infectivity, serologic response and challenge results in immunization with an avian infectious bronchitis vaccine J Immunol 94 pp 538-543 149 Raj D G and R.C Jones (1997) Infectious bronchitis virus: Immunopathogenesis of infection in the chicken Avian Pathol 26 pp 677-706 150 Rajeswar J J., N Dorairajan and W M Paul (1998) Seroprevalence study of infectious bronchitis among poultry in Tamilnadu Ind Vet J 75 pp 973-974 151 Ramneek A and R McFarlane (1998) Sequence analysis of the S1 glycoprotein of New Zealand Infectious Bronchitis virus (IBV) strains Proceedings of the 4th Asia Pacifi c Health Conference P 139 Melbourne, Australia, 22–26 November, 1998 152 Ramneek N., L Mitchell and R.G McFarlane (2005) Rapid detection and characterisation of infectious bronchitis virus (IBV) from New Zealand using RTPCR and sequence analysis New Zealand Veterinary Journal 53 pp 6, 457-461 153 Ren X., J Yin, D Ma and G Li (2009) Characterization and membrane gene-based phylogenetic analysis of avian infectious bronchitis virus Chinese strain HH06, Virus Genes (2009) 38 pp 39-45 at https://doi.org/10.1007/s11262-008-0280-7 154 Riddell C (1987) In the Avian histopathology 1st ed [1987] American Association of Avian Pathologists (USA) 155 Rottier P J M (1995) in The Viruses, ed by Fraenkel-Conrat, H and Wagner, R R (The Coronaviridae, ed by Siddell, S G., chapter 6: The Coronavirus Membrane Glycoprotein) pp 115-139 129 156 Roussan D A., W S Totanji and G Y Khawaldeh (2008) Molecular subtype of infectious bronchitis virus in broiler flocks in Jordan, Poult Sci 87 pp 661-664 157 Schalk A.F and M C Hawn (1931) An apparently new respiratory disease of baby chicks, J Am Vet Med Assoc, 78, 413-422 158 Seifi S., K Asasi and A Mohammadi (2010) Natural co-infection caused by avian influenza H9 subtype and infectious bronchitis viruses in broiler chicken farms Veterinarski Arhiv pp 269-281 159 Seo S H, L Wang, R Smith and E W Collisson (1997) The carboxyl-terminal 120-residue polypeptide of infectious bronchitis virus nucleocapsid induces cytotoxic T lymphocytes and protects chickens from acute infection Journal of Virology 71 pp 7889-7894 160 Shieh H K., J H Shien, H Y Chou, Y Shimizu, J N Chen and P C Chang (2004) Complete nucleotide sequences of S1 and N genes of infectious bronchitis virus isolated in Japan and Taiwan J Vet Med Sci 66 pp 555-558 161 Smith H A and T C Jones (1966) Veterinary pathology 1st.- Philadelphia : Lea and Febiger, 1966-636.089/S649 162 Smith H W., J K A Cook and Z E Parsell (1985) The experimental infection of chickens with mixtures of infectious bronchitis virus and Escherichia coli Journal of General Virology 66 pp 777-786 163 Song C.S., Y.J Lee, J.H Kim, H.W Sung, C.W Lee, Y Izumiya, I Miyazawa, H K Jang and I Mikami (1998) Epidemiological classification of infectious bronchitis virus isolated in Korea between 1986 and 1997 AvianPathol 27 pp 409-416 164 Spencer K A and J A Hiscox (2006) Characterisation of the RNA binding properties of the coronavirus infectious bronchitis virus nucleocapsid protein amino-terminal region, FEBS letters 580 pp 5993-5998 165 Stern D F and B M Sefton (1982) Coronavirus proteins: biogenesis of avian infectious bronchitis virus proteins J Virol 44 pp 794-803 166 Sylvester S A., K Dhama, J M Kataria, S Rahul and M Mahendran (2005) Avian infectious bronchitis: A review Indian J Comp Microbiol Immunol Infect Dis Vol 26 (1) pp 1-14 130 167 Terregino C., A Toffan, M S Beato, R De Nardi, M Vascellari, A Meini, G Ortali, M Mancin and I Capua (2008) Pathogenicity of a QX strain of infectious bronchitis virus in specific pathogen free and commercial broiler chickens, and evaluation of protection induced by a vaccination programme based on the Ma5 and 4/91 serotypes Avian Pathology Avian Pathology (October 2008) 37 (5) pp 487493 168 Toffan A., C Terregino, E Mazzacan, I Castaldello, I Capua and M Bonci (2011) Detection of Chinese Q1 strain of infectious bronchitis virus in Europe Vet Rec 169 pp 212-213 169 Tom H (2011) BioEdit: An important software for molecular biology GERF Bulletin of Biosciences pp 60-61 170 Tran Ngoc Bich, Nguyen Phuc Khanh, Pham Hoang Dung and Nguyen Thi Cam Loan (2017) Molecular characterization of infectious bronchitis virus (IBV) isolated from commercial chicken farms Can Tho University Journal of Science 56-62 171 Tyrrell D A J., J D Almeida, D M Berry, C H Cunningham, D Hamre, M S Hofstad, L Mallucci and K McIntosh (1968) "Coronaviruses", Nature, London 220 pp 650 172 Tyrrell D A., J D Almeida, C H Cunningham, W R Dowdle, M S Hofstad, K McIntosh, M Tajima, L Y Zakstelskaya, B C Easterday, A Kapikian and R W Bingham (1975) "Coronaviridae", Intervirology pp 76-82 173 Umar S., M A A Shah, M T Munir, U Ahsan and K Kaboudi (2016) Infectious bronchitis virus: evolution and vaccination World’s Poultry Science Journal 72 pp 49-60 174 Valastro V., E C Holmes, P Britton, A Fusaro, M W Jackwood, G Cattoli and I Monne (2016) S1 gene-based phylogeny of infectious bronchitis virus: An attempt to harmonize virus classification Infect Genet Evol 39 pp 349-364 175 Wang H N., Q Z Wu, Y Huang and P Liu (1997) Isolation and identification of infectious bronchitis virus from chickens in Sichuan, China Avian Dis 41 pp 279282 176 Wickramasinghe I N., S J van Beurden, E A Weerts and M H Verheije (2014) The avian coronavirus spike protein Virus Res 194 pp 37-48 177 Williams A K., L Wang, L W Sneed and E W Collison (1992) Comparative analysis of the nucleocapsid genes of several strains of infectious bronchitis viruses and other coronaviruses Virus Research 25 pp 213-222 131 178 Worthington K J., R Currie and R C Jones (2008) A reverse transcriptasepolymerase chain reaction survey of infectious bronchitis virus genotypes in Western Europe from 2002 to 2006 Avian Pathol 37 pp 247-257 179 Xia J., X He, K C Yao, L J Du, P Liu, Q G Yan, Y P Wen, S J Cao, X F Han and Y Huang (2016) Phylogenetic and antigenic analysis of avian infectious bronchitis virus in southwestern China, 2012-2016 Infect Genet Evol 45 pp 1119 180 Yu L., Y Jiang, S Low, Z Wang, S J Nam, W Liu and J Kwangac (2001) Characterization of Three Infectious Bronchitis Virus Isolates from China Associated with Proventriculus in Vaccinated Chickens Avian Dis 45 pp 416-424 181 Yudong W., W Yonglin, Z Zichun, F GenChe and J Yihai (1998) Isolation and identification of glandular stomach type IBV (QX IBV) in chickens Chinese J Ani Quar 15 pp 1-3 182 Zanella A., A Lavazza, R Marchi, A Moreno martin and F Paganelli (2003) Avian Infectious Bronchitis: Characterization of New Isolates from Italy, Avian Dis 47 pp 180-185 183 Zhao W., M Gao, Q Xu, Y Xu, Y Zhao, Y Chen, T Zhang, Q Wang, Z Han, H Li, L Chen, S Liang, Y Shao and S Liu (2017) Origin and evolution of LX4 genotype infectious bronchitis coronavirus in China, Veterinary Microbiology 198 pp 9-16 184 Zhou J., I Yu and J Hong (1998) Isolation, identification and pathogenicity of virus causing proventricular-type infectious bronchitis, Chinese J Anim Poult Infect Dis 20 pp 62 185 Zou N., J Xia, F Wang, Z Duan, D Miao, Q Yan, S Cao, X Wen, P Liu and Y Huang (2015) Two novel neutralizing antigenic epitopes of the s1 subunit protein of a QX-like avian infectious bronchitis virus strain Sczy3 as revealed using a phage display peptide library Vet Immunol Immunopathol 168 pp 49-55 132 PHỤ LỤC Phụ lục So sánh trình tự nucleotide chủng ck/VN/VNUA-HN01/2014 với chủng tham chiếu ck/VN/VNUA-HN01/2014 cK/CH/SCLS/140104 CK/CH/LSD/08-10 S1 DY09 CK/CH/Chongqing/0908 J2 Q1 CK/CH/LDL/98I CoV/Ck/Italy/I2022/13 ck/CH/LDL/97I 4/91 Ma5 10 20 30 40 50 60 70 80 90 100 | | | | | | | | | | | | | | | | | | | | ATGTTGGGGAAGTCACTGTTTATAGTGACTCTTTTGTTTGCACTATGTAGTGCCGCTTTGTTTGATAATAATGAAACCGTTTACTACTACCAAAGTGCCT C AC.G T AC G A .TTTGC.T.A A ACTTA TA.CAC.T T AC .G .T .A C.G G.TCTTA G ck/VN/VNUA-HN01/2014 cK/CH/SCLS/140104 CK/CH/LSD/08-10 S1 DY09 CK/CH/Chongqing/0908 J2 Q1 CK/CH/LDL/98I CoV/Ck/Italy/I2022/13 ck/CH/LDL/97I 4/91 Ma5 110 120 130 140 150 160 170 180 190 200 | | | | | | | | | | | | | | | | | | | | TTAGACCGGCTGATGGATGGCATTTGCATGGTGGTGCTTATGCAGTAGTAAACGTTTCTTTAGAAACTAATAATGCAGGCACAGCTTCACAATGCATTGC G T.G.C.A T C.A G AT G T.AAT.G C C .T GT.TA TG.T C C AC .T A G G G T T TA AGT T T.TT.A TGGG T.C T ck/VN/VNUA-HN01/2014 cK/CH/SCLS/140104 CK/CH/LSD/08-10 S1 DY09 CK/CH/Chongqing/0908 J2 Q1 CK/CH/LDL/98I CoV/Ck/Italy/I2022/13 ck/CH/LDL/97I 4/91 Ma5 210 220 230 240 250 260 270 280 290 300 | | | | | | | | | | | | | | | | | | | | AGGGGCTATTTCTTGGAGTAAAAATTTCTCTGCTTCTGCTGTAGCCATGACTGCACCTGAGTTAGGGATGACGTGGTCAACTGGGCAATTCTGCACGGCT T TA T A.GAA CT.T A.T G T A.T ACCTGCT T T.T GT CA G T T A T TAT CA.G.TG CGTGT.G.TAA .T A T G GTCA.C T G.T T.GCA.T G T T T A ck/VN/VNUA-HN01/2014 cK/CH/SCLS/140104 CK/CH/LSD/08-10 S1 DY09 CK/CH/Chongqing/0908 J2 Q1 CK/CH/LDL/98I CoV/Ck/Italy/I2022/13 ck/CH/LDL/97I 4/91 Ma5 310 320 330 340 350 360 370 380 390 400 | | | | | | | | | | | | | | | | | | | | CACTGTAACTTCTCGGATTTTACAGTGTTCGTTACGCATTGTTTTAAACACGGTAACGGTCTATGCCCGCTAACAGGGCTTATTCCAAGTGGATTTATTC T G T A C T AGTCAAC.A AGT T AT.G TA.G TCAGAATCA T T A AC .T A .A T GGG T TA T CA.GC A.CAGCAT.C A ck/VN/VNUA-HN01/2014 cK/CH/SCLS/140104 CK/CH/LSD/08-10 S1 DY09 CK/CH/Chongqing/0908 J2 Q1 CK/CH/LDL/98I CoV/Ck/Italy/I2022/13 ck/CH/LDL/97I 4/91 Ma5 410 420 430 440 450 460 470 480 490 500 | | | | | | | | | | | | | | | | | | | | GTGTTTCTGCTATGAGGAAGGGAAGTAATTCCTTGTTTTATAATTTAACAGTTTCTGTGACTAAATATCCTAGATTTAAGTCGCTTCAATGTGTTAATAA A ATCT .TT AGC AT .C A A .GGC AA T C CAGC.T C .AG AG G C CT A AT G ck/VN/VNUA-HN01/2014 cK/CH/SCLS/140104 CK/CH/LSD/08-10 S1 DY09 CK/CH/Chongqing/0908 J2 Q1 CK/CH/LDL/98I CoV/Ck/Italy/I2022/13 ck/CH/LDL/97I 4/91 Ma5 510 520 530 540 550 560 570 580 590 600 | | | | | | | | | | | | | | | | | | | | TTATACATCTGTGTATTTAAATGGTGATCTTGTGTTCACTTCTAATGAAACTAAACCTGTTAGTGCAGCAGGTGTTTCTTTTAAAGCTGGTGGACCTATA C C .C C C .C T C A.CT.AC CG.GT C A .AG G G TA C A T.A C .CG C.C.GA CAT.T A 133 ck/VN/VNUA-HN01/2014 cK/CH/SCLS/140104 CK/CH/LSD/08-10 S1 DY09 CK/CH/Chongqing/0908 J2 Q1 CK/CH/LDL/98I CoV/Ck/Italy/I2022/13 ck/CH/LDL/97I 4/91 Ma5 610 620 630 640 650 660 670 680 690 700 | | | | | | | | | | | | | | | | | | | | ACTTACAAGACTATGAGTGAAGTTAAAGTCCTAGCTTATTTTGTCAATGGAACCGCACAAACTGTTATTCCTTGTGATGGTTCACCTAGAGGCTTGTTAG G .T AGT AA C C C A.T T .GAG TTA AAC T C.T T AGT A .G C G T T T GA .TTG G ck/VN/VNUA-HN01/2014 cK/CH/SCLS/140104 CK/CH/LSD/08-10 S1 DY09 CK/CH/Chongqing/0908 J2 Q1 CK/CH/LDL/98I CoV/Ck/Italy/I2022/13 ck/CH/LDL/97I 4/91 Ma5 710 720 730 740 750 760 770 780 790 800 | | | | | | | | | | | | | | | | | | | | CTTGTCAGTATAATACAGGCAATTTTTCAGATGGTTTCTACCCTTACACTAATAGTAGTTTAGTTAAGGAAAGGTTTATTGTTTATAGAGAAAGTAGTGT .A C T T A TT TC.TC T A C CAC A C T .C T T TT C.G.A .C C.T A ck/VN/VNUA-HN01/2014 cK/CH/SCLS/140104 CK/CH/LSD/08-10 S1 DY09 CK/CH/Chongqing/0908 J2 Q1 CK/CH/LDL/98I CoV/Ck/Italy/I2022/13 ck/CH/LDL/97I 4/91 Ma5 810 820 830 840 850 860 870 880 890 900 | | | | | | | | | | | | | | | | | | | | TAACACTACCTTAGTGTTAACTAATTTTACTTTCTCAAATGTTAGTAACGCCCCTCCTAATACAGGTGGTGTTCATAGTATTGTTTTACATCAAACACAA .T C C .T A C TA.T A T TT T .C G C.T.CCAA T T T T TAC CAC C TCAT AG.C.GG AAC A C.TA .C G.A CAAACTT.C ck/VN/VNUA-HN01/2014 cK/CH/SCLS/140104 CK/CH/LSD/08-10 S1 DY09 CK/CH/Chongqing/0908 J2 Q1 CK/CH/LDL/98I CoV/Ck/Italy/I2022/13 ck/CH/LDL/97I 4/91 Ma5 910 920 930 940 950 960 970 980 990 1000 | | | | | | | | | | | | | | | | | | | | ACAGCTCAGAGTGGTTATTATAATTTTAATTTCTCCTTTCTGAGTAGTTTCCGTTATGTAGAATCAGATTTTATGTATGGGTCATACCACCCAAAATGTT T .A A T GA A A TGTG AA.CC T T A T .TGT AAG G TA A T T .GT A ck/VN/VNUA-HN01/2014 cK/CH/SCLS/140104 CK/CH/LSD/08-10 S1 DY09 CK/CH/Chongqing/0908 J2 Q1 CK/CH/LDL/98I CoV/Ck/Italy/I2022/13 ck/CH/LDL/97I 4/91 Ma5 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 | | | | | | | | | | | | | | | | | | | | CATTTAGACTAGAAACTATTAATAATGGTTTGTGGTTTAATTCACTTTCGGTTTCTCTTGGTTATGGTCCACTACAGGGTGGTTGTAAGCAATCTGTGTT C C C C C C C C C AT .C G.A C A T.A T G A AC C A CA.T A T AT .A AA C C T T A C C ck/VN/VNUA-HN01/2014 cK/CH/SCLS/140104 CK/CH/LSD/08-10 S1 DY09 CK/CH/Chongqing/0908 J2 Q1 CK/CH/LDL/98I CoV/Ck/Italy/I2022/13 ck/CH/LDL/97I 4/91 Ma5 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 | | | | | | | | | | | | | | | | | | | | TAATAATATGGCAACTTGTTGTTATGCTTATTCATATAGTGGTCCCACACTATGTAAAGGTGTTTATAGTGGTCAGTTACAAAAAACTTTTGAGTGTGGG G .G G AA C T CC.A T TAG G A GG C ACGC TAC A A G.GG GA C C G.A TTTG G .TCA G G.TC.T.A A A 134 ck/VN/VNUA-HN01/2014 cK/CH/SCLS/140104 CK/CH/LSD/08-10 S1 DY09 CK/CH/Chongqing/0908 J2 Q1 CK/CH/LDL/98I CoV/Ck/Italy/I2022/13 ck/CH/LDL/97I 4/91 Ma5 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 | | | | | | | | | | | | | | | | | | | | TTGCTGGTTTTTGTGACTAAGAGCGATGGCTCTCGTATACAAACTAGAAATGAACCACTTGTGTTAACTCAGCACAATTACAATAATATTACTTTAAATA C.T A A A T .G .G AT.T T C C C T.A A T G AGCC.C G.CA TA .A T ck/VN/VNUA-HN01/2014 cK/CH/SCLS/140104 CK/CH/LSD/08-10 S1 DY09 CK/CH/Chongqing/0908 J2 Q1 CK/CH/LDL/98I CoV/Ck/Italy/I2022/13 ck/CH/LDL/97I 4/91 Ma5 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 | | | | | | | | | | | | | | | | | | | | AGTGTGTTGAGTATAATATATATGGCAGAGTTGGCCAAGGTCTTATTACTAACATAACAGATTCAGCTGCTAATCATGGCTATTTGGCAGATGGCGGGTT .T T T TG T AG A T A.T C.A T T CT T AC T TG C C .T G.T AAT C.A C.CA T ck/VN/VNUA-HN01/2014 cK/CH/SCLS/140104 CK/CH/LSD/08-10 S1 DY09 CK/CH/Chongqing/0908 J2 Q1 CK/CH/LDL/98I CoV/Ck/Italy/I2022/13 ck/CH/LDL/97I 4/91 Ma5 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 | | | | | | | | | | | | | | | | | | | | GGCTGTTTTAGATACTTCAGGTGCCATAGACGTTTTTGTTGTACAAGGTGTTTATGGCCTAACTTATTATAAGGTTAATCCCTGTGAAGATGTTAACCAA C C C C C C C C C A A A .A.A T.G CA T T.A A A T T A.C C A AA T T.A .C T C C G ck/VN/VNUA-HN01/2014 cK/CH/SCLS/140104 CK/CH/LSD/08-10 S1 DY09 CK/CH/Chongqing/0908 J2 Q1 CK/CH/LDL/98I CoV/Ck/Italy/I2022/13 ck/CH/LDL/97I 4/91 Ma5 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 | | | | | | | | | | | | | | | | | | | | CAATTTGTAGTCTCTGGTGGACAGTTAGTTGGCATACTTACATCTCGTAATGAAACTGGTTCTCAACCTATTGAGAACCGGTTTTATGTTAAATTTCCTA T T G G CA.T T A .A.A G TT A CA.C C.CA G T TA.A A T T T A G C G.T.C .T.A CA.C A.CA ck/VN/VNUA-HN01/2014 cK/CH/SCLS/140104 CK/CH/LSD/08-10 S1 DY09 CK/CH/Chongqing/0908 J2 Q1 CK/CH/LDL/98I CoV/Ck/Italy/I2022/13 ck/CH/LDL/97I 4/91 Ma5 1610 1620 | | | | ATAGTAGACGTCGCACGGGACGT A .CG.A.C .T.TA G.A.C TTTTA 135 Phụ lục Quy trình vacxin khuyến cáo LỊCH CHỦNG NGỪA CHO THỊT Ngày tuổi 1 13 17 21 35 42 60 Tên vacxin HVT & Rispen Avinew & IB H120 Livacox T Avac New K IBD blen Diftosec VIFLUVAC Avinew & IB88 Bur706 LT-Ivax VIFLUVAC Avinew & IB H120 Phòng bệnh Marek IB Niu-cát xơn Cầu trùng Niu-cát xơn Gumboro Đậu Cúm gia cầm IB Niu-cát xơn Gumboro ILT Cúm gia cầm IB Niu-cát xơn 136 Cách dùng Tiêm trạm ấp Phun sương (tại trạm ấp) Phun vào thức ăn Chích da cổ Nhỏ miệng Chủng màng cánh Tiêm da cổ Nhỏ mắt Nhỏ miệng Nhỏ mũi Tiêm da cổ Uống phun sương LỊCH CHỦNG NGỪA CHO ĐẺ (GIỐNG) Tuổi Tên vacxin Phòng bệnh Cách dùng IB 4/91 & IB Ma5 IB Phun sương nt Avinew Neo Niu-cát xơn Nhỏ mắt 15 nt Ma5 and Clone30 nt (ngày tuổi) 19 nt 27 nt 32 nt IB Niu-cát xơn Medivac Pox Đậu Chủng màng cánh IBD blen Gumboro Nhỏ miệng Nemovac Sưng phù đầu Nhỏ mắt VIFLUVAC Cúm H5N1 Tiêm bắp đùi Reo 1133 Viêm khớp truyền nhiễm LT-IVAX 37 nt Nhỏ mắt ILT Tiêm da cổ Nhỏ mũi Phòng viêm ruô ̣t Gallimune SE Salmonella Tiêm bắp cánh gà 44 nt Corvac4 49 nt MSMG nhũ dầu 53 nt 59 nt 63 nt 70 nt AvinewH120 Sổ mũi truyền nhiễm MS + MG IB IB+ Niu-cát xơn Tiêm bắp lườn trái Tiêm bắp Nhỏ mắt Biofos IBND IB & Niu-cát xơn Tiêm bắp lườn VIFLUVAC Cúm H5N1 Tiêm bắp/ da Thymovac Thiếu máu truyền nhiễm Nhỏ miệng Nemovac Sưng phù đầu Nhỏ mắt Medivac Pox Đậu Chủng màng cánh Corvac4 Sổ mũi truyền nhiễm 137 Tiêm bắp lườn Ma5 and Clone30 12 tt (tuần IB Niu-cát xơn Phun sương/ Nhỏ mắt LT-IVAX ILT Nhỏ mũi 13 tt MSMG nhũ dầu MS & MG Tiêm bắp 14 tt TRI REO tuổi) 15 tt Gallimune 407 AvinewH120 Viêm khớp truyền nhiễm Hội chứng sưng đầu IB & Niu-cát xơn Tiêm bắp/ da Tiêm bắp/ da Phun sương/ Nhỏ mắt Phòng viêm ruô ̣t 16 tt Gallimune SE Salmonella Tiêm bắp cánh gà 17 tt GUMBORO Gumboro Tiêm bắp/ da VIFLUVAC Cúm H5N1 Tiêm bắp/ da IB Niu-cát Phun sương/ Nhỏ mắt 19 tt Ma5 and Clone30 25 tt Ma5 and Clone30 31 tt AvinewH120 IB+ Niu-cát xơn Phun sương/ Nhỏ mắt 35 tt VIFLUVAC Cúm H5N1 Tiêm bắp/ da xơn IB Niu-cát xơn 138 Phun sương/ Nhỏ mắt LỊCH CHỦNG NGỪA CHO ĐẺ TRỨNG THƯƠNG PHẨM Tuổi nt nt 16 nt 23 nt 25 nt 30 nt 40 nt 52 nt 62 nt 70 nt 92 nt 105 nt Tên vacxin IB Ma5 & IB 4/91 ND clone30 Newcavac Cúm H5N1 + H9N2 Gum D78 Ma5clone30 Chủng đậu Gum 228E LT-IVAC Covac IB 4/91 Ma5colne30 H5N1 + H9N2 Newcavac Nemovac LT-IVAC Cúm Vifluvac RT-Inac Avinew H120 Cor IB-OLVAI 19 tt 24 tt 29 tt ND (ND,IB) Mac5clone30 ND Avinew Phòng bệnh IB Niu-cát xơn Niu-cát xơn Cúm gia cầm Gumboro IB & Niu-cát xơn Đậu Gumboro ILT Sổ mũi truyền nhiễm IB IB & Niu-cát xơn Cúm gia cầm Niu-cát xơn Sưng phù đầu ILT Cúm H5N1 Viêm mũi IB & Niu-cát xơn Sổ mũi truyền nhiễm IB Niu-cát xơn (hoặc Niu-cát xơn &IB) IB & Niu-cát xơn Niu-cát xơn 139 Cách dùng Phun sương Phun sương Tiêm da cổ Tiêm da cổ Bắn miệng Nhỏ mắt Đâm cánh Bắn miệng Nhỏ mũi Chích bắp Nhỏ mắt Phun sương Tiêm lườn Tiêm lườn Phun sương Nhỏ mũi Tiêm lườn Tiêm lườn Nhỏ mắt Chích bắp Tiêm lườn Nhỏ mắt Phun sương Phun sương Phụ lục : BẢNG CÂU HỎI DÀNH CHO CHỦ TRANG TRẠI, HỘ GIA ĐÌNH CHĂN NUÔI (Cán Trạm thú y và/hoặc NCS đồng nghiệp vấn) Xã (Phường):…………………………………………………………………………… Huyện (Quận):…………………………………………………………………………… Tỉnh/Thành phố:……………………… Cán điều tra :……………………………Nơi công tác :……………………………… Ngày điều tra (ngày/tháng/năm) :………………………………………………………… I THÔNG TIN VỀ TRANG TRẠI, HỘ CHĂN NUÔI Họ tên chủ trang trại/hộ chăn ni :………………………………………………… Thơn :……………………………Xóm :………………………………………………… II VỀ TÌNH HÌNH CHĂN NI Xin chào ơng (bà), chúng tơi xin phép hỏi số thông tin sau : (Đánh dấu √ vào lựa chọn đúng) Quy mô đàn nuôi (con) :………………………………………………… Xác nhận thú y địa phương tình hình dịch bệnh IB ? Có Khơng Xác nhận thú y địa phương tình hình dịch bệnh khác ? Có Khơng Phương thức chăn ni : 140 Chăn thả Công nghiệp Nguồn gốc nuôi có từ đâu ? Tự ấp nở Nơi chuyên cung cấp giống có kiểm dịch Thương lái đến nhà Hộ chăn nuôi khác Chợ Khác (Ghi rõ đâu):……………………………………………………………… từ Nhốt cách ly gia cầm mua ? Có Khơng Mục đích ni ? đẻ trứng thịt III PHÒNG BỆNH Quét dọn vệ sinh, sử dụng hoá chất tiêu độc nơi ni, nhốt, thả ? Có thường xun Có lâu (trên tháng) Khơng Tiêm phòng vacxin IB ? Có Khơng 10 Nếu có, ngày tiêm phòng cuối ? 11 Tiêm phòng loại vacxin khác ? Có Khơng 12 Nếu có, tiêm loại vacxin ? Ngày tiêm phòng cuối ? 141 …………………………………………………………………………………………… …………………………………………………………………………………………… ………………………………………………………………………………………… 13 Ai thực tiêm phòng vacxin ? Tự tiêm Thú y xã tiêm Thú y từ nơi khác đến tiêm (ghi cụ thể, từ đâu ?) ………………………………………………………………………………………… … Có vệ sinh, tiêu độc khử trùng trước, sau tiêm 14 Trong vòng tháng qua, gia đình ông (bà) có bị bệnh, chết ? Có Không 15 Nếu có, trả lời câu hỏi sau : Số lượng bị (con) :……………………………………………………………… bệnh Số lượng bị (con) :………………………………………………………………… chết Có vệ sinh tiêu độc khử trùng sau có bị bệnh, chết ? Có Khơng 16 Ơng (bà) làm thấy bị bệnh ? Nuôi cách ly Điều trị 142 Làm thịt Bán Xử lý cách khác (ghi cụ thể) :…………………………………………………………… 17 Ơng (bà) có báo thú y cán thơn xã ? Có Khơng 18 Gần có trang trại gia cầm, lò giết mổ hay chợ bn bán gia cầm khơng ? Có Khơng 19 Nếu có, khoảng cách bao xa ? >1000 mét
- Xem thêm -

Xem thêm: Nghiên cứu dịch tễ học bệnh viêm phế quản truyền nhiễm (Infectious Bronchitis – IB) ở gà nuôi tại một số tỉnh miền Bắc Việt Nam (Luận án tiến sĩ), Nghiên cứu dịch tễ học bệnh viêm phế quản truyền nhiễm (Infectious Bronchitis – IB) ở gà nuôi tại một số tỉnh miền Bắc Việt Nam (Luận án tiến sĩ)

Gợi ý tài liệu liên quan cho bạn

Nhận lời giải ngay chưa đến 10 phút Đăng bài tập ngay