XÁC ĐỊNH Aspergillus NHÓM Flavi SINH ĐỘC TỐ AFLATOXIN TRONG NÔNG SẢN BẰNG KỸ THUẬT PCR

50 9 0
  • Loading ...
1/50 trang

Thông tin tài liệu

Ngày đăng: 26/02/2019, 14:12

BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƢỜNG ĐẠI HỌC NÔNG LÂM THÀNH PHỐ HỒ CHÍ MINH BỘ MƠN CƠNG NGHỆ SINH HỌC KHÓA LUẬN TỐT NGHIỆP XÁC ĐỊNH Aspergillus NHÓM Flavi SINH ĐỘC TỐ AFLATOXIN TRONG NÔNG SẢN BẰNG KỸ THUẬT PCR Ngành học: CÔNG NGHỆ SINH HỌC Sinh viên thực hiện: NGUYỄN XUÂN DANH Niên khóa: 2011 - 2013 Tháng 12/2013 BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƢỜNG ĐẠI HỌC NƠNG LÂM THÀNH PHỐ HỒ CHÍ MINH BỘ MƠN CƠNG NGHỆ SINH HỌC KHĨA LUẬN TỐT NGHIỆP XÁC ĐỊNH Aspergillus NHĨM Flavi SINH ĐỘC TỐ AFLATOXIN TRONG NƠNG SẢN BẰNG KỸ THUẬT PCR Hƣớng dẫn khoa học Sinh viên thực TS HUỲNH VĂN BIẾT NGUYỄN XUÂN DANH ThS TRẦN THỊ VÂN Tháng 12/2013 LỜI CẢM ƠN Trong suốt thời gian thực khóa luận, tơi ln nhận đƣợc dẫn tận tình Q Thầy Cơ, động viên gia đình giúp đỡ bạn bè, nhờ điều giúp tơi hồn thành tốt khóa luận Lời cảm ơn xin gửi đến Quý Thầy Cô khoa Nông Nghiệp Công Nghệ Sinh Học trƣờng Đại Học Nông Lâm TP.HCM dạy dỗ, truyền đạt kiến thức cho suốt hai năm học qua Tôi xin chân thành cảm ơn thầy Lê Đình Đơn tạo điều kiện tốt để tơi thực khóa luận Viện nghiên cứu Công Nghệ Sinh Học Môi Trƣờng trƣờng Đại Học Nơng Lâm, Thành Phố Hồ Chí Minh Tôi xin gửi lời cảm ơn đến thầy Huỳnh Văn Biết Trần Thị Vân hết lòng hƣớng dẫn, dạy cho tơi suốt q trình thực khóa luận Một lần tơi xin chân thành cảm ơn TP.HCM, Ngày 06 Tháng 12 Năm 2013 Nguyễn Xuân Danh i TÓM TẮT Aspergillus flavus Aspergillus parasiticus gây nhiễn nghiêm trọng nông sản vùng nhiệt đới cận nhiệt đới Sự xâm nhiễm loại nấm nơng sản gây ô nhiễm thực phẩm thức ăn chăn nuôi độc tố Aflatoxin gây ung thƣ mạnh Việc ăn phải loại thực phẩm nhiễm Aflatoxin đƣợc ghi nhận yếu tố gây nguy ung thƣ biểu mô gan cho ngƣời Trong báo cáo nghiên cứu số loại nông sản nhƣ bắp, đậu phộng cà phê nhằm kiểm tra diện loại nấm sinh Aflatoxin Từ 45 mẫu bao gồm Bắp (15 mẫu), Đậu Phộng (15 mẫu) Cà Phê (15 mẫu), phân lập đƣợc 30 chủng nấm mốc Dựa vào hình thái khuẩn lạc đăc điểm tế bào chi nấm Aspergillus flavus đƣợc phát hiện, khơng có diện nấm Aspergillus parasticus Nấm Aspergillus flavus diện bắp 35,33%, 36,80 % đậu phộng % mẫu cà phê Về đặc điểm hình thái học, chủ yêu dựa vào màu sắc khuẩn lạc mơi trƣờng PDA hình thái bào tử, nấm Aspergillus flavus có khuẩn lạc màu xanh vàng, bào tử đính trơn nhám Về phân tử, diện gene aflQ (=ord1=ordA) liên quan đến đƣờng sinh tổng hợp Aflatoxin đƣợc kiểm tra (bằng phƣơng pháp PCR) Sự diện gene có mối tƣơng quan tới chủng nấm mốc sinh Aflatoxin Tất chủng nấm Aspergillus flavus phân lập đƣợc cho kết dƣơng tính với diện gene aflQ ii SUMMARY Aspergillus flavus and Aspergillus parasiticus cause perennial infection of agriculturally important agricultural products in tropical and subtropical areas Invasion of crops by these fungi may result in contamination of food and feed by potent carcinogenic aflatoxins Consumption of aflatoxin contaminated foods is a recognised risk factor for human hepatocellular carcinoma This study conducted some agricultural products such as: peanuts, corn and coffee beans for the presence of aflatoxigenic fungi From a total of 45 samples comprising peanut (15), corn (15) and coffee beans (15), 30 strains of fungi were isolated Identification of strains by colony morphology found to be Aspergillus flavus with no Aspergillus parasiticus isolated Aspergillus flavus was present in 35.33% of peanut samples, 36.80 % of corn samples and % of coffee beans samples On the basis of morphological characters (mainly colony color on Potato Dglucose agar and conidia orphology), Aspergillus flavus had yellow-green (yellow is less than) colonies and smooth tofinely rough globose conidia Molecularly, the presence of one genes of the aflatoxin biosynthetic pathway, aflQ (=ord1=ordA) were tested (by PCR method) The presence of genes correlate with aflatoxigenicity All of Asperglillus flavus isolates were positive with the presence of aflQ (ord1) Keywords: Asperglillus, PCR, Aflatoxin, morphological characters iii MỤC LỤC Trang LỜI CẢM ƠN i TÓM TẮT .ii SUMMARY iii MỤC LỤC iv DANH SÁCH CÁC TỪ VIẾT TẮT vi DANH SÁCH CÁC BẢNG vii DANH SÁCH CÁC HÌNH viii Chƣơng 1: GIỚI THIỆU 1.1 Đặt vấn đề 1.2 Mục tiêu nghiên cứu để tài 1.3 Nội dung đề tài Chƣơng: TỔNG QUAN TÀI LIỆU 2.1 Nhóm Aspergillus flavi sinh độc tố Aflatoxin 2.1.1 Phân loại học 2.1.2 Hình thái 2.1.3 Sinh thái 2.2 Phƣơng pháp phát nhóm Aspecgillus flavi 2.2.1 Dựa vào đặc điểm hình thái 2.2.2 Dựa phƣơng pháp sinh học phân tử 2.3 Độc chất Aflatoxin 2.3.1 Lịch sử phát aflatoxin 2.3.2 Công thức cấu tạo số tính chất vật lý Aflatoxin 2.3.3 Tác hại Aflatoxin 2.4 Giới thiệu kỹ thuật PCR 10 2.4.1 Khái quát kỹ thuật PCR 10 2.4.1.1 Khái niệm 10 2.4.1.2 Lịch sử 10 2.3.2 Nguyên lý 11 2.3.3 Các thành phần phản ứng 11 iv 2.3.4 Chu trình nhiệt phản ứng PCR 12 2.3.5 Các yếu tố ảnh hƣởng đến phản ứng PCR 13 Chƣơng VẬT LIỆU VÀ PHƢƠNG PHÁP 14 3.1 Thời gian địa điểm nghiên cứu 14 3.2 Vật liệu 14 3.2.1 Mẫu thực 14 3.2.2 Thiết bị dụng cụ 14 3.3 Phƣơng pháp 15 3.3.1 Phƣơng pháp định danh nấm mốc 15 3.3.2 Phƣơng pháp tách chết DNA 16 3.3.3 Phƣơng pháp PCR 16 3.3.4 Phƣơng pháp điện di gel agarose 18 Chƣơng KẾT QUẢ VÀ THẢO LUẬN 19 4.1 Kết 19 4.1.1 Kết xác định tỉ lệ nhiễm Aspergillus nhóm Flavi nơng sản 19 4.1.1.1 Kết xác định tỉ lệ nhiễm Aspergillus nhóm Flavi mẫu bắp 19 4.1.1.2 Kết xác định tỉ lệ nhiễm Aspergillus nhóm Flavi mẫu đậu phộng 20 4.1.1.3 Kết xác định tỉ lệ nhiễm Aspergillus nhóm Flavi mẫu cà phê 21 4.1.2 Kết mô tả hình thái nấm Aspergillus flavus 22 4.1.3 Kết tách DNA nấm Aspergillus flavus 24 4.1.3.1 Kết tách DNA mẫu nấm Aspergillus flavus phân lập từ bắp 25 4.1.3.1 Kết tách DNA mẫu nấm Aspergillus flavus phân lập từ hạt đậu phộng 26 4.1.4 Kết xác định nhóm nấm Aspergillus flavus phƣơng pháp PCR 26 4.1.4.1 Kết thử nghiệm quy trình PCR xác định Aspergillus flavus 26 4.1.4.2 Kết PCR xác định Aspergillus flavus phân lập từ mẫu bắp 28 4.1.4.3 Kết PCR xác định Aspergillus flavus phân lập từ mẫu đậu phộng 29 4.2 Thảo Luận 29 Chƣơng KẾT LUẬN VÀ ĐỀ NGHỊ 32 5.1 Kết luận 32 5.2 Đề nghị 32 TÀI LIỆU THAM KHÀO 33 PHỤ LỤC 36 v DANH SÁCH CÁC TỪ VIẾT TẮT AFB1 Aflatoxin B1 AFB2 Aflatoxin B2 AFG1 Aflatoxin G1 AFG2 Aflatoxin G2 AFPA Aspergillus flavus Aspergilus parasiticus agar CCA Coconut cream agar ddNTP Dideoxyribonucleotide triphosphate DNA Deoxyribonucleic acid dNTP Deoxyribonucleotide triphosphate EDTA Ethylenediaminetetraacetic acid Kb Kilobases PCR Polymer chain reaction RAPD Random Amplified Polymorphic DNA RFLP Restriction Fragment Length Polymorphisms SDS Sodium dodecyl sulfate SSCP Single strand conformation polymorphyrism Ta Annealing temperature Tm Melting temperature UV Ultraviolet vi DANH SÁCH CÁC BẢNG Trang Bảng 2.1 Phân loại học nấm Aspecgillus flavus Bảng 2.2 Phân loại học nấm Aspecgillus parasiticus Bảng 3.1 Một số mẫu nông sản tiến hành thí nghiệm 14 Bảng 3.2 Thành phần phản ứng PCR 17 Bảng 4.1 Kết xác định tỉ lệ nhiễm Aspergillus flavus mẫu bắp 20 Bảng 4.2 Kết xác định tỉ lệ nhiễm Aspergillus flavus mẫu đậu phộng 21 vii DANH SÁCH CÁC HÌNH Trang 2.1 Aspergillus flavus Hình 2.2 Aspergillus parasiticus Hình 2.3 Cơng thức cấu tạo hoá học AFB1, AFB2, AFG1 AFG2 Hình 3.1 Chu trình nhiệt cho phản ứng PCR 17 Hình 4.1 Nấm Aspergillus flavus nhiễm mẫu nông sản 19 Hình 4.2 Mẫu ca phe môi trƣờng PDA sau ngày nuôi cấy .22 Hình 4.3 Nấm Aspergillus flavus bắp đậu phộng 22 Hình 4.4 Khuẩn lạc Aspergillus flavus môi trƣờng PDA sau ngày ni cấy 23 Hình 4.5 Tản nấm Aspergillus flavus môi trƣờng PDA sau 15 ngày nuôi cấy 23 Hình 4.6 Bơng bào tử nấm Aspergillus flavus 24 Hình 4.7 Bào tử nấm Aspergillus flavus .24 Hình 4.8 Sợi nấm Aspergillus flavus môi trƣờng PD broth sau 72 nuôi cấy 25 Hình 4.9 Kết điện di DNA genome nấm Aspergillus flavus phân lập từ hạt bắp 25 Hình 4.10 Kết điện di DNA genome nấm Aspergillus flavus phân lập từ hạt đậu phộng 26 Hình 4.11 Kết điện di sản phẩm PCR mẫu bắp B.5 .26 Hình 4.12 Xử lý kết giải trình tự với phần mềm BioEdit 27 Hình 4.13 Blast ssDNA xử lý lên ngân hàng liệu NCBI 27 Hình 4.14 Kết blast trình tự giải lên ngân hang giƣ liệu NCBI 28 Hình 4.15 Kết điện di sản phẩm PCR mẫu nấm Aspergillus flavus phân lập từ bắp .28 Hình 4.16 Kết điện di sản phẩm PCR mẫu nấm Aspergillus flavus phân lập từ đậu phộng 29 viii 4.1.3.2 Kết tách DNA mẫu Aspergillus flavus phân lập từ đậu phộng Mẫu DNA sau tách chiết đƣợc kiểm tra kết phƣơng pháp điện di gel agarose 1,5 %, 80 volt, 45 phút Hình 4.10 Kết điện di DNA genome nấm Aspergillus flavus phân lập từ hạt đậu phộng.1 – 15: Các mẫu DNA tách chiết từ nấm Aspergillus flavus phân lập đậu phộng (mẫu ĐP.1 – ĐP.15) Kết điện di cho thấy DNA đƣợc tách chiết tốt điên di xuất vạch sáng rõ DNA đƣơc tách chiết đƣợc sử dụng để thực phản ứng PCR 4.1.4 Kết xác định Aspergillus flavus phƣơng pháp PCR 4.1.4.1 Kết thử nghiệm quy trình PCR xác định Aspergillus flavus Để kiểm tra quy trình PCR xác định Aspergillus flavus, chúng tơi tiến hành thử nghiệm quy trình PCR với mẫu Aspergillus flavus phân lập từ mẫu bắp hiệu B.5 với cặp mồi Ord1 (Scherm cộng sự, 2005) Kết PCR đƣợc kiểm tra điện di gel agarose 1,5 % 80 volt 35 phút Hình 4.11 Kết điện di sản phẩm PCR mẫu bắp B.5 1: Thang chuẩn 2: Sản phẩm PCR mẫu bắp B.5 26 3: Đối chứng âm Kết điện di cho thấy sản phẩm PCR vạch chuyên biệt Do thời gian điện di ngắn chƣa đủ để thang chuẩn phân tách tốt nên chƣa thể xác định kích thƣớc sản phẩm PCR Tuy nhiên, quy trình PCR thử nghiệm sử dụng cho mẫu Aspergillus flavus sau Từ mẫu sản phẩm PCR nhận định nấm Aspergillus flavus trên, gửi mẫu giải trình tự tới cơng ty Nam Khoa Kết giải trình tự thơ đƣợc xử lý với thuật tốn ClustalW phầm mềm BioEdit (Hình 4.12) tạo đoạn ssDNA hồn chỉnh Từ đoạn ssDNA này, chúng tơi tiến hành Blast (Hình 4.13) với trình tự DNA genome có ngân hàng NCBI Kết kiểm tra với công cụ Blast trình tự ngân hàng giữ liệu NCBI khớp 99 % trình tự ord1 nấm Aspergillus flavus (Hình 4.14) Với sở chúng tơi định chọn sản phẩm PCR mẫu bắp B.5 nhƣ đối chứng dƣơng cho phản ứng PCR sau Hình 4.12 Xử lý kết giải trình tự với phần mềm BioEdit Hình 4.13 Blast ssDNA xử lý lên ngân hàng liệu NCBI 27 Hình 4.14 Kết blast trình tự giải lên ngân hang giƣ liệu NCBI 4.1.4.2 Kết PCR xác định Aspergillus flavus phân lập từ mẫu bắp Mẫu DNA nấm Asecgillus flavus phân lập bắp sau tách chiết tiếp tục thực phản ứng PCR với cặp mồi Ord1 (Scherm cộng sự, 2005) khuyếch đại gen aflQ Sản phẩm PCR đƣợc kiểm tra thông qua điện di gel agarose 1,5 % 80 volt 45 phút 80 bp 70 bp Hình 4.15 Kết điện di sản phẩm PCR mẫu nấm Aspergillus flavus phân lập từ bắp 1: Leader; - 16: Sản phẩm PCR mẫu DNA nấm Aspergillus flavus tách chiết từ bắp (mẫu B.1 – B.15); 17: Đối chứng dương; 18: Đối chứng âm Kết điện di cho thấy sản phẩm PCR chuyên biệt sản phẩm Sản phẩm PCR có kích thƣớc phù hợp với lý thuyết (nằm khoảng 700 bp đến 800 bp) nhƣ với kích thƣớc đối chứng dƣơng Từ sở khẳng định nguồn DNA tách chiết từ nấm Aspergillus flavus 28 4.1.4.3 Kết PCR xác định Aspergillus flavus phân lập từ mẫu đậu phộng Mẫu DNA nấm Aspergillus flavus phân lập đậu phộng sau tách chiết tiếp tục thực phản ứng PCR với cặp mồi Ord1 (Scherm cộng sự, 2005) khuyếch đại gen aflQ Sản phẩm PCR đƣợc kiểm tra thông qua điện di gel agarose 1,5 % 80 volt 45 phút 80 bp 70 bp Hình 4.16 Kết điện di sản phẩm PCR mẫu nấm Aspergillus flavus phân lập từ hạt đậu phộng 1: leader; - 16: Sản phẩm PCR mẫu DNA nấm Aspergillus flavus tách chiết từ hạt đậu phộng (mẫu ĐP.1 – ĐP.15); 17: Đối chứng dương; 18: Đối chứng âm Thông qua kết điện di, ta thấy sản phẩm PCR chuyên biệt Sản phẩm PCR mẫu với kích thƣớc đối chứng dƣơng Có thể khẳng định mẫu nấm tách chiết DNA nấm Aspergillus flavus 4.2 Thảo Luận Theo nghiên cứu nhóm tác giả Tran-Dinh N (2009) kết phân lập nấm mốc mẫu hạt đậu phộng bắp Việt Nam phát nấm Aspergillus flavus mà không phát nấm Aspergillus parasiticus Nấm Aspergillus parasiticus xuất không phổ biến Đông Nam Á Nhiều báo cáo cho thấy Aspergillus parasiticus gặp không xuất Thái Lan, Trung Quốc Tuy nhiên, nấm Aspergillus parasiticus đƣợc ghi nhận phát Nhật Bản Philippines Kết nghiên cứu lần cho thấy nấm Aspergillus parasiticus không xuất mẫu hạt bắp đậu phộng 29 chợ đầu mối lớn thành phố Hồ Chí Minh Phát có ý nghĩa quan trọng chiến lƣợc kiểm sốt sinh học khu vực chợ đầu mối Tp.HCM Kết xác định tỉ lệ nhiễm nấm Aspergillus flavus mẫu hạt nơng sản chợ có chênh lệch bị ảnh hƣởng điều kiện bảo quản nguồn thu mua đầu mối Ghi nhận tỉ lệ nhiễm nấm Aspergillus flavus bắp 36,80 % cao không đáng kể với mức 31,1 % từ kết nhiên cứu tác giả Tran-Dinh N (2009) Tỉ lệ nhiễm nấm Aspergillus flavus đậu phộng đƣợc thí nghiệm 35,33 % ngang với mức 36 % từ kết nghiên cứu nhóm tác giả N Tran-Dinh (2009) Kết thí nghiệm mẫu cà phê nguyên vỏ không ghi nhận diện nấm Aspergillus flavus phát Chƣa có giải thích cự thể cho việc Tuy nhiên giả thuyết cà phê đƣợc bảo quản tốt (thƣờng đƣợc sấy nhiệt độ 120-200oC trƣớc trữ vào kho), lớp vỏ cứng chứa số chất ức chế phát triển nấm Aspergillus flavus Về mặt hình thái nấm Aspergillus flavus giống với nấm Aspergillus oryzae có màu xanh vàng Tuy nhiên, tản nấm Aspergillus flavus có xanh vàng có đƣờng tròn đồng tâm Nấm Aspergillus oryzae khuẩn lạc màu vàng nhiều xanh, hình thái khuẩn lạc giống hình dạng hoa Cúc (Aspergillus oryzae đƣợc gọi mốc hoa Cúc) Trong đề tài này, mẫu nấm Aspergillus flavus phân lập từ mẫu hạt Bắp có hình thái khuẩn lạc giống với mô tả nấm Aspergillus flavus đƣớc ghi nhận theo nghiên cứu tác giả Đặng Vũ Hồng Miên (1980); nấm Aspergillus flavus dễ nhận biết qua màu xanh vàng, đƣờng kính khuẩn lạc đạt 5-7 cm sau ngày ni cấy Aspergillus flavus có bơng lớn hình cầu hình tia, bọng hình cầu, lớp thể bình, vách cuống conidi xù xì, hạt đính hình cầu, trơn có gai Tác giả Nguyễn Thu Mai (2007) có ghi nhân tƣơng tự tiến hành phân lập nấm Aspergillus flavus mẫu Đậu Phộng thu mua chợ Xuân Khánh (Cần Thơ); lớn hình cầu đến gần cầu, cuống có gai mịn, lớp thể bình, bào tử đính trơn nhẵn hình cầu Xem xét mặt hình thái mắt thƣờng thƣờng dễ nhầm lẫn nấm Aspergillus flavus với nấm họ Aspergillus khác xác định lại phƣơng pháp PCR lựa chọn thích hợp với độ xác cao thơng dụng Trong nghiên cứu này, xác định Aspergillus flavus thông qua kĩ thuật PCR đƣợc thực thành công Các mẫu nấm Aspergillus flavus phân lập từ mẫu nông 30 sản đƣợc xác nhận lại kỹ thuật PCR với cặp mồi Ord1 (Scherm cộng sự, 2005) khuyếch đại gene aflQ Kết xác định nấm Aspergillus nhóm Flavi kỹ thuật PCR đƣợc thực phù hợp với sở lý thuyết nghiên cứu nhóm tác giả Scherm cộng (2005), đồng thời kết mẫu giải trình tự từ sản phẩm PCR hồn tồn khớp với trình tự shotgun nấm Aspergillus flavus ngân hàng giữ liệu NCBI Với sở chắn trên, chúng tơi khẳng định kết xác định nấm mốc Aspergillus flavus phân lập mẫu nông sản hồn tồn xác 31 Chƣơng KẾT LUẬN VÀ KIẾN NGHỊ 5.1 Kết luận Sau thực phân lập định danh mẫu nông sản thu mua từ chợ Thủ Đức, chợ Lớn chợ Tân Bình, xác định diện chủng Aspergillus flavus, bắp 36,8 % (275/750 hạt), đậu phộng 35,33 % (265/750 hạt), với mẫu cà phê không xác định diện chủng Aspergillus flavus A.parasiticus Kết xác nhận nấm Aspergillus flavus nông sản kỹ thuật PCR 100% mẫu nấm phân lập đƣợc nấm Aspergillus flavus 5.2 Kiến nghị - Tiến hành thí nghiệm khả sinh độc tố Aflatoxin mẫu nấm Aspergillus flavus phân lập đƣợc - Xây dựng quy trình xác định nhóm nấm Aspergillus flavus mẫu nông sản phƣơng pháp PCR trƣc tiếp không qua phân lập 32 TÀI LIỆU THAM KHẢO 52 TCN-TQTP 0001:2003 Thường quy kỹ thuật định danh nấm mốc Aspergillus flavus, Aspergillus niger, Aspergillus fumigatus thực phẩm Quyết định số 4871/2004/QĐBYT 52 TCN-TQTP 0009: 2004 Thường quy kỹ thuật định danh nấm mốc Aspergillus parasiticus, Aspergillus versicolor thực phẩm Quyết định số 4871/2004/QĐBYT Alessio Amadasi, Chiara Dall′Asta, Gianluigi Ingletto, Roberto Pela, Rosangela Marchelli and Pietro Cozzini (2007), Explaning cyclodextrinmycotoxin interactions using a “natural” force fiel, Bioorganic & Medicinal Chemistry (15) 4585–4594, Elsevier Ltd Chang, P.K., Cary, J.W., Bhatnagar, D., Cleveland, T.E., Bennett, J.W., Linz, J.E., Woloshuk, C.H.P and Payne, G.A (1995) Cloning of the Aspergillus parasiticusapa-2 gene associated with the coregulation of aflatoxin biosynthesis Applied and Environmental Microbiology Dƣơng Thanh Liêm 2003 “Độc tố nấm mốc, kẻ thù số thức ăn công nghiệp” Nhà xuất Nông nghiệp, Hà Nội Đặng Vũ Hồng Miên 1980 Nấm mốc độc thực phẩm Nhà xuất khoa học kỹ thuật, Hà Nội Erami, M., Hashemi S.J., Pourbakhsh S.A., Shahsavandi S., Mohammadi, S., Shooshtari, A.H., Jahanshiri 2007 Application of PCR on detection of aflatoxinogenic fungi Razi Vaccine & Serum Research Institute FAO 1414-1992 Manual microbiological analysis in the food control laboratory Fente C.A., Ordaz J.Jaimez, V¸zquez B I., Franco C M 2001 New Additive For Culture Media For Rapid Identification of Producing Aspergillus Strains, Applied and environmental microbiology, 2001, p 4858–4862, American Society for Microbiology 33 10 González-Salgado, Amaia; UCM, genetics 2007 Highly sensitive PCR-based detection method specific to Aspergillus flavus in wheat flour Scholarone Manuscripts 11 Lƣơng Đức Phẩm 2002 Vi sinh vật an toàn vệ sinh thực phẩm Nhà xuất Nông Nghiệp 12 Nguyễn Minh Trí 2006 “Tình hình nhiễm độc tố nấm (Aflatoxin B1, Ochratoxin A, Citrinin) gạo Nha Trang”, Tạp chí khoa học Cơng nghệ thủy sản, (số 02) năm 2006 Nhà xuất khoa học kỹ thuật 13 Nguyễn Thị Hiền cộng tác 2003 Vi sinh vật nhiễm tạp lương thực – thực phẩm Nhà xuất Nông nghiệp 14 Nguyễn Thị Xuyến 1999 Vi sinh vật thực phẩm Nhà xuất Khoa học kỹ thuật 15 Nguyễn Thu Mai 2007 Phân lập định danh số loài Aspergillus hạt đậu phộng chợ Xn Khánh Khóa luận tốt nghiệp kỹNơng Học– Đại Học Cần Thơ 16 Phạm Hùng Vân 2009 PCR real-time PCR vấn đề thường gặp Nhà xuất y học chi nhánh TP.HCM 17 Quỳnh Đình Thi, Nơng Văn Hải 2008 Cộng nghệ sinh học tập II Những Kỹ Thuật PCR Và Ứng Dụng Trong Phân Tích DNA Nhà xuất khoa học tự nhiên công nghệ 18 Rodrigues P., Soares C., Kozakiewicz Z., Paterson R.R.M., Lima N., and Venâncio A 2007 Identification and characterization of Aspergillus flavus and aflatoxins International Journal of Food Microbiology 19 Rodrigues P.,Venâncio A.,Kozakiewicz Z., Lima Z 2009 A polyphasic approach to the identification of aflatoxigenic and non-aflatoxigenic strains of Aspergillus Section Flavi isolated from Portuguese almonds, International Journal of Food Microbiology 20 Scherm, B., Palomba, M., Serra, O., Marcello, A and Migheli, Q (2005) Detection of transcripts of the- aflatoxin genes aflD, aflO, and aflP by reverse transcription–polymerase chain reaction allows differentiation of aflatoxin– producing and non–producing Food Microbiology 98: 201-210 34 21 Tran-Dinh N, Kennedy I, Bui T, Carter D Survey of Vietnamese Peanuts, Corn and Soilfor the Presence of Aspergillus flavus and Aspergillus parasiticus Published online: 20 August 2009, Mycopathologia 2009 35 PHỤ LỤC Phụ lục Các môi trƣờng sử dụng Potato D-glucose Agar (PDA) Thành phần Khoai tây 200 gram D-glucose 40 gram Agar 15-20 gram Nƣớc cất 1000 ml Điều chế: Khoai tây làm vỏ, cắt thành lát mỏng cho vào nồi nấu với nƣớc cất Lọc lấy nƣớc trích, cho thêm nƣớc cất cho đủ thể tích Bổ sung glucose agar khuấy cho tan chia vào bình, tiến hành trùng 121oC 15 phút Canh Potato D-glucose (PD broth) Thành phần Khoai tây 200 gram D-glucose 40 gram Nƣớc cất 1000 ml Điều chế: : Khoai tây làm vỏ, cắt thành lát mỏng cho vào nồi nấu với nƣớc cất Lọc lấy nƣớc trích, cho thêm nƣớc cất cho đủ thể tích Bổ sung glucose khuấy cho tan chia vào bình, tiến hành trùng 121oC 15 phút Phụ lục Kết giải trình tự sản phẩm PCR mẫu B6 Primer F GTTAAGGATGACTATGGTCCCCTACTTATGGATAAAGGATCAGGTCGCTCGC GGCTGCTCTCGTCCTTCCATCCTCTTGCGCTTGTTGCAGAAAGGCCACTATG AATCTGGATCACATCAAGAGCAGGTTTTGGTATGGACTAATGCCGAATTCGTT ATGGGAGGATCGGACACGGTACAACATTCTCTGCCTCATCACTTTAGGATAG GAAGCGCGTTAATCCATTACACAGACAGTGTCCGCAGTGTCTAGCCTTTTTG TGGCCATGGCCCTGTACCCCGAGGTGCAACGCAAGGCGCGCGAGGAACTCG ACCGAGTCGTGGGACCAACTACTCTGGCGACCTTTGAGCACCGTTCGCAGT TACCCTTTATTGACGCCCTTGTCAAGGAGGTGTTTCGATGGCATCCTGCCTCC CCTTTGGGTGCACCCCATATCACGCAGGAGGATCAGATCTGGGATGGCTATC TACTGCCCAAAGGTGCTCTTCTACTGCCGAATATCTGGTTGTTTCACACCCGT CCATTGATTCTCCTATTAGCTTCCAAGCTAACTTTATACTTGCTAGGACGTTTA CCCATGATCCCAGTGTCTACCACGACCCCATGGTGTTCAAGCCAGAGCGATT CCTCGAGGGAAAAGACTCCCCGCCAGAAACAGATCCCATGAAATTTGTGTT CGGTTTTTGGGGCGTCAAATAAAGGGTAACTTGCAAAAAAGGGGGTGAAAG GTCGCAAAGTATTGGTCCTCCTGATTAGTTCGACCCCCCT Primer R AGGGCATCTGTTTCTGGCGGGGAGTCTTTTCCCTCGAGGAATCGCTCTGGCT TGAACACCATGGGGTCGTGGTAGACACTGGGATCATGGGTAAACGTCCTAG CAAGTATAAAGTTAGCTTGGAAGCTAATAGGAGAATCAATGGACGGGTGTGA AACAACCAGATATTCGGCAGTAGAAGAGCACCTTTGGGCAGTAGATAGCCAT CCCAGATCTGATCCTCCTGCGTGATATGGGGTGCACCCAAAGGGGAGGCAG GATGCCATCGAAACACCTCCTTGACAAGGGCGTCAATAAAGGGTAACTGCG AACGGTGCTCAAAGGTCGCCAGAGTAGTTGGTCCCACGACTCGGTCGAGTT CCTCGCGCGCCTTGCGTTGCACCTCGGGGTACAGGGCCATGGCCACAAAAA GGCTAGACACTGCGGACACTGTCTGTGTAATGGATTAACGCGCTTCCTATCCT AAAGTGATGAGGCAGAGAATGTTGTACCGTGTCCGATCCTCCCATAACGAAT TCGGCATTAGTCCATACCAAAACCTGCTCTTGATGTGATCCAGATTCATAGTG GCCTTTCTGCAACAAGCGCAAGAGGATGGAAGGACGAGAGCAGCCGCGAG CGACCTGATCCTTTATCCATAAGTAGGGGACCATAGTCATCCTTTCGATGGTC CACTTGTATTCCGCTT Phụ lục 3: Kết xác định tỉ lệ nhiễm nấm Aspergillus flavus nông sản Bảng Kết tỉ lệ diện nấm Aspergillus flavus mẫu bắp thu mua từ chợ Thủ Đức Chợ Thủ Đức Đĩa 10 Tỉ lệ nhiễm B.1 2 3 2 38,00 % B.2 B.3 B.4 2 1 2 2 3 2 1 2 2 2 2 2 38,00 % 36,00 % 38,00 % Tỉ lệ nhiễm trung bình 37,60 % B.5 2 2 2 38,00 % Bảng Kết tỉ lệ diện nấm Aspergillus flavus mẫu Bắp thu mua từ chợ Tân Bình Chợ Tân Bình Đĩa B.6 B.7 B.8 B.9 B.10 2 2 3 3 2 2 2 2 3 2 3 2 4 3 10 2 Tỉ lệ nhiễm 48,00 % 46,00 % 48,00 % 48,00 % Tỉ lệ nhiễm trung bình 46,80 % 44,00 % Bảng Kết tỉ lệ diện nấm Aspergillus flavus mẫu Bắp thu mua từ chợ Lớn Đĩa 10 Tỉ lệ nhiễm B.11 1 2 26,00 % Chợ Lớn B.12 B.13 B.14 1 1 1 1 1 1 2 2 1 2 28,00 % 24,00 % 26,00 % Tỉ lệ nhiễm trung bình 26,00 % B.15 1 2 2 26,00 % Bảng Kết tỉ lệ diện nấm Aspergillus flavus mẫu Đậu Phộng thu mua từ chợ Thủ Đức Chợ Thủ Đức Đĩa 10 Tỉ lệ nhiễm ĐP.1 2 2 2 2 36,00 % ĐP.2 2 1 2 1 32,00 % ĐP.3 2 2 2 1 2 36,00 % ĐP.4 2 3 36,00 % Tỉ lệ nhiễm trung bình 34,80 % ĐP.5 2 2 34,00 % Bảng Kết tỉ lệ diện nấm Aspergillus flavus mẫu Đậu Phộng thu mua từ chợ Tân Bình Chợ Tân Bình Đĩa 10 Tỉ lệ nhiễm ĐP.6 2 2 2 2 38,00 % ĐP.7 ĐP.8 ĐP.9 2 2 2 2 2 2 3 2 2 38,00 % 36,00 % 38,00 % Tỉ lệ nhiễm trung bình 36,80 % ĐP.10 1 2 2 34,00 % Bảng Kết tỉ lệ diện nấm Aspergillus flavus mẫu Đậu Phộng thu mua từ chợ Lớn Chợ Lớn Đĩa 10 Tỉ lệ nhiễm ĐP.11 2 2 2 1 36,00 % ĐP.12 2 2 36,00 % ĐP.13 2 1 2 32,00 % ĐP.14 2 2 2 34,00 % Tỉ lệ nhiễm trung bình 34,40 % ĐP.15 2 1 0 3 34,00 % ... HỌC NÔNG LÂM THÀNH PHỐ HỒ CHÍ MINH BỘ MƠN CƠNG NGHỆ SINH HỌC KHÓA LUẬN TỐT NGHIỆP XÁC ĐỊNH Aspergillus NHÓM Flavi SINH ĐỘC TỐ AFLATOXIN TRONG NÔNG SẢN BẰNG KỸ THUẬT PCR Hƣớng dẫn khoa học Sinh. .. thuật PCR dựa kết nghiên cứu hệ gen đƣờng sinh tổng hợp Aflatoxin xác định xác nấm Aspergillus nhóm Flavi Từ sở trên, tiến hành nghiên cứu đề tài: Xác định Aspergillus nhóm Flavi sinh độc tố Aflatoxin. .. 4.1.1 Kết xác định tỉ lệ nhiễm Aspergillus nhóm Flavi nơng sản 19 4.1.1.1 Kết xác định tỉ lệ nhiễm Aspergillus nhóm Flavi mẫu bắp 19 4.1.1.2 Kết xác định tỉ lệ nhiễm Aspergillus nhóm Flavi mẫu
- Xem thêm -

Xem thêm: XÁC ĐỊNH Aspergillus NHÓM Flavi SINH ĐỘC TỐ AFLATOXIN TRONG NÔNG SẢN BẰNG KỸ THUẬT PCR , XÁC ĐỊNH Aspergillus NHÓM Flavi SINH ĐỘC TỐ AFLATOXIN TRONG NÔNG SẢN BẰNG KỸ THUẬT PCR

Gợi ý tài liệu liên quan cho bạn

Nhận lời giải ngay chưa đến 10 phút Đăng bài tập ngay