XÁC ĐỊNH MỐI QUAN HỆ GIỮA SỰ HIỆN DIỆN CỦA CÁC GEN GÂY ĐỘC aerA, ahpA, lip VÀ ĐỘC LỰC CỦA Aeromonas hydrophila GÂY BỆNH TRÊN CÁ TRA (Pangasius hypophthalmus)

75 1 0
  • Loading ...
1/75 trang

Thông tin tài liệu

Ngày đăng: 26/02/2019, 14:12

BỘ GIÁO DỤC ĐÀO TẠO TRƯỜNG ĐẠI HỌC NÔNG LÂM THÀNH PHỐ HỒ CHÍ MINH BỘ MƠN CƠNG NGHỆ SINH HỌC KHÓA LUẬN TỐT NGHIỆP XÁC ĐỊNH MỐI QUAN HỆ GIỮA SỰ HIỆN DIỆN CỦA CÁC GEN GÂY ĐỘC aerA, ahpA, lip ĐỘC LỰC CỦA Aeromonas hydrophila GÂY BỆNH TRÊN TRA (Pangasius hypophthalmus) Ngành học : CÔNG NGHỆ SINH HỌC Sinh viên thực : NGUYỄN THỊ NGỌC THÙY Niên khóa : 2009 – 2013 Tháng 6/2013 BỘ GIÁO DỤC ĐÀO TẠO TRƯỜNG ĐẠI HỌC NÔNG LÂM THÀNH PHỐ HỒ CHÍ MINH BỘ MƠN CƠNG NGHỆ SINH HỌC KHÓA LUẬN TỐT NGHIỆP XÁC ĐỊNH MỐI QUAN HỆ GIỮA SỰ HIỆN DIỆN CỦA CÁC GEN GÂY ĐỘC aerA, ahpA, lip ĐỘC LỰC CỦA Aeromonas hydrophila GÂY BỆNH TRÊN TRA (Pangasius hypophthalmus) Hướng dẫn khoa học Sinh viên thực ThS NGUYỄN THỊ HIỀN NGUYỄN THỊ NGỌC THÙY Tháng 6/2013 LỜI CẢM ƠN Để hoàn thành luận văn này, đầu tiên, em xin cảm ơn Ban Giám Hiệu trường Đại học Nông Lâm Tp Hồ Chí Minh bày tỏ lòng biết ơn sâu sắc đến Thầy – PGS.TS Lê Đình Đơn, trưởng Bộ Mơn Công nghệ Sinh học, người tạo điều kiện cho em thực đề tài Cảm ơn thầy kính chúc thầy mạnh khỏe để tiếp tục dẫn dắt nhiều hệ sinh viên đường tri thức Xin bày tỏ lòng biết ơn sâu sắc đến ThS Nguyễn Thị Hiền, người trực tiếp hướng dẫn, giúp đỡ bảo tận tình cho em thời gian làm đề tài Nhân đây, em xin gửi lời cảm ơn đến anh chị: Võ Hồng Phượng, Ngơ Thị Bích Phượng, Mã Tú Lan, Phạm Võ Hồng Ánh, Chung Minh Lợi, Nguyễn Phạm Hoàng Huy, làm việc phòng Vi Khuẩn Học anh chị phòng Sinh Học Phân Tử: Nguyễn Hồng Lộc, Cao Thành Trung, Nguyễn Viết Dũng, trực thuộc Trung Tâm Quan Trắc Cảnh Báo Mơi Trường Phòng Ngừa Dịch Bệnh Thủy Sản Khu Vực Nam Bộ - Viện Nghiên Cứu Nuôi Trồng Thủy Sản II, với cô Tô Thị Nhã Trầm, cố vấn học tập lớp DH09SH thầy cô Bộ Môn Công Nghệ Sinh Học, người tạo điều kiện thuận lợi giúp đỡ em q trình thực đề tài Bên cạnh đó, ln có chia sẻ, động viên nhiệt tình giúp đỡ bạn: Ngô Thanh Cường, Nguyễn Thị Hồng Vân, Dương Huỳnh Ngọc Trân, Phạm Công Nguyên, Nguyễn Chuyên Thuận, làm việc phòng Sinh Học Phân Tử thành viên lớp DH09SH, xin cảm ơn chúc bạn thành công sống Cuối cùng, xin dành tình cảm thiêng liêng gửi tới cha mẹ tồn thể gia đình Mọi người ln ln dõi theo, chăm sóc, ủng hộ động viên bước đường Gia đình chỗ dựa vững nơi hạnh phúc Do hạn chế thời gian kiến thức nên luận văn khơng thể tránh khỏi thiếu sót định, mong nhận góp ý chân thành thầy cô bạn Thủ Đức, tháng 06 năm 2013 Sinh viên Nguyễn Thị Ngọc Thùy i TÓM TẮT tra đối tượng nuôi mang lại giá trị kinh tế cao ngành nuôi nước đồng sông Cửu Long Tuy nhiên, bệnh xuất huyết tra Aeromonas hydrophila gây thiệt hại đáng kể cho người ni Do đó, đề tài thực với mục đích đánh giá tần xuất xuất gen mã hóa cho aerolysin (aerA), serine protease (ahpA) lipase (lip) A hydrophila phân lập từ nguồn khác xác định mối quan hệ diện gen độc lực A hydrophila tra Xác định diện gen aerA, ahpA lip phương pháp PCR 93 chủng vi khuẩn A hydrophila phân lập từ bệnh, khỏe môi trường nước Các chủng vi khuẩn chia thành tổ hợp gene dựa kết PCR: aerA- ahpA- lip- (12,9%), aerA- ahpA- lip+ (1,08%), aerA- ahpA+ lip- (8,6%), aerAahpA+ lip+ (4,3%), aerA+ ahpA- lip- (2,15%), aerA+ ahpA+ lip- (4,3%) aerA+ ahpA+ lip+ (66,67%) Tiến hành xác định liều gây chết 50% (LD50) chủng vi khuẩn mang tổ hợp gen tra phòng thí nghiệm Kết cho thấy chủng có tổ hợp gen aerA+ ahpA+ lip+ có giá trị LD50 < 103 CFU/cá, tổ hợp gen aerA- ahpA- lipcó giá trị > 108 CFU/cá Có thể thấy khả gây độc A hydrophilamối liên quan chặt chẽ với diện gen độc Các chủng A hydrophila mang tổ hợp gen aerA+ ahpA+ lip+ tìm thấy từ bệnh nhiều từ khỏe môi trường nước có tỉ lệ cao so với tổ hợp gen lại ii SUMMARY In recent years, freshwater catfish, Pangasius hypophthalmus, has become one of aqua - species with highly economic value in Mekong Delta However, diseases have been occurred, particularly the haemorrhages caused by Aeromonas hydrophila in catfish caused unbenefied for fish farms Therefore, this study was carried out to evaluate the frequency of the aerolysin (aerA), serine protease (ahpA) and lipase (lip) gens isolates from different sources, and to determine the relationship between the presence of these gens and virulence of A hydrophila in catfish A total of 93 A hydrophila strains isolated from diseased fish, healthy fish and water environment was analysed with respect to the prevalence of aerA, ahpA and lip gens by PCR assay These isolates were divided into groups on the basis of PCR results: aerA- ahpA- lip- (12.9%), aerA- ahpA- lip+ (1.08%), aerA- ahpA+ lip- (8.6%), aerA- ahpA+ lip+ (4.3%), aerA+ ahpA- lip- (2.15%), aerA+ ahpA+ lip- (4.3%) and aerA+ ahpA+ lip+ (66.67%) The challenge tests to identify 50% lethal dose (LD50) of A hydrophila were carried out in wetlab The LD50s of aerA+ ahpA+ lip+ group was < 103 CFU per fish and of aerA- ahpA- lip- group was > 108 CFU per fish in catfish The result reported that virulence properties of A hydrophila well correlated with the presence of virulence gens tested The aerA+ ahpA+ lip+ group be found more in A hydrophila from diseased fish than from healthy fish and water environment at the rate were higher than the other six gentic profiles Key word: aerolysin (aerA), Aeromonas hydrophila, serine protease (ahpA), lipase (lip), virulence properties iii MỤC LỤC LỜI CẢM ƠN i TÓM TẮT ii SUMMARY iii MỤC LỤC iv DANH SÁCH CÁC CHỮ VIẾT TẮT vii DANH SÁCH CÁC BẢNG viii DANH SÁCH CÁC HÌNH ix Chương MỞ ĐẦU 1.1 Đặt vấn đề 1.2 Yêu cầu đề tài .2 1.3 Nội dung thực Chương TỔNG QUAN TÀI LIỆU .3 2.1 Giới thiệu vi khuẩn Aeromonas hydrophila 2.1.1 Đặc điểm 2.1.1.1 Đặc điểm hình thái .3 2.1.1.2 Đặc điểm phát triển 2.1.1.3 Đặc tính sinh hóa 2.1.1.4 Đặc điểm phân bố .4 2.1.1.5 Cơ chế gây bệnh 2.1.2 Bộ gen hoàn chỉnh chủng A hydrophila ATCC 7966T .5 2.1.3 Yếu tố độc lực A hydrophila 2.1.3.1 Yếu tố bám dính số thành phần khác .5 2.1.3.2 Sản phẩm ngoại bào (ECPs - extracelluar products) 2.2 Giới thiệu tra Pangasius hypophthalmus Sauvage, 1878 10 2.2.1 Hình thái 10 2.2.2 Đặc điểm sinh trưởng .10 iv 2.2.3 Đặc điểm sinh sản 10 2.3 Ngành nuôi tra Việt Nam 10 2.2.1 Tình hình ni tra 10 2.2.2 Các bệnh thường gặp tra 12 2.2.2.1 Bệnh vi khuẩn 12 2.2.2.2 Bệnh ký sinh trùng 12 2.2.2.3 Bệnh chưa rõ nguyên nhân .13 2.2.3 Bệnh xuất huyết phương pháp kiểm soát bệnh 13 2.2.3.1 Bệnh xuất huyết 13 2.2.3.2 Một số phương pháp kiểm soát bệnh 14 2.4 Một số nghiên cứu có liên quan đến A hydrophila .15 2.4.1 Nghiên cứu nước 15 2.4.2 Nghiên cứu nước 15 2.5 Sơ lược PCR (Polymerase Chain Reaction) 17 2.6 Các phương pháp gây bệnh thực nghiệm 19 2.6.1 Gây bệnh phương pháp tiêm 20 2.6.2 Gây bệnh thực nghiệm cách ngâm cohabitant – nuôi chung 20 2.6.3 Gây bệnh phương pháp cho ăn 21 Chương VẬT LIỆU PHƯƠNG PHÁP NGHIÊN CỨU 22 3.1 Thời gian địa điểm nghiên cứu .22 3.2 Vật liệu, dụng cụ hóa chất .22 3.2.1 Vật liệu .22 3.2.2 Dụng cụ, thiết bị hóa chất 22 3.2.2.1 Dụng cụ thiết bị 22 3.2.2.2 Hóa chất 24 3.3 Phương pháp nghiên cứu .25 3.3.1 Ly trích DNA vi khuẩn 25 3.3.2 Phản ứng PCR xác định diện gen gây độc .25 3.3.2.1 Quy trình PCR phát gen aerA 25 3.3.2.2 Quy trình PCR phát gen ahpA 25 v 3.3.2.3 Quy trình PCR phát gen lip 26 3.3.3 Điện di kiểm tra kết chạy PCR 26 3.3.4 Chuẩn bị tra thí nghiệm điều kiện ni 26 3.3.5 Chuẩn bị vi khuẩn gây nhiễm 27 3.3.6 Phương pháp tiêm xoang bụng 27 3.3.7 Phương pháp theo dõi sau gây bệnh thực nghiệm .28 3.3.8 Phương pháp xác định LD50 theo Reed-Muench (1938) 28 3.4 Bố trí thí nghiệm 29 3.4.1 Xác định chủng A hydrophila mang tổ hợp gen khác 29 3.4.2 Đánh giá độc lực 10 chủng vi khuẩn mang tổ hợp gen khác 30 3.4.3 Xác định mối quan hệ diện gen độc độc lực vi khuẩn 30 3.5 Phương pháp xử lý thống kê 30 4.1 Kết 32 4.1.1 Sự diện gen aerA, ahpA lip chủng A hydrophila .32 4.1.2 Độc lực chủng vi khuẩn A hydrophila mang tổ hợp gen khác 34 4.1.3 Mối quan hệ diện gen độc độc lực vi khuẩn 41 4.2 Thảo luận 42 5.1 Kết luận 45 5.2 Đề nghị 45 TÀI LIỆU THAM KHẢO .46 vi DANH SÁCH CÁC CHỮ VIẾT TẮT API 20E: Hệ thống định danh vi khuẩn họ Enterobacteriaceae vi khuẩn Gram âm hình que (Biomerieux, Pháp) APW: Alkaline Peptone Water BHIB: Brain Heart Infusion Broth bp: base pair CFU: colony forming unit (khuẩn lạc) ctv: cộng tác viên ĐBSCL: Đồng Bằng Sông Cửu Long DNA: deoxyribonucleic acid dNTPs: deoxynucleoside triphosphate ECPs: extracelluar products EDTA: Ethylene diamine tetraacetic acid FlgK: a flagellar hook – filament junction protein IM: Intra – muscular IP: Intra – peritoneal kbp: kilo base pair LD50: Lethal dose 50% (liều gây chết 50%) lps: lipopolysaccharides NA: Nutrient Agar ng: nanogram OD: Optical Density (mật độ quang) OMPs: outer membrane proteins PCR: Polymerase Chain Reaction PD: proportionate distance (khoảng cách tỷ lệ) ppt: phần nghìn SDS: Sodium dodecyl sunfate TSA: Tryptone Soy Agar vii DANH SÁCH CÁC BẢNG Trang Bảng 2.1 Một số đặc điểm gen A hydrophila ATCC 7966T Bảng 2.2 Một số sản phẩm ngoại bào Aeromonas Bảng 2.3 Tình hình sản xuất tiêu thụ tra đến ngày 30/8/2012 11 Bảng 3.1 Bố trí thí nghiệm 10 chủng vi khuẩn gây bệnh thực nghiệm 31 Bảng 4.1 Kết tỷ lệ xuất tổ hợp gen 33 Bảng 4.2 Kết tỷ lệ tổ hợp gen 34 Bảng 4.3 Tỷ lệ chết 10 chủng vi khuẩn gây bệnh thực nghiệm 39 Bảng 4.3 (tt) Tỷ lệ chết 10 chủng vi khuẩn gây bệnh thực nghiệm 40 Bảng 4.4 Bảng so sánh giá trị LD50 chủng vi khuẩn gây bệnh thực nghiệm 41 viii Tài liệu internet 55 http://en.wikipedia.org/wiki/Aeromonas_hydrophila NT Diện tích sản lượng thu hoạch tra tháng 8/2012 tăng nhẹ so với kỳ năm 2011 2012 http://www.vasep.com.vn/Tin-Tuc/51_21606/Dien-tich-va-san-luong-thuhoach-ca-tra-thang-82012-tang-nhe-so-voi-cung-ky-nam-2011.htm 56 Thu Hiền Sản xuất thủy sản tháng đầu năm 2013 2013 http://www.fistenet.gov.vn-/b-tin-tuc-su-kien/a-tin-van/san-xuat-thuy-san-3-thang111au-nam-2013 Nguyễn Trang Giữ ổn định diện tích ni tra 2012 http://www.vasep.com.vn/Tin-Tuc/51_23887/Giu-on-dinh-dien-tich-nuoi-ca-tra.htm 57 50 PHỤ LỤC Phụ lục 1: Bảng thông tin nguồn gốc kết PCR 93 chủng vi khuẩn A hydrophila STT Ngày thu Tỉnh Kích cỡ 25/09/12 Vĩnh Long 40 con/kg Ao (500600g/con) Ao6 (150g/con) Ao 12 xử lý Nhiều kích cỡ 45 con/kg 30con/kg33con/kg 12 g/con 02/10/12 Vĩnh Long 02/10/12 Vĩnh Long 03/10/12 Vĩnh Long 12/11/12 12/11/12 Cần Thơ An Giang 30/10/12 Vĩnh Long 30/10/12 Vĩnh Long 16/08/12 An Giang 10 11 12 16/08/12 03/10/12 03/10/12 An Giang Vĩnh Long Vĩnh Long 13 30/10/12 Đồng Tháp 150g/con 14 16/08/12 An Giang 30 con/kg Dấu hiệu lâm sàng Kí hiệu mẫu Kết PCR thận bị mủ, xuất huyết B34 aerA N ahpA N lip N xuất huyết, gan thận mủ B45 N N N xuất huyết vây B48 N N N xuất huyết, phù mắt B74 N N N hồi phục từ nhiều ao bệnh khác gan thận mủ xuất huyết B101 B105 N N N N N N xuất huyết B110 N N N Ao bệnh không cho ăn ao lờ đờ, xuất huyết đầu, hậu mơn, gan nhạt màu ao bình thường ao xuất huyết vây, thận sưng lờ đờ, thận sưng mủ vàng nắp mang xuất huyết nặng, mật sưng màu xanh đậm, chết xuất huyết hậu môn, gan thận mủ B141 N N N N4 N N N N6 N12 N15 N N N N N N N N N B88 N N P B5 N P N Phụ lục (tt) Bảng thông tin nguồn gốc kết PCR 93 chủng vi khuẩn A hydrophila STT Ngày thu Tỉnh Kích cỡ 16 17 18 19 20 21 30/10/12 30/10/12 15/08/12 24/08/12 25/09/12 12/11/12 Đồng Tháp Đồng Tháp An Giang An Giang Vĩnh Long Cần Thơ 150g/con 150g/con 22 16/08/12 An Giang 30 con/kg 23 16/08/12 An Giang 30 con/kg 24 03/10/12 Vĩnh Long 25 12/11/12 Cần Thơ 26 27 24/09/12 30/10/12 Vĩnh Long Đồng Tháp 28 23/08/12 An Giang 29 03/10/12 Vĩnh Long 30 03/10/12 Vĩnh Long 31 31/10/12 Đồng Tháp Ao 12 xử lý Nhiều kích cỡ 25 con/kg 150g/con 40-50 con/kg Ao 1(3035g/con) Ao 12 xử lý 200g/con Dấu hiệu lâm sàng lồi mắt lờ đờ, xuất huyết bên Ao xuất huyết vây ngực, đầu, miệng, hậu mơn, gan ao có dấu hiệu xuất huyết chung thận sưng, xuất huyết đầu vây đuôi ao khỏe xuất huyết vây bụng,đầu, miệng, gan xung huyết, thận mủ xuất huyết vây bụng, hậu môn, gan xung huyết mủ, thận nhũn Kí hiệu mẫu B83 B86 N1 N9 N14 N16 Kết PCR aerA ahpA lip N P N N P N N P N N P N N P N N P N B3 N P P B7 N P P xuất huyết, phù mắt B71 N P P hồi phục từ nhiều ao bệnh khác B99 N P P hoại tử phần đầu nắp mang, xuất huyết lờ đờ, xuất huyết bên dấu hiệu chung: xuất huyết vây ngực, vây đuôi, thận sưng, B30 B85 P P N N N N B12 P P N thận sưng B56 P P N lờ đờ, thận sưng bóng nhũn B77 P P N khỏe K13 P P N Phụ lục (tt) Bảng thông tin nguồn gốc kết PCR 93 chủng vi khuẩn A hydrophila STT Ngày thu Tỉnh Kích cỡ 32 16/08/12 An Giang 400g/con 33 34 35 36 16/08/12 16/08/12 16/08/12 23/08/12 An Giang An Giang An Giang An Giang 37 23/08/12 An Giang 38 39 40 41 42 43 44 45 46 47 48 23/08/12 23/08/12 23/08/12 24/09/12 24/09/12 25/09/12 25/09/12 25/09/12 25/09/12 25/09/12 25/09/12 An Giang An Giang An Giang Vĩnh Long Vĩnh Long Vĩnh Long Vĩnh Long Vĩnh Long Vĩnh Long Vĩnh Long Vĩnh Long 49 02/10/12 Vĩnh Long 50 03/10/12 Vĩnh Long Dấu hiệu lâm sàng lờ đờ, xuất huyết phần đầu, hậu môn sưng to, thận sậm màu 400g/con lờ đờ xuất huyết 400g/con chớm bệnh, gan nhạt màu 400g/con chớm bệnh, gan nhạt màu giống thận sưng dấu hiệu chung: xuất huyết vây ngực, vây đuôi, 40-50 con/kg thận sưng, 50-60 con/kg không thấy rõ dấu hiện, xuất huyết, thận sưng 50-60 con/kg không thấy rõ dấu hiện, xuất huyết, thận sưng 50-60 con/kg không thấy rõ dấu hiện, xuất huyết, thận sưng 25 con/kg phù mắt, hoại tử gần vây ngực 25 con/kg xung huyết dày, gan thận mủ 40 con/kg xuất huyết, phù mắt 40 con/kg xuất huyết, phù mắt 40 con/kg xuất huyết, phù mắt 40 con/kg xuất huyết, phù mắt 40 con/kg xuất huyết, phù mắt 40 con/kg xuất huyết, phù mắt Ao (500xuất huyết, gan thận mủ 600g/con) Ao gan thận lách mủ, xuất huyết bên ngồi Kí hiệu mẫu Kết PCR aerA ahpA lip B9 P P P B10 B11 B13 B18 P P P P P P P P P P P P B22 P P P B24 B25 B27 B28 B29 B37 B38 B39 B41 B42 B43 P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P B44 P P P B47 P P P Phụ lục (tt) Bảng thông tin nguồn gốc kết PCR 93 chủng vi khuẩn A hydrophila STT Ngày thu Tỉnh 51 02/10/12 Vĩnh Long 52 02/10/12 Vĩnh Long 53 02/10/12 Vĩnh Long 54 02/10/12 Vĩnh Long 55 03/10/12 Vĩnh Long 56 03/10/12 Vĩnh Long 57 03/10/12 Vĩnh Long 58 03/10/12 Vĩnh Long 59 03/10/12 Vĩnh Long 60 03/10/12 Vĩnh Long 61 03/10/12 Vĩnh Long 62 03/10/12 Vĩnh Long 63 03/10/12 Vĩnh Long Kích cỡ Ao (150g/con) Ao (150g/con) Ao 12 (100g/con) Ao 12 (100g/con) Ao (3035g/con) Ao 1(3035g/con) Ao 1(3035g/con) Ao 1(3035g/con) Ao 12 (100g/con) Ao 12 (100g/con) Ao 12 (100g/con) Ao 12 (100g/con) Ao 12 (100g/con) Kết PCR aerA ahpA lip Dấu hiệu lâm sàng Kí hiệu mẫu xuất huyết vây B49 P P P bệnh khơng có dấu hiệu rõ B50 P P P hoại tử đầu phần thân B51 P P P hoại tử đầu phần thân B52 P P P thận sưng B53 P P P thận sưng B54 P P P thận sưng B55 P P P thận sưng B57 P P P thận nhũn sưng B58 P P P thận sưng, dịch vàng xoang bụng B59 P P P xuất huyết vây, nắp mang B60 P P P xuất huyết vây, nắp mang B61 P P P xuất huyết vây, nắp mang B62 P P P Phụ lục (tt) Bảng thông tin nguồn gốc kết PCR 93 chủng vi khuẩn A hydrophila STT Ngày thu Tỉnh 64 03/10/12 Vĩnh Long 65 03/10/12 Vĩnh Long 66 67 68 69 70 71 03/10/12 03/10/12 03/10/12 03/10/12 03/10/12 03/10/12 Vĩnh Long Vĩnh Long Vĩnh Long Vĩnh Long Vĩnh Long Vĩnh Long 72 03/10/12 Vĩnh Long 73 03/10/12 Vĩnh Long 74 03/10/12 Vĩnh Long 75 03/10/12 Vĩnh Long 76 03/10/12 Vĩnh Long 77 03/10/12 Vĩnh Long 78 03/10/12 Vĩnh Long Kích cỡ Ao 12 (100g/con) Ao 12 (100g/con) Ao Ao Ao Ao Ao Ao Ao12 xử lý Ao 12 xử lý Ao 12 xử lý Ao 12 xử lý Ao 12 xử lý Ao 12 xử lý Ao 12 xử lý Kết PCR aerA ahpA lip Dấu hiệu lâm sàng Kí hiệu mẫu xuất huyết vây, nắp mang B63 P P P xuất huyết vây, nắp mang B64 P P P xuất huyết, bong bóng nhũn, gan nhạt thận sưng, sậm màu thận sưng, sậm màu thận sưng, sậm màu lồi mắt, nhũn bóng xuất huyết phần đầu B65 B66 B67 B68 B69 B70 P P P P P P P P P P P P P P P P P P xuất huyết, phù mắt B72 P P P xuất huyết, phù mắt B73 P P P lờ đờ, thận sưng bóng nhũn B75 P P P lờ đờ, thận sưng bóng nhũn B76 P P P lờ đờ, thận sưng bóng nhũn B78 P P P lờ đờ, thận sưng bóng nhũn B79 P P P lờ đờ, thận sưng bóng nhũn B80 P P P Phụ lục (tt) Bảng thông tin nguồn gốc kết PCR 93 chủng vi khuẩn A hydrophila STT Ngày thu Tỉnh Kích cỡ 79 30/10/12 Đồng Tháp 150g/con 80 30/10/12 Đồng Tháp 200 g/con 81 12/11/12 Cần Thơ 150-200g 82 12/11/12 Cần Thơ 150-200g 83 84 85 86 87 88 89 90 12/11/12 12/11/12 16/08/12 16/08/12 16/08/12 31/10/12 16/08/12 23/08/12 An Giang An Giang An Giang An Giang An Giang Đồng Tháp An Giang An Giang thu chung thu chung 200-300g/con 200-300g/con 1,7cm 200g/con 91 24/09/12 Vĩnh Long 92 93 12/11/12 12/11/12 An Giang An Giang Dấu hiệu lâm sàng nắp mang xuất huyết nặng, mật sưng màu xanh đậm, chết lờ đờ, xuất huyết vây, thận sưng, ruột có dịch lờ đờ, phù mắt, xuất huyết bên bên nội tạng lờ đờ, xuất huyết xung quanh mắt, phù mắt,xuất huyết bên nội tạng lồi mắt, xuất huyết nặng lồi mắt, xuất huyết nặng bình thường bình thường bình thường khỏe ao bình thường ao có dấu hiệu xuất huyết chung ao xuất huyết, phù mắt, hoại tử gần vây ngực, đầu, nắp mang ao bệnh xuất huyết (B106, B107) ao bệnh xuất huyết (B106, B107) Kết PCR Kí hiệu mẫu aerA ahpA lip B87 P P P B90 P P P B94 P P P B95 P P P B106 B107 K1 K2 K5 K7 N5 N8 P P P P P P P P P P P P P P P P P P P P P P P P N13 P P P N17 N18 P P P P P P Phụ lục 2: Các thông số cặp mồi xác định gen aerA, ahpA lip Mồi Trình tự (5’ - 3’) Độ dài (Nu) Tmo (oC) %GC Kích thước (bp) AerA-F CAAGAACAAGTTCAAGTGGCCA 22 66,2 45,4 - AerA-R ACGAAGGTGTGGTTCCAGT 19 62,1 52,6 309 AhpA-F ATTGGATCCCTGCCTATCGCTTCAGTTCA 29 75,8 48,2 - AhpA-R GCTAAGCTTGCATCCGTGCCGTATTCC 27 75,9 55,5 1011 Lip-F AACCTGGTTCCGCTCAAGCCGTTG 24 76,1 58,3 - Lip-R TTGCTCGCCTCGGCCCAGCAGCT 23 81,5 69,5 760 Nu: Tham khảo Wang ctv, 2003 Zheng ctv, 2012 Cascón ctv, 1996 nucleotide Phụ lục 3: Bảng số liệu chết cộng dồn theo ngày Ngày Nghiệm Chủng thức N1 N2 N3 N4 N5 N6 N7 N8 N9 107 CFU/cá B110 108 CFU/cá 109 CFU/cá 10 13 108 CFU/cá 106 CFU/cá 107 CFU/cá 103 CFU/cá B40 104 CFU/cá 105 CFU/cá B99 105 CFU/cá 106 CFU/cá 20 17 15 1 18 10 16 80 16 80 20 0 20 19 20 14 30 17 15 19 20 100 15 16 80 20 0 20 0 20 1 19 21 21 100 20 20 100 11 55 14 30 105 CFU/cá B05 106 CFU/cá 107 CFU/cá Tỷ Số lệ chết sống (%) 20 105 CFU/cá B88 Số chết 15 25 14 70 13 15 75 11 45 20 19 18 10 19 1 1 Phụ lục (tt): Bảng số liệu chết cộng dồn theo ngày Ngày Chủng B99 Nghiệm thức N1 N2 N3 N4 N5 N6 N7 N8 N9 107 CFU/cá 11 108 CFU/cá 109 CFU/cá B85 B12 15 10 10 50 19 19 95 17 17 85 20 20 100 18 20 100 5x106 CFU/cá 15 25 15 25 5x107 CFU/cá 20 20 100 20 20 100 5x108 CFU/cá 19 19 95 19 19 95 5x103 CFU/cá 10 10 10 50 12 40 5x104 CFU/cá 12 40 7 13 35 5x105 CFU/cá 19 19 95 17 85 5x106 CFU/cá 18 18 90 20 100 5x107 CFU/cá 20 20 100 20 20 100 12 60 10 10 10 50 15 75 12 60 15 17 85 18 20 100 15 16 80 14 70 102 CFU/cá 103 CFU/cá 104 CFU/cá 16 19 1 10 101 CFU/cá B107 Số chết Tỷ Số lệ chết sống (%) 75 14 Phụ lục (tt): Bảng số liệu chết cộng dồn theo ngày Ngày Chủng Nghiệm thức N1 N2 N3 N4 N5 N6 N7 N8 N9 105 CFU/cá 106 CFU/cá 102 CFU/cá K02 103 CFU/cá 104 CFU/cá 102 CFU/cá N05 103 CFU/cá 104 CFU/cá Đối chứng Số chết Tỷ Số lệ chết sống (%) 95 19 19 20 20 100 19 19 95 19 19 95 13 65 13 65 10 11 55 10 10 50 15 18 90 17 20 100 1 18 10 11 55 4 10 10 50 10 10 50 10 17 85 17 85 20 0 20 1 Nước muối sinh lý Ngày thí nghiệm ngày 1; N: ngày; nồng độ gồm bể Phụ lục 4: Bảng tính giá trị LD50 Bảng Bảng tính giá trị LD50 chủng B101 Nghiệm thức Tổng chết Tổng sống Tổng chết dồn Tổng sống dồn Tỷ lệ chết dồn (%) 109 CFU/cá 32 37 82,2 35 43 10,4 40 83 10 CFU/cá 10 CFU/cá PD = (82,2 - 50)/(82,2 - 10,4) = 0,45 LD50 = 10(9 - 0,45) = 108,55 = 3,55x108 CFU/0,2 ml/cá Bảng Bảng tính giá trị LD50 chủng B88 Nghiệm thức Tổng chết Tổng sống Tổng chết dồn Tổng sống dồn 108 CFU/cá 36 46 Tỷ lệ chết dồn (%) 92 107 CFU/cá 31 10 35 22,22 106 CFU/cá 39 74 1,33 105 CFU/cá 40 114 PD = (92 - 50)/(92 - 22,22) = 0,6 LD50 = 10(8 - 0,6) = 107,4 = 2,51x107 CFU/0,2 ml/cá Bảng Bảng tính giá trị LD50 chủng B05 Nghiệm thức Tổng chết Tổng sống Tổng chết dồn Tổng sống dồn Tỷ lệ chết dồn (%) 107 CFU/cá 41 42 100 39 39 2,5 40 79 10 CFU/cá 10 CFU/cá PD = (100 - 50)/(100 - 2,5) = 0,51 LD50 = 5x10(7 - 0,51) = 106,49 = 3,09x106 CFU/0,2 ml/cá Bảng Bảng tính giá trị LD50 chủng B40 Nghiệm thức Tổng chết Tổng sống Tổng chết dồn Tổng sống dồn Tỷ lệ chết dồn (%) 105 CFU/cá 24 16 60 16 78,95 104 CFU/cá 19 21 36 37 49,32 17 23 17 60 22,08 10 CFU/cá PD = (78,95 - 50)/(78,95 - 49,32) = 0,98 LD50 = 10(5 - 0,98) = 104,02 = 1,05x104 CFU/0,2 ml/cá Bảng Bảng tính giá trị LD50 chủng B99 Nghiệm thức Tổng chết Tổng sống Tổng chết dồn Tổng sống dồn 109 CFU/cá 40 105 Tỷ lệ chết dồn (%) 100 108 CFU/cá 36 65 94,2 25 15 29 19 60,4 37 56 6,67 39 95 1,04 10 CFU/cá 10 CFU/cá 10 CFU/cá PD = (60,4 - 50)/(60,4 - 6,67) = 0,19 LD50 = 10(7 - 0,19) = 106,81 = 6,46x106 CFU/0,2 ml/cá Bảng Bảng tính giá trị LD50 chủng B85 Nghiệm thức Tổng chết Tổng sống Tổng chết dồn 5x108 CFU/cá 39 89 Tỷ lệ chết dồn (%) 98,89 5x107 CFU/cá 40 50 98,04 5x106 CFU/cá 10 30 10 31 24,39 Tổng sống dồn PD = (98,04 - 50)/(98,04 - 24,39) = 0,65 LD50 = 5x10(7 - 0,65) = 5x106,35 = 1,12x107 CFU/0,2 ml/cá Bảng Bảng tính giá trị LD50 chủng B12 Nghiệm thức Tổng chết Tổng sống Tổng chết dồn 5x107 CFU/cá 40 147 Tỷ lệ chết dồn (%) 100 5x10 CFU/cá 38 107 98,17 5x105 CFU/cá 36 69 92 5x104 CFU/cá 15 25 33 31 51,56 5x103 CFU/cá 18 22 18 53 25,35 Tổng sống dồn PD = (51,56 - 50)/(51,56 - 25,35) = 0,06 LD50 = 5x10(4 - 0,06) = 5x103,94 = 4,36x104 CFU/0,2 ml/cá Bảng Bảng tính giá trị LD50 chủng B107 38 193 Tỷ lệ chết dồn (%) 98,97 39 155 98,1 30 10 116 13 89,92 10 CFU/cá 37 86 16 84,31 102 CFU/cá 27 13 49 29 62,82 101 CFU/cá 22 18 22 47 31,88 Nghiệm thức Tổng chết Tổng sống Tổng chết dồn Tổng sống dồn 106 CFU/cá 10 CFU/cá 10 CFU/cá PD = (62,82 - 50)/(62,82 - 31,88) = 0,41 LD50 = 10(2 - 0,41) = 101,59 = 38,9 CFU/0,2 ml/cá Bảng Bảng tính giá trị LD50 chủng K02 Nghiệm thức Tổng chết Tổng sống Tổng chết dồn Tổng sống dồn Tỷ lệ chết dồn 104 CFU/cá 38 85 98 103 CFU/cá 21 19 47 21 69 102 CFU/cá 26 14 26 35 43 PD = (69,12 - 50)/(69,12 - 42,62) = 0,72 LD50 = 10(3 - 0,72) = 102,28 = 1,91x102 CFU/0,2 ml/cá Bảng 10 Bảng tính giá trị LD50 chủng N05 Nghiệm thức Tổng chết Tổng sống Tổng chết dồn Tổng sống dồn Tỷ lệ chết dồn 104 CFU/cá 34 67 92 20 20 33 26 56 13 27 13 53 20 10 CFU/cá 10 CFU/cá PD = (55,93 - 50)/(55,93 - 19,7) = 0,16 LD50 = 10(3 - 0,16) = 102,84 = 6,92x102 CFU/0,2 ml/cá PD: proportionate distance (khoảng cách tỷ lệ); LD50: Lethal dose 50% (liều gây chết 50%); CFU: colony forming unit (khuẩn lạc) ... bệnh xuất huyết A hydrophila 1.2 Yêu cầu đề tài Nghiên cứu mối quan hệ diện gen gây độc aerA, ahpA, lip độc lực A hydrophila gây bệnh cá tra 1.3 Nội dung thực - Xác định diện gen aerA, ahpA lip. .. cứu độc lực, chọn lựa chủng vi khuẩn để làm vaccine quan trọng Xuất phát từ ý tưởng trên, đề tài Xác định mối quan hệ diện gen gây độc aerA, ahpA, lip độc lực Aeromonas hydrophila gây bệnh cá tra. .. VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC NÔNG LÂM THÀNH PHỐ HỒ CHÍ MINH BỘ MƠN CƠNG NGHỆ SINH HỌC KHÓA LUẬN TỐT NGHIỆP XÁC ĐỊNH MỐI QUAN HỆ GIỮA SỰ HIỆN DIỆN CỦA CÁC GEN GÂY ĐỘC aerA, ahpA, lip VÀ ĐỘC LỰC CỦA
- Xem thêm -

Xem thêm: XÁC ĐỊNH MỐI QUAN HỆ GIỮA SỰ HIỆN DIỆN CỦA CÁC GEN GÂY ĐỘC aerA, ahpA, lip VÀ ĐỘC LỰC CỦA Aeromonas hydrophila GÂY BỆNH TRÊN CÁ TRA (Pangasius hypophthalmus) , XÁC ĐỊNH MỐI QUAN HỆ GIỮA SỰ HIỆN DIỆN CỦA CÁC GEN GÂY ĐỘC aerA, ahpA, lip VÀ ĐỘC LỰC CỦA Aeromonas hydrophila GÂY BỆNH TRÊN CÁ TRA (Pangasius hypophthalmus)

Gợi ý tài liệu liên quan cho bạn

Nhận lời giải ngay chưa đến 10 phút Đăng bài tập ngay