MỐI LIÊN HỆ GIỮA SỰ HIỆN DIỆN CỦA CÁC GENalt, astVÀahh1VỚI ĐỘC LỰC CỦA VI KHUẨN Aeromonas hydrophila TRÊN CÁ TRA (Pangasius hypophthalmus)

65 2 0
  • Loading ...
1/65 trang

Thông tin tài liệu

Ngày đăng: 26/02/2019, 14:11

BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC NÔNG LÂM THÀNH PHỐ HỒ CHÍ MINH BỘ MƠN CƠNG NGHỆ SINH HỌC KHÓA LUẬN TỐT NGHIỆP MỐI LIÊN HỆ GIỮA SỰ HIỆN DIỆN CỦA CÁC GENalt, astVÀahh1VỚI ĐỘC LỰC CỦA VI KHUẨN Aeromonas hydrophila TRÊN TRA (Pangasius hypophthalmus) Ngành học : CÔNG NGHỆ SINH HỌC Sinh viên : NGÔ THANH CƯỜNG Niên khóa : 2009 – 2013 Tháng 06/2013 BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC NÔNG LÂM THÀNH PHỐ HỒ CHÍ MINH BỘ MƠN CƠNG NGHỆ SINH HỌC KHÓA LUẬN TỐT NGHIỆP MỐI LIÊN HỆ GIỮA SỰ HIỆN DIỆN CỦA CÁC GENalt, astVÀahh1 VỚI ĐỘC LỰC CỦA VI KHUẨN Aeromonas hydrophila TRÊN TRA (Pangasius hypophthalmus) Hướng dẫn khoa học Sinh viên thực ThS NGUYỄN THỊ HIỀN NGÔ THANH CƯỜNG Tháng 06/2013 LỜI CẢM ƠN Tôi xin chân thành cảm ơn: Ban giám hiệu trường Đại Học Nông Lâm TP.HCM, Ban chủ nhiệm môn công nghệ sinh học, với tất quý thầy cô truyền đạt kiến thức cho suốt q trình học tập trường PGS.TS Lê Đình Đơn, trưởng Bộ Môn Công Nghệ Sinh Học, người tạo điều kiện cho em thực đề tài ThS Nguyễn Thị Hiền hết lòng hướng dẫn tơi suốt trình thực tập tốt nghiệp Viện Nghiên Cứu Nuôi Trồng Thủy Sản II ThS Nguyễn Hồng Lộc, ThS Ngơ Thị Bích Phượng, KS Võ Thị Hồng Phượng, CN Mã Tú Lan, KS Chu Minh Lợi, KS Nguyễn Phạm Hồng Huy tận tình bảo giúp đỡ tơi suốt q trình thực tập tốt nghiệp viện Các anh chị phòng phòng PCR phòng Vi Sinh thuộc Trung Tâm Quốc Gia Quan Trắc Cảnh Báo Mơi Trường Phòng Ngừa Dịch Bệnh Thuỷ Sản Khu Vực Nam Bộ - Viện Nghiên Cứu Nuôi Trồng Thuỷ Sản II Th.S Tô Thị Nhã Trầm cố vấn học tập lớp DH09SH, tận tình dạy suốt khoảng thời gian học tập làm đề tài tốt nghiệp Anh Phạm Công Nguyên, bạn Nguyễn Thị Ngọc Thùy, bạn Nguyễn Thị Hồng Vân, bạn Dương Huỳnh Ngọc Trân giúp đỡ công việc tinh thần suốt thời gian làm đề tài Viện Nghiên Cứu Và Nuôi Trồng Thủy Sản II Các bạn bè thân thương lớp CNSH K35 chia sẻ niềm vui, nỗi buồn thời gian học Đại học, tận tình giúp đỡ hỗ trợ trình làm thực tập tốt nghiệp Thành kính ghi ơn ba mẹ người thân gia đình ln tạo điều kiện động viên suốt trình học tập trường Sinh Viên Ngô Thanh Cường i   TĨM TẮT tra lồi dễ ni, mau lớn, sức chống chịu tốt, chiếm tỷ lệ xuất cao mang lại nguồn thu nhập lớn cho người nuôi vùng đồng sông Cửu Long Tuy nhiên, phát triển nghề nuôi tra với diện tích ao bè ni ngày tăng nhanh, mật độ nuôi dày đặc, môi trường nước ô nhiễm điều kiện bất lợi thời tiết tạo hội cho nhiều tác nhân gây bệnh phát triển lây lan Trong đó, vi khuẩn A.hydrophila gây bệnh xuất huyết tác nhân gây bệnh làm thiệt hại lớn cho người ni trồng vậy, để góp phần việc phòng tránh bệnh xuất huyết A hydrophila, dựa cơng trình ngồi nước, đề tài nghiên cứu diện gen hemolysin (ahh1), độc tố cytotocxin (ast) enterotocxin (alt) A hydrophila xác định mối quan hệ diện gen với độc lực A hydrophila tra A hydrophila phân lập từ bệnh (n=75), khỏe (n=5) môi trường nước (n=13), sử dụng PCR để đánh giá mức độ diện gen ahh1, alt, ast Các yếu tố độc lực mẫu phân lập từ mẫu bệnh, khỏe môi trường nước Có 89,23% chủng mang nhiều gen độc lực Kết thu 93 mẫu A hydrophila có 77 mẫu có genahh1, 80 mẫu có genalt 20 mẫu có genast đồng thời xác định tổ hợp gen A hydrophila gây bệnh với tỷ lệ Ast – Alt – Ahh1+ (3,22%), Ast –Alt +Ahh1–(6,45%), Ast – Alt +Ahh1+ (58,06%), Ast +Alt +Ahh1+ (21,50%), Ast– Alt–Ahh– (10,77%) gây nhiễm A hydrophila chết cấp tính chủ yếu, chết từ ngày đến ngày thứ Những chủng mang gen gây độcđộc lực mạnh với giá trị gây chết nhỏ 104 CFU/cá Xác định gen ahh1 mang độc lực mạnh, gen altvà ast góp phần giúp tăng độc lực A hydrophila Tổ hợp gen Ast + Alt +Ahh1+ diện mẫu phân lập từ bệnh, khỏe mơi trường nước có độc lực mạnh ii   SUMMARY Sutchi catfish having many advantages such as easy culture, fast growth, and good resistance make up a high export rate as well as give a large income for worker in Mekong delta However, the development of sutchi catfish culture areas and culture density combine with water polution and unfavourable weather give bacterium a chance to grow and infect A hydrophila bacterium causing motile Aeromonas septicaemia is a reason for the loss of farmers Therefore, in this study, the presence of alt, astandahh1genes and its relationship with virulence of A hydrophila in sutchi catfish were investigated A total ofA hydrophilastrains isolated from deseased fish (n=75), from healthy fish (n=5) and from water environment (n=13) was analysed with respect to the prevalence of ahh1, altand astgenes by PCR assay These virulence factors occur among clinical isolates as well as among isolates from healthy fish and water environment Most of the strains examined (89,23%) carried one or more virulence genes.Results obtained in 93 samples A hydrophila gene ahh1 had 77 samples, 80 samples and 20 samples had gen alt, astand identified groupsAst (3,22%), Ast – Alt + Ahh1– (6,45%), Ast Ahh1+(21,50%), andAst + – Alt –Ahh1 – – Alt + Ahh1 + – Alt –Ahh1 (58,06%), Ast + + Alt (10,77%) The experimentally infection indicated that geneAhh1play the main role in the virulence of A hydrophila.The genotypeAhh1+Ast+ Alt + presents in sample isolates from diseased fish, fish healthy and water had strong virulence Key words: A hydrophila, alt, hypophthalmus), virulence properties iii   ast,ahh1,sutchi catfish (Pangasius MỤC LỤC Trang Lời cảm ơn i  Summary iii  Mục lục iv  Danh sách chữ viết tắt vi  Danh sách bảng .vii  Danh sách hình viii  Chương MỞ ĐẦU 1  1.1 Đặt vấn đề  . 1  1.2 Mục tiêu nghiên cứu   2  1.3 Nội dung thực hiện   2  Chương TỔNG QUAN TÀI LIỆU 3  2.1.  Giới thiệu tra   3  2.1.1.  Phân loại   3  2.1.2.  Phân bố   4  2.1.3.  Hình thái   4  2.1.4.  Môi trường sống   4  2.1.5.  Đặc điểm dinh dưỡng   5  2.1.6.  Đặc điểm sinh trưởng   5  2.1.7.  Đặc điểm sinh sản tra  . 5  2.1.8.  Tình hình sản xuất tiêu thụ   6  2.1.9.  Các nghiên cứu nước liên quan tới A.hydrophila   6  2.1.9.1. Tình hình nước   6  2.1.9.2. Trên giới   7  2.2.1.  Phân loại vi khuẩn A hydrophila   8  2.2.2.  Giới thiệu A hydrophila  . 8  2.2.3.  Cấu trúc gen A hydrophila   9  2.2.4.  Các gen gây độc A hydrophila   9  2.2.4.1. Hemolysin   9  2.2.4.3. Enterotoxin   12  2.2.5.  Đối tượng gây bệnh A hydrophila   13  2.2.5.1. Gây bệnh cho người   13  2.2.5.2. Gây bệnh cho lưỡng cư   13  2.2.6.  Tác nhân gây bệnh   13  2.2.7.  Các phương pháp phòng trị bệnh tra   14  iv   2.2.7.1. Phòng bệnh   14  2.2.7.4. Trị bệnh   15  2.2.8.  Các phương pháp gây bệnh thực nghiệm   16  2.2.8.1. Gây bệnh phương pháp tiêm   16  2.2.8.2. Gây bệnh thực nghiệm phương pháp ngâm   16  2.2.8.3. Gây bệnh thực nghiệm phương pháp cho ăn   17  Chương VẬT LIỆU VÀ PHƯƠNG PHÁP 18  3.1.  Thời gian địa điểm thực tập   18  3.2.  Vật liệu   18  3.2.1.  Vi khuẩn   18  3.2.2.  giống   18  3.3.  Thiết bị, dụng cụ hóa chất   18  3.3.1.  Thiết bị, dụng cụ   18  3.3.2.  Hóa chất   19  3.4.  Phương pháp nghiên cứu   20  3.4.1.  Ly trích DNA   20  3.4.2.  Quy trình PCR phát hiện gen Ahh1   20  3.4.3.  Quy trình PCR phát gen Alt  . 21  3.4.4.  Quy trình PRC phát gen Ast.   21  3.4.5.  Phương pháp cá  . 22  3.4.6.  Chuẩn bị huyền dịch vi khuẩn sống   23  3.4.7.  Gây bệnh thực nghiệm phương pháp tiêm   23  3.4.8.  Phương pháp theo dõi sau gây bệnh thực nghiệm   23  3.4.9.  Phương pháp xác định LD50theo nồng độ vi khuẩn   24  3.5.  Bố trí thí nghiệm  . 25  3.5.1.  Xác định diện gen Ahh1, Alt Ast vi khuẩn A.hydrophila   25  3.5.2.  Xác định độc lực A.hydrophila mang tổ hợp gen gây độc thông qua gây bệnh thực nghiệm tra   25  3.5.3.  Xác định mối liên hệ kiểu gen Ahh1, Alt, Ast với độc lực A.hydrophilas   25  Chương KẾT QUẢ VÀ THẢO LUẬN 27  4.1.  Sự diện gen gây độcAhh1, Alt Ast A.hydrophila  . 27  4.2.  Độc lực A.hydrophila mang tổ hợp gen khác nhau   29  4.3.  Mối liên hệ diện gen Ahh1, Alt Ast độc lực A.hydrophila  . 32  Chương KẾT LUẬN VÀ ĐỀ NGHỊ 34  5.1.  Kết luận   34  5.2.  Kiến nghị   34  TÀI LIỆU THAM KHẢO 35  PHỤ LỤC 40  v   DANH SÁCH CÁC CHỮ VIẾT TẮT BA : Blood Agar (thạch máu) BHIB : Brain Heart Infusion Borth (môi trường dịch canh Brain Heart Infusion) CFU : Colony Forming Unit (đơn vị tạo thành khuẩn lạc) ĐBSCL : Đồng Bằng Sông Cửu Long DNA : Deoxyribonucleic acid EUS : Epizootic Ulcerative Syndrome (hội chứng lở loét) GDP : Gross Domestic Product(Tổng sản phẩm quốc nội) IM : Intra – muscular (tiêm vào cơ) IP : Intra – peritoneal (tiêm vào xoang bụng) IPNV : Infectious pancreatic necrosis virus (virus gây hoại tử tuyến tụy) LD : Lethal dose (Liều gây chết) NST : nhiễm sắc thể OD : Optical Density (mật độ quang) PBS : Phosphate Buffered Saline PCR : Polymerase Chain Reaction (phản ứng tổng hợp chuỗi) PD : proportionate distance (khoảng cách tỉ lệ) RNA : Ribonucleic acid rRNA : Ribosomal ribonucleic acid TBE : Tris / Borat / EDTA (Ethylenediaminetetraacetic acid) tRNA : Transfer Ribonucleic acid NC NTTSII : Viện Ngiên Cứu Nuôi Trồng Thủy Sản II tt : Tiếp theo vi   DANH SÁCH CÁC BẢNG Trang Bảng 3.1 Quy trình luân nhiệt genahh1 21 Bảng 3.2 Quy trình luân nhiệt genalt 21 Bảng 3.3 Quy trình luân nhiệt genast 22 Bảng 3.4 Theo dõi tỷ lệ chết, sống 24 Bảng 3.5 Thí nghiệm gây nhiễm 26 Bảng 4.1Sự diện gen ahh1, alt ast A hydrophila thuộc mẫu khác 28 Bảng 4.2Tỷ lệ tổ hợp gen A hydrophila phân lập từ tra 28 Bảng 4.3So sánh tổ hợp gen với độc lực A hydrophila 30 vii   DANH SÁCH CÁC HÌNH Trang Hình 2.1 tra Pangasius hypophthalmus Hình 2.2Aeromonas hydrophila Hình 2.3Kích thước gencủa A hydrophyla Hình 2.4Vi khuẩn A hydrophila môi trường thạch máu 10 Hình 2.5 Cấu trúc α-hemolysin 10 Hình 2.6Cấu trúc Aerolysin 11 Hình 2.7 Cấu trúc Enterotoxin 12 Hình 2.8 Các vị trí gây bệnh thực nghiệm 16 Hình 3.1 tra chuyển vào bể kính trước gây bệnh 22 Hình 3.2 Vị trí tiêm gây bệnh thực nghiệm 23 Hình 4.1Sản phẩm quy trình PCR alt, ahh1, ast 27 Hình 4.2 Biểu bệnh tích bên ngồi A hydrophila tra gây bệnh 31 Hình 4.3 Biểu bệnh tích bên tra vi khuẩn A hydrophila 31 viii   Phụ lục (tt) Bảng thông tin nguồn gốc kết PCR 93 chủng vi khuẩn A hydrophila STT   Ngày thu Tỉnh 14 15 30/10/12 30/10/12 Đồng Tháp Đồng Tháp 16 15/08/12 An Giang 17 24/08/12 18 Kích cỡ 150g/con 150g/con Dấu hiệu lâm sàng Kí hiệu mẫu Kết PCR B83 B86 Ast N N Alt P P Ahh1 P P N15 N N P An Giang Lồi mắt lờ đờ, xuất huyết bên Ao xuất huyết vây ngực, đầu, miệng, hậu mơn, gan Ao có dấu hiệu xuất huyết chung N09 N P P 25/09/12 Vĩnh Long thận sưng, xuất huyết đầu vây đuôi N14 N P N 19 12/11/2012 Cần Thơ N16 P P P 20 16/08/12 An Giang 30 con/kg Ao khỏe Xuất huyết vây bụng,đầu, miệng, gan xung huyết, thận mủ B03 N P P 21 16/08/12 An Giang 30 con/kg Xuất huyết vây bụng, hậu môn, gan xung huyết mủ, thận nhũn B70 N P P 22 3/10/2012 Vĩnh Long 23 12/11/2012 Cần Thơ 24 24/09/12 25 26 Ao 12 xử lý Nhiều kích cỡ Xuất huyết, phù mắt B71 N P P hồi phục từ nhiều ao bệnh khác B99 N P P Vĩnh Long 25 con/kg Hoại tử phần đầu nắp mang, xuất huyết B30 N P P 30/10/12 Đồng Tháp N P P An Giang lờ đờ, xuất huyết bên Dấu hiệu chung: xuất huyết vây ngực, vây đuôi, thận sưng, B85 23/08/12 150g/con 40-50 con/kg B12 P P N Phụ lục (tt) Bảng thông tin nguồn gốc kết PCR 93 chủng vi khuẩn A hydrophila   Kết PCR STT Ngày thu Tỉnh Kích cỡ Dấu hiệu lâm sàng Kí hiệu Ast Alt Ahh1 27 3/10/2012 Vĩnh Long Ao 1(30-35g/con) Thận sưng B56 P P P 28 3/10/2012 Vĩnh Long Ao 12 xử lý lờ đờ, thận sưng bóng nhũn B77 P P P 29 31/10/12 Đồng Tháp 200g/con K13 P P P 30 16/08/12 An Giang 400g/con B9 N P P 31 16/08/12 An Giang 400g/con khỏe lờ đờ, xuất huyết phần đầu, hậu môn sưng to, thận sậm màu lờ đờ xuất huyết B10 N P P 32 16/08/12 An Giang 400g/con chớm bệnh, gan nhạt màu B11 N P P 33 16/08/12 An Giang 400g/con chớm bệnh, gan nhạt màu B13 N P P 34 23/08/12 An Giang giống B18 N P P 35 23/08/12 An Giang 40-50 con/kg B22 N P P 36 23/08/12 An Giang 50-60 con/kg B24 N P P 37 23/08/12 An Giang 50-60 con/kg B25 N P P 38 23/08/12 An Giang 50-60 con/kg B27 N P P 39 24/09/12 Vĩnh Long 25 con/kg Thận sưng Dấu hiệu chung: xuất huyết vây ngực, vây đuôi, thận sưng, Không thấy rõ dấu hiện, xuất huyết, thận sưng Không thấy rõ dấu hiện, xuất huyết, thận sưng Không thấy rõ dấu hiện, xuất huyết, thận sưng Phù mắt, hoại tử gần vây ngực B28 N P P 40 24/09/12 Vĩnh Long 25 con/kg Xung huyết dày, gan thận mủ B29 N P P Phụ lục (tt) Bảng thông tin nguồn gốc kết PCR 91 chủng vi khuẩn A hydrophila   Kết PCR Ast Alt Ahh1 P P P N P P N P P N P P N P P N P P STT Ngày thu Tỉnh Kích cỡ Dấu hiệu lâm sàng Kí hiệu mẫu 41 42 43 44 45 46 25/09/12 25/09/12 25/09/12 25/09/12 25/09/12 25/09/12 Vĩnh Long Vĩnh Long Vĩnh Long Vĩnh Long Vĩnh Long Vĩnh Long Xuất huyết, phù mắt Xuất huyết, phù mắt Xuất huyết, phù mắt Xuất huyết, phù mắt Xuất huyết, phù mắt Xuất huyết, phù mắt B37 B38 B39 B41 B42 B43 47 2/10/2012 Vĩnh Long 40 con/kg 40 con/kg 40 con/kg 40 con/kg 40 con/kg 40 con/kg Ao (500600g/con) Xuất huyết, gan thận mủ B44 P P P 48 3/10/2012 Vĩnh Long Gan thận lách mủ, xuất huyết bên B47 N P P 49 2/10/2012 Vĩnh Long Xuất huyết vây B49 N P P 50 2/10/2012 Vĩnh Long bệnh khơng có dấu hiệu rõ B50 N P P 51 2/10/2012 Vĩnh Long Hoại tử đầu phần thân B51 N P P 52 2/10/2012 Vĩnh Long Hoại tử đầu phần thân B52 N P P 53 3/10/2012 Vĩnh Long Thận sưng B53 N P P Ao Ao (150g/con) Ao (150g/con) Ao 12 (100g/con) Ao 12 (100g/con) Ao (3035g/con) Phụ lục (tt) Bảng thông tin nguồn gốc kết PCR 91 chủng vi khuẩn A hydrophila   STT Ngày thu Tỉnh Kích cỡ Dấu hiệu lâm sàng 54 55 56 57 3/10/2012 3/10/2012 3/10/2012 3/10/2012 Vĩnh Long Vĩnh Long Vĩnh Long Vĩnh Long Ao 1(30-35g/con) Ao 1(30-35g/con) Ao 1(30-35g/con) Ao 12 (100g/con) 58 3/10/2012 Vĩnh Long Ao 12 (100g/con) 59 60 61 62 63 3/10/2012 3/10/2012 3/10/2012 3/10/2012 3/10/2012 Vĩnh Long Vĩnh Long Vĩnh Long Vĩnh Long Vĩnh Long Ao 12 (100g/con) Ao 12 (100g/con) Ao 12 (100g/con) Ao 12 (100g/con) Ao 12 (100g/con) 64 3/10/2012 Vĩnh Long Ao 65 66 67 68 69 70 71 72 73 3/10/2012 3/10/2012 3/10/2012 3/10/2012 3/10/2012 3/10/2012 3/10/2012 3/10/2012 3/10/2012 Vĩnh Long Vĩnh Long Vĩnh Long Vĩnh Long Vĩnh Long Vĩnh Long Vĩnh Long Vĩnh Long Vĩnh Long Ao Ao Ao Ao Ao Ao12 xử lý Ao 12 xử lý Ao 12 xử lý Ao 12 xử lý thận sưng thận sưng thận sưng thận nhũn sưng thận sưng, dịch vàng xoang bụng xuất huyết vây, nắp mang xuất huyết vây, nắp mang xuất huyết vây, nắp mang xuất huyết vây, nắp mang xuất huyết vây, nắp mang xuất huyết, bong bóng nhũn, gan nhạt thận sưng, sậm màu thận sưng, sậm màu thận sưng, sậm màu lồi mắt, nhũn bóng xuất huyết phần đầu xuất huyết, phù mắt xuất huyết, phù mắt lờ đờ, thận sưng bóng nhũn lờ đờ, thận sưng bóng nhũn Kí hiệu mẫu B54 B55 B57 B58 Kết PCR Alt Ahh1 Ast P P P P P P N P P N P P B59 N P P B60 B61 B62 B63 B64 P P P P P P P P P P P P P P P B65 P P P B66 B67 B68 B69 B70 B72 B73 B75 B76 P P P N N N N N N P P P P P P P P P P P P P P P P P P Phụ lục (tt) Bảng thông tin nguồn gốc kết PCR 91 chủng vi khuẩn A hydrophila   STT Ngày thu Tỉnh Kích cỡ Dấu hiệu lâm sàng Kí hiệu mẫu 74 75 76 3/10/2012 3/10/2012 3/10/2012 Vĩnh Long Vĩnh Long Vĩnh Long Ao 12 xử lý Ao 12 xử lý Ao 12 xử lý lờ đờ, thận sưng bóng nhũn lờ đờ, thận sưng bóng nhũn lờ đờ, thận sưng bóng nhũn B78 B79 B80 Kết PCR Alt Ahh1 Ast N P P N P P N P P 77 30/10/12 Đồng Tháp 150g/con Nắp mang xuất huyết nặng, mật sưng màu xanh đậm, chết B87 N P P 78 30/10/12 Đồng Tháp 200 g/con lờ đờ, xuất huyết vây, thận sưng, ruột có dịch B90 N P P 79 12/11/2012 Cần Thơ 150-200g lờ đờ, phù mắt, xuất huyết bên bên nội tạng B94 N P P 80 12/11/2012 Cần Thơ 150-200g lờ đờ, xuất huyết xung quanh mắt, phù mắt,xuất huyết bên nội tạng B95 N P P 81 82 83 84 85 86 87 12/11/2012 12/11/2012 16/08/12 16/08/12 16/08/12 31/10/12 16/08/12 An Giang An Giang An Giang An Giang An Giang Đồng Tháp An Giang thu chung thu chung 200-300g/con 200-300g/con 1,7cm 200g/con B106 B107 K1 K2 K5 K7 N5 N N N N N P N P P P P P P P P P P P P P P 88 23/08/12 An Giang N8 N P P Lồi mắt, xuất huyết nặng Lồi mắt, xuất huyết nặng bình thường bình thường bình thường khỏe Ao bình thường Ao có dấu hiệu xuất huyết chung Phụ lục (tt) Bảng thông tin nguồn gốc kết PCR 91 chủng vi khuẩn A hydrophila STT Ngày thu Tỉnh 89 24/09/12 Vĩnh Long 90 91 92 93 12/11/2012 12/11/2012 12/11/2012 12/11/2012 An Giang An Giang An Giang An Giang Kích cỡ Kí hiệu mẫu Dấu hiệu lâm sàng Ao xuất huyết, phù mắt, hoại tử gần vây ngực, đầu, nắp mang Ao bệnh xuất huyết (B106, B107) Ao bệnh xuất huyết (B106, B107) Kết PCR Ast Alt Ahh1 N13 N P P N17 N18 B141 B110 P N N N P P N P P P N N Phụ luc 2: Trình tự mồi gen Ahh1, Alt, Ast Kích thước bp Ahh1 130 TGACCCAGTCCTGG GGTGATCGATCACC Alt 442 TCTCCATGCTTCCCTTCCACT GTGTAGGGATTGAAGAAGCCG Ast 331 Trình tự ( 5’ – 3’) AHH1F GCCGAGCGCCCAGAAGGTGAGTT AHH1R GAGCGGCTGGATGCGGTTGT ALTF ALTR ASTF ASTR   Gen mục tiêu Tên mồi Tmo Độ dài %GC 76,8 23 65,2 73,9 20 65 39 14 64,2 37 14 57,1 67,1 21 52,3 64,6 21 52,3 Tài liệu tham khảo Wang cộng sự, (2003) Li cộng sự, (2011) Zheng cộng sự, (2012) Phụ lục 3: Bảng số liệu chết cộng dồn theo ngày Nghiệm thức 10 11 12 13 14 15 16 17 18   Chủng Nồng vi độ khuẩn CFU/cá B101 Ngày theo dõi N1 N2 N3 109 10 108 1 N4 1 107 B141 5x106 5x107 17 18 20 19 11 17 19 17 20 20 5x108 105 B74 106 107 N5 N6 N7 Tổng số chết 16 16 0 17 18 20 19 11 17 19 19 20 20 Tỷ lệ chết trung bình Giá triLD50 CFU/cá 80 12,5 3,5 x 108 2,5 87,5 1,87 x 107 97,5 70 95 100 1,9 x 104 Phụ lục (tt): Bảng số liệu chết cộng dồn theo ngày Nghiệm thức 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36   Chủng Nồng vi độ khuẩn CFU/cá Ngày theo dõi N1 N2 N3 N4 N5 N6 5x106 B110 5x107 5x108 104 N17 105 106 102 B60 103 104 17 19 20 19 6 2 3 4 1 1 2 N7 Tổng số chết 0 0 17 19 10 20 19 10 11 13 19 16 Tỷ lệ chết trung bình Giá tri LD50 CFU/cá 0 1,79 x 108 90 30 45 7,0 x 104 97,5 40 60 87,5 6,0 x 103 Phụ lục (tt): Bảng số liệu chết cộng dồn theo ngày Chủng Nồng Nghiệm vi độ thức khuẩn CFU/cá 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54   105 K07 106 107 103 B40 104 105 5x106 B85 5x107 5x108 Ngày theo dõi N1 N2 N3 11 15 19 19 20 20 3 13 20 20 19 19 1 N4 N5 N6 1 1 N7 Tổng số chết 18 17 20 20 20 20 11 5 14 15 20 20 20 19 Tỷ lệ chết trung bình Giá tri LD50 CFU/cá 87,5 100 9,5 x 103 100 40 47,5 1,1 x 104 60 27,5 100 97,5 107 Phụ lục (tt): Bảng số liệu chết cộng dồn theo ngày Chủng Nồng Nghiệm vi độ thức khuẩn CFU/cá Ngày theo dõi N1 55 106 56 57 105 58 59 104 60 B107 61 103 62 63 102 64 65 101 66 Phụ lục 4: Bảng tính giá trị LD50 N2 N3 19 19 19 20 15 14 15 18 N4 N5 N6 1 10 10 Bảng Bảng tính giá trị LD50 chủng B101   Nghiệm thức Tổng chết Tổng sống 5x106 5x107 5x108 PD LD50 0 36 0,44 3,5 x 108 40 40 7,56 CFU/cá Tổng chết dồn 0 36 Tổng sống dồn 84 44 TL chết dồn 0,00 0,00 90,00 N7 Tổng số chết 19 19 19 20 16 14 17 20 15 12 12 10 Tỷ lệ chết trung bình Giá tri LD50 CFU/cá 95 97,5 75 92,5 67,5 55 x 101 Bảng Bảng tính giá trị LD50 chủng B141 Nghiệm thức Tổng chết Tổng sống 5x106 5x107 5x108 PD LD50 35 39 0.43 1,87 x 107 39 7.57 CFU/cá Tổng chết dồn 36 75 Tổng sống dồn 45 TL chết dồn 2,17 85,71 98,68 Bảng Bảng tính giá trị LD50 chủng B40 Nghiệm thức Tổng chết Tổng sống 5x103 5x104 5x105 PD LD50 24 19 24 0,507 1,5 x 104 24 16 3,49 CFU/cá Tổng chết dồn 24 43 67 Tổng sống dồn 46 22 16 TL chết dồn 34,29 66,15 80,72 Bảng 4Bảng tính giá trị LD50 chủng B74 Nghiệm thức Tổng chết Tổng sống 103 104 105 PD LD50 16 19 15 0,71 1,9 x 104 24 21 25 7,29 CFU/cá Tổng chết dồn 16 35 50 Tổng sống dồn 70 46 25 TL chết dồn 18,60 43,21 66,67 Bảng Bảng tính giá trị LD50 chủng B110 Nghiệm thức 5x106 5x107 5x108 PD LD50   Tổng chết Tổng sống 0 36 0,44 1,79 x 108 40 40 37,78 CFU/cá Tổng chết dồn 0 36 Tổng sống dồn 84 44 TL chết dồn 0,00 0,00 90,00 Bảng Bảng tính giá trị LD50 chủng B85 Nghiệm thức x 106 x 107 x 108 PD LD50 Tổng chết Tổng sống 11 40 39 0,67 2,1 x 106 29 6,33 CFU/cá Tổng chết dồn 11 51 90 Tổng sống dồn 30 1 TL chết dồn 26,83 98,08 98,90 Bảng Bảng tính giá trị LD50 chủng K07 Nghiệm thức x 105 x 106 x 107 PD LD50 Tổng chết Tổng sống 20 23 0.29 9,5 x 103 20 17 13 3.71 CFU/cá Tổng chết dồn 20 43 50 Tổng sống dồn 50 30 13 TL chết dồn 28,57 58,90 79,37 Bảng Bảng tính giá trị LD50 chủng B60 Nghiệm thức 5x102 x 103 x 104 PD LD50 Tổng chết Tổng sống 16 24 35 0.55 1,39 x 103 0 24 2.44 CFU/cá Tổng chết dồn 16 40 75 Tổng sống dồn 24 24 24 TL chết dồn 40,00 62,50 75,76 Bảng Bảng tính giá trị LD50 chủng B107 Nghiệm thức 101 102 103 104 105 106 PD LD50   Tổng chết Tổng sống 22 27 37 30 39 38 0,41 x 101 18 13 10 1,59 CFU/cá Tổng chết dồn 22 49 86 116 155 193 Tổng sống dồn 47 29 16 13 TL chết dồn 31,88 62,82 84,31 89,92 98,10 98,97 Bảng 10 Bảng tính giá trị LD50 chủng N17 Nghiệm thức 5x104 x 105 x 106 PD LD50   Tổng chết Tổng sống 12 18 39 0.18 3,34 x 105 28 22 4,82 CFU/cá Tổng chết dồn 12 30 69 Tổng sống dồn 51 23 TL chết dồn 19,05 56,60 98,57 Phụ Lục 4: Tỷ lệ (%) chết cộng dồn theo ngày chủng A hydrophila ngày gây nhiễm   Phụ lục (tt):Tỷ lệ (%) chết cộng dồn theo ngày chủng A hydrophila ngày gây nhiễm   ... MINH BỘ MƠN CƠNG NGHỆ SINH HỌC KHÓA LUẬN TỐT NGHIỆP MỐI LIÊN HỆ GIỮA SỰ HIỆN DIỆN CỦA CÁC GENalt, astVÀahh1 VỚI ĐỘC LỰC CỦA VI KHUẨN Aeromonas hydrophila TRÊN CÁ TRA (Pangasius hypophthalmus) Hướng... nghiên cứu A hydrophila gây bệnh cá tra Xuất phát từ vấn đề trên, đề tài Mối liên hệ diện gen alt, ast ahh1 với độc lực vi khuẩn A hydrophila cá tra (Pangasius hypophthalmus) thực   1.2 Mục tiêu... cá tra tỉnh ĐBSCL  Xác định độc lực chủng vi khuẩnA hydrophila mang tổ hợp gen gây độc khác nhauthông qua gây bệnh thực nghiệm cá tra  Xác định mối liên hệ diện genahh1, alt astvà độc lực A hydrophila
- Xem thêm -

Xem thêm: MỐI LIÊN HỆ GIỮA SỰ HIỆN DIỆN CỦA CÁC GENalt, astVÀahh1VỚI ĐỘC LỰC CỦA VI KHUẨN Aeromonas hydrophila TRÊN CÁ TRA (Pangasius hypophthalmus) , MỐI LIÊN HỆ GIỮA SỰ HIỆN DIỆN CỦA CÁC GENalt, astVÀahh1VỚI ĐỘC LỰC CỦA VI KHUẨN Aeromonas hydrophila TRÊN CÁ TRA (Pangasius hypophthalmus)

Gợi ý tài liệu liên quan cho bạn

Nhận lời giải ngay chưa đến 10 phút Đăng bài tập ngay