NGHIÊN CỨU KHẢ NĂNG GÂY BỆNH CỦA NẤM Lecanicillium spp. LÊN RỆP Rhopalosiphum maidis GÂY HẠI TRÊN NGÔ

77 1 0
  • Loading ...
1/77 trang

Thông tin tài liệu

Ngày đăng: 26/02/2019, 14:10

BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC NÔNG LÂM THÀNH PHỐ HỒ CHÍ MINH BỘ MƠN CƠNG NGHỆ SINH HỌC KHÓA LUẬN TỐT NGHIỆP NGHIÊN CỨU KHẢ NĂNG GÂY BỆNH CỦA NẤM Lecanicillium spp LÊN RỆP Rhopalosiphum maidis GÂY HẠI TRÊN NGÔ Ngành học : CÔNG NGHỆ SINH HỌC Sinh viên thực : ĐỖ KHẮC SÁNG Niên khóa : 2010 – 2014 Tháng 12/2013 BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC NÔNG LÂM THÀNH PHỐ HỒ CHÍ MINH BỘ MƠN CƠNG NGHỆ SINH HỌC KHĨA LUẬN TỐT NGHIỆP NGHIÊN CỨU KHẢ NĂNG GÂY BỆNH CỦA NẤM Lecanicillium spp LÊN RỆP Rhopalosiphum maidis GÂY HẠI TRÊN NGÔ Hướng dẫn khoa học Sinh viên thực ThS TRẦN THỊ VÂN ĐỖ KHẮC SÁNG Tháng 12/2013   LỜI CẢM ƠN Em xin chân thành cảm ơn Ban giám hiệu Trường Đại học Nông Lâm TP HCM, ban chủ nhiệm Bộ môn Công Nghệ Sinh Học tạo điều kiện thuận lợi cho em thời gian học tập vừa qua Chân thành cảm ơn thầy cô Bộ môn Công Nghệ Sinh Học thầy cô trực tiếp giảng dạy, truyền đạt cho em kiến thức kinh nghiệm suốt bốn năm qua Chân thành cảm ơn ThS Trần Thị Vân tận tình hướng dẫn, giải đáp thắc mắc động viên em thời gian thực đề tài tốt nghiệp Chân thành cảm ơn TS Tôn Bảo Linh KS Võ Khánh Hưng, người hết lòng quan tâm dìu dắt, chăm lo cho em tập thể lớp DH10SH trình học tập sống Chân thành cảm ơn anh Nguyễn Phan Thành, anh Huỳnh Đăng Sang hỗ trợ, giúp đỡ giải thích thắc mắc cho em trình làm đề tài Chân thành cảm ơn anh chị phụ trách phòng Bệnh thuộc Viện Nghiên cứu Cơng Nghệ Sinh học Môi trường, trường Đại học Nông Lâm TP HCM Chân thành cảm ơn chị Trần Thị Tú Ngân, anh Phan Công Nhật anh chị, bạn thực tập phòng thí nghiệm A203 Viện Nghiên cứu Cơng Nghệ Sinh học Môi trường, trường Đại học Nông Lâm TP HCM Chân thành cảm ơn tập thể lớp DH10SH thân yêu đồng hành, chia sẻ vui buồn, động viên giúp đỡ suốt thời gian học tập làm đề tài Thành kính ghi ơn ba mẹ người thân gia đình ln tạo điều kiện động viên suốt trình học tập trường i     TĨM TẮT Rệp (Aphidoidae) côn trùng gây hại thường gặp rau nhiều trồng nơng nghiệp khác Nó nguyên nhân làm giảm suất giá trị trồng Bên cạnh đó, nhiều lồi rệp báo cáo có khả kháng thuốc trừ sâu Việc vừa kiểm soát chúng vừa đáp ứng giới hạn an toàn dư lượng thuốc trừ sâu loại nông sản môi trường gặp nhiều khó khăn Đề tài “Nghiên cứu khả gây bệnh nấm Lecanicillium spp lên rệp Rhopalosiphum maidis gây hại ngô” thực nhằm đánh giá hiệu kiểm sốt rệp Lecanicillium spp Thí nghiệm thực khảo sát đặc điểm hình thái để tuyển chọn mẫu nấm Lecanicillium spp định danh mẫu nấm tuyển chọn phương pháp sinh học phân tử Đồng thời, để kiểm tra khả diệt rệp nấm Lecanicillium spp., thí nghiệm thực phun trực tiếp bào tử nấm Lecanicillium spp với nồng độ 104, 105, 106, 107 bào tử/ml lên rệp trái ngơ điều kiện phòng thí nghiệm với nồng độ 106, 107, 108 bào tử/ml lên rệp ngô điều kiện nhà lưới Kết định danh hình thái cho thấy ba bốn mẫu nấm khảo sát có đặc điểm hình thái tương đồng với Lecanicillium spp VPH - HM1, VPH – HM2 VPH – HM3 Trong trình định danh mẫu nấm phương pháp sinh học phân tử, nấm li trích DNA, chạy PCR đọc trình tự gen vùng ITS1, 5,8S, ITS2, phần vùng 18S 28S với độ đài 939 bp Trình tự vùng đọc trình tự mẫu nấm giống 100% Khi so sánh trình tự gen mẫu nấm với trình tự gen ngân hàng gen công cụ BLAST, kết cho thấy mẫu có tương đồng 95% với Lecanicillium fusisporum Hiệu lực diệt rệp mẫu nấm sau ngày theo dõi điều kiện phòng thí nghiệm điều kiện nhà lưới đạt cao Trong điều kiện phòng thí nghiệm, mẫu nấm VPH – HM3 có hiệu lực diệt rệp cao (đạt 94,0%) nồng độ x 107 bào tử/ml Trong đó, mẫu nấm VPH - HM1 có hiệu lực diệt rệp cao điều kiện nhà lưới với hiệu lực đạt 79,0% nồng độ bào tử Từ khóa: Lecanicillium spp., Rhopalosiphum maidis, PCR ii     SUMMARY “Efficacy of Lecanicillium spp for controlling of Rhopalosiphum maidis on corn” Aphids are common pests on vegetables and other crops They damage crops directly, wilting and distorting leaves and flowers as they feed In addition, many species of aphids were reported they were resistant to pesticides To control the pest is not easy in term of food safety due to pesticide residue in agricultural products and environment The aim of this study is to evaluate the control efficacy of Lecanicillium spp on corn aphids Fungal samples were identified by sequencing the genome conservation regions ITS1, ITS2, 5,8S rDNA full sequence and regions 18S, 28S partial sequence At the same time, to examine the possibility control aphid of Lecanicillium spp., experiments were conducted directly injection Lecanicillium spp with concentrations of 104, 105, 106, 107 spores/ml to a Rhopalosiphum maidis on the corncob in laboratory conditions and with concentrations of 106,107, 108 spores/ml to a Rhopalosiphum maidis on the corn leaf surface in a greenhouse conditions The result of morphological identification, three fungal samples (VPH - HM1, VPH - HM2 and VPH - HM3) were selected Their morphological characteristics is similar to Lecanicillium spp In the process of identifying the fungi based on molecular biology method, fungal DNA was extracted, amplified via PCR and sequenced with primer ITS1-F, ITS4 When comparing the gene sequence of the isolates with the gene sequences on GenBank by BLAST tools, the results show that the sequence of three isolates were similar for 95% to Lecanicillium fusisporum Efficacy of Lecanicillium spp for controlling of corn aphids was high in both laboratory and greenhouse conditions In laboratory conditions, fungal VPH - HM3 is the highest effective to control corn aphids (reaching 94.0 %) at concentrations of x 107 spores/ml Besides, fungal VPH – HM1 was the highest effective to control corn aphids in greenhouse conditions (reached 79.0 %) at the same concentration spores Key words: Lecanicillium spp , Rhopalosiphum maidis, PCR iii     MỤC LỤC Trang LỜI CẢM ƠN i  TÓM TẮT ii  SUMMARY iii  DANH SÁCH BẢNG vii  DANH SÁCH CÁC CHỮ VIẾT TẮT viii  Chương MỞ ĐẦU 1  1.1 Đặt vấn đề 1  1.2 Yêu cầu 2  1.3 Nội dung thực 2  Chương TỔNG QUAN TÀI LIỆU 3  2.1 Khái qt tình hình sâu hại ngơ 3  2.2 Khái quát chung rệp họ Aphididae 3  2.2.1 Vị trí phân loại họ rệp Aphidiae 3  2.2.2 Đặc điểm chung họ rệp 4  2.3 Rệp ngô Rhopalosiphum maidis 5  2.3.1 Sự phân bố kí chủ rệp Rhopalosiphum maidis 5  2.3.2 Triệu chứng, mức độ gây hại rệp Rhopalosiphum maidis ngơ 5  2.3.3 Một số đặc điểm hình thái rệp Rhopalosiphum maidis 6  2.3.4 Tập tính sống quy luật phát sinh gây hại Rhopalosiphum maidis 7  2.3.5 Biện pháp phòng trừ rệp Rhopalosiphum maidis 8  2.4 Giới thiệu nấm ký sinh côn trùng 8  2.5 Nấm Lecanicillium spp 9  2.5.1 Vị trí phân loại chi nấm Lecanicillium 9  2.5.4 Một số nghiên cứu Lecanicillium 11  2.5.5 Tổng quan ITS - rDNA 13  Chương VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 14  3.1 Thời gian địa điểm nghiên cứu 14  3.2 Vật liệu 14  iv     3.2.1 Nguồn gốc mẫu thí nghiệm 14  3.2.2 Thiết bị, hóa chất mơi trường 14  3.3 Phương pháp nghiên cứu 15  3.3.1 Quan sát đặc điểm hình thái mẫu nấm 15  3.3.2 Định danh mẫu nấm phương pháp sinh học phân tử 16  3.3.3 Hiệu lực gây chết Lecanicillium spp lên rệp phòng thí nghiệm 18  3.3.4 Hiệu lực gây chết Lecanicillium spp lên rệp nhà lưới 19  3.3.5 Phân lập nấm thể rệp sau chủng nấm 19  3.3.6 Phương pháp thu thập, xử lý số liệu phân tích thống kê 19  Chương KẾT QUẢ VÀ THẢO LUẬN 21  4.1 Khảo sát đặc điểm hình thái nấm Lecanicillium spp 21  4.1.1 Một số hình ảnh tản nấm nấm thu trình phục hồi giống gốc 21  4.1.2 Khảo sát đặc điểm hình thái nấm 22  4.1.3 Khảo sát tốc độ tăng trưởng nấm 26  4.2 Kết định danh nấm phương pháp sinh học phân tử 26  4.2.1 Kết nhân sinh khối nấm môi trường PG 26  4.2.2 Kết ly trích DNA khuyếch đại trình tự ITS mẫu nấm 26  4.2.3 Kết giải trình tự gen mẫu nấm 27  4.3 Hiệu lực nấm Lecanicillium spp rệp phòng thí nghiệm 31  4.4 Hiệu lực nấm Lecanicillium spp rệp điều kiện nhà lưới 34  4.5 Phân lập nấm rệp sau chủng nấm 37  4.6 Thảo luận 38  Chương KẾT LUẬN VÀ ĐỀ NGHỊ 41  5.1 Kết luận 41  5.2 Đề nghị 41  TÀI LIỆU THAM KHẢO 42  v     DANH SÁCH CÁC HÌNH Trang Hình 2.1 Hình thái rệp ngô Rhopalosiphum maidis Hình 2.2 Hình thái nấm Lecanicillium 11 Hình 4.1 Một số tản nấm nấm thu sau phục hồi 21 Hình 4.2 Đặc điểm hình thái mẫu VPH – HM1 quan sát kính hiển vi 24 Hình 4.3 Đặc điểm hình thái mẫu VPH – HM2 quan sát kính hiển vi 24 Hình 4.4 Đặc điểm hình thái mẫu VPH – HM3 quan sát kính hiển vi 25 Hình 4.5 Đặc điểm hình thái mẫu BW – CC quan sát kính hiển vi 25 Hình 4.6 Sự tăng trưởng mẫu nấm mơi trường PGA 26 Hình 4.7 Kết kiểm tra DNA tổng số mẫu nấm 27 Hình 4.8 Sản phẩm PCR điện di mẫu nấm Lecanicillium spp 27 Hình 4.9 Bản đồ sinh dòng mẫu nấm với mẫu nấm tham khảo 30 Hình 4.10 Tỉ lệ phần trăm tương đồng mẫu nấm 31 Hình 4.11 Một số hình ảnh thí nghiệm chủng nấm phòng thí nghiệm 34 Hình 4.12 Một số hình ảnh thí nghiệm chủng nấm nhà lưới 37 Hình 4.13 Đặc điểm hình thái mẫu nấm thu nhận từ thể rệp 38 Hình 4.14 Đặc điểm hình thái tản nấm mẫu nấm phân lập từ rệp 38 vi     DANH SÁCH BẢNG Trang Bảng 3.1 Nguồn địa điểm phân lập mẫu nấm 14 Bảng 3.2 Thành phần lít mơi trường PGA 15 Bảng 3.3 Thành phần kg môi trường gạo 15 Bảng 3.4 Primer sử dụng khuếch đại trình tự ITS nấm 17 Bảng 3.5 Các nguồn nấm dùng so sánh trình tự 18 Bảng 4.1 Đặc điểm hình thái tản nấm mơi trường ni cấy 22 Bảng 4.2 Đặc điểm hình thái mẫu nấm quan sát kính hiển vi 23 Bảng 4.3 Hiệu lực (%) mẫu nấm rệp ngơ phòng thí nghiệm 33 Bảng 4.4 Hiệu lực (%) mẫu nấm rệp ngô nhà lưới 36 vii     DANH SÁCH CÁC CHỮ VIẾT TẮT BLAST: Basic Local Alignment Search Tool BYDV: Barley yellow dwarf virus CRD: Complete Randomized Design Ctv: Cộng tác viên MYB: Molasses Yeast Broth NCBI: National Center for Biotechnology Information NT: Nghiệm thức PCR: Polymerase Chain Reaction SD: Standar Deviation viii     Sbjct 203 CTCACTGAGCCATTCAATCGGTAGTAGCGACGGGCGGTG 165 PHỤ LỤC Trình tự gen mẫu nấm VPH – HM1, VPH – HM2, VPH – HM3 mẫu nấm sử dụng để tham khảo VPH HM VPH HM VPH HM EF026005.1 GU183118.1 AB360370.1 AB360367.1 AB378513.1 AB360356.1 AB360363.1 AB378527.1 AB378516.1 AY129552.1 TCGAAGGAGC TTTACAGAGG CTTGGTATCC GACCAGACGG GGCTCTCACC CTCTATGGCG TCGAAGGAGC TTTACAGAGG CTTGGTATCC GACCAGACGG GGCTCTCACC CTCTATGGCG TCGAAGGAGC TTTACAGAGG CTTGGTATCC GACCAGACGG GGCTCTCACC CTCTATGGCG TCGAAGGAGC TTTACAGAGG CTCGGTGTCC GACCAGACGG GGCTCTCACC CTCTATGGCG TCGAAGGAGC TTTACAGAGG CTCGGTGTCC GACCAGACGG GGCTCTCACC CTCTATGGCG TCGAAGGAGC TTTACAGAGG CGCGGTATCC GACCAGACGG GGCTCTCACC CTCTATGGCG TCGAAGGAGC TTTACAGAGG CTTGGTATCC GACCAGACGG GGCTCTCACC CTCTATGGCG TCGAAGGAGC TTTACAGAGG CTCGGTGTCC GACCAGACGG GGCTCTCACC CTCTATGGCG TCGAAGGAGC TTTACATAGG CTTGGCATCC GACCAGACGG GGCTCTCACC CTCTGTGGCG TCGAAGGAAC TTTACAGAGG CTTGGTATCC GACCAGACGG GGCTCTCACC CTCTATGGCG TCGAAGGAGC TTTACAGAGG CTCGGTGTCC GACCAGACGG GGCTCTCACC CTCTATGGCG TCGAAGGAGC TTTACATAGG CTTGGCATCC GACCAGACGG GGCTCTCACC CTCTGTGGCG TCGAAGGAGC TTTACAGAGG CTCGGTGTCC GACCAGACGG GGCTCTCACC CTCTATGGCG VPH HM VPH HM VPH HM EF026005.1 GU183118.1 AB360370.1 AB360367.1 AB378513.1 AB360356.1 AB360363.1 AB378527.1 AB378516.1 AY129552.1 TCCCGTTCCA GGGAACTCGG AAGGCACCTT GCCAAAAGCA TCCTCTACAA ATTACAATTC TCCCGTTCCA GGGAACTCGG AAGGCACCTT GCCAAAAGCA TCCTCTACAA ATTACAATTC TCCCGTTCCA GGGAACTCGG AAGGCACCTT GCCAAAAGCA TCCTCTACAA ATTACAATTC TCCCGTTCCA GGGAACTCGG AAGGCACCTC GCCAAAAGCA TCCTCTACAA ATTACAACTC TCCCGTTCCA GGGAACTCGG AAGGCACCTT GCCAAAAGCA TCCTCTACAA ATTACAACTC TCCCGTTCCA GGGAACTCGG AAGGCACCTT GCCAAAAGCA TCCTCTACAA ATTACAACTC TCCCGTTCCA GGGAACTCGG AAGGCACCTC GCCAAAAGCA TCCTCTACAA ATTACAACTC TCCCGTTCCA GGGAACTCGG AAGGCACCTC GCCAAAAGCA TCCTCTACAA ATTACAACTC TCCCGTTCCA GGGAACTCGG AAGGCGCCTC GCCAAAAGCA TCCTCTACAA ATTACAACTC TCCCGTTCCA GGGAACTCGG AAGGCACCTC GCCAAAAGTA TCCTCTACAA ATTACAACTC TCCCGTTCCA GGGAACTCGG AAGGCACCTT GCCAAAAGCA TCCTCTACAA ATTACAACTC TCCCGTTCCA GGGAACTCGG AAGGCGCCTC GCCAAAAGCA TCCTCTACAA ATTACAACTC TCCCGTTCCA GGGAACTCGG AAGGCACCTC GCCAAAAGCA TCCTCTACAA ATTACAACTC VPH HM VPH HM VPH HM EF026005.1 GU183118.1 AB360370.1 AB360367.1 AB378513.1 AB360356.1 AB360363.1 AB378527.1 AB378516.1 AY129552.1 GGGCCCTGGG GACCAGATTT CAAATTTGAG CTGTTGCCGC TTCACTCGCC GTTACTGGGG GGGCCCTGGG GACCAGATTT CAAATTTGAG CTGTTGCCGC TTCACTCGCC GTTACTGGGG GGGCCCTGGG GACCAGATTT CAAATTTGAG CTGTTGCCGC TTCACTCGCC GTTACTGGGG GGACCC-AAG GGCCAGATTT CAAATTTGAG CTGTTGCCGC TTCACTCGCC GTTACTGGGG GGGCCCTGGG GACCAGATTT CAAATTTGAG CTGTTGCCGC TTCACTCGCC GTTACTGGGG GGGCCCTGGG GACCAGATTT CAAATTTGAG CTGTTGCCGC TTCACTCGCC GTTACTGGGG GGACCC-GAA GGCCAGATTT CAAATTTGAG CTGTTGCCGC TTCACTCGCC GTTACTGGGG GGACCC-AAG GGCCAGATTT CAAATTTGAG CTGTTGCCGC TTCACTCGCC GTTACTGGGG GGGCCCTAGG GGCCAGATTT CAAATTTGAG CTGTTGCCGC TTCACTCGCC GTTACTGGGG GGACCC-GAA GGCCAGATTT CAAATTTGAG CTGTTGCCGC TTCACTCGCC GTTACTGGGG GGGCCCTGGG GACCAGATTT CAAATTTGAG CTGTTGCCGC TTCACTCGCC GTTACTGGGG GGACCCTGGG GGCCAGATTT CAAATTTGAG CTGTTGCCGC TTCACTCGCC GTTACTGGGG GGACCC-GGG GGCCAGATTT CAAATTTGAG CTGTTGCCGC TTCACTCGCC GTTACTGGGG VPH HM VPH HM VPH HM EF026005.1 GU183118.1 AB360370.1 AB360367.1 AB378513.1 AB360356.1 AB360363.1 AB378527.1 AB378516.1 AY129552.1 CAATCCCTGT TGGTTTCTTT TCCTCCGCTT ATTGATATGC TTAAGTTCAG CGGGTATTCC CAATCCCTGT TGGTTTCTTT TCCTCCGCTT ATTGATATGC TTAAGTTCAG CGGGTATTCC CAATCCCTGT TGGTTTCTTT TCCTCCGCTT ATTGATATGC TTAAGTTCAG CGGGTATTCC CAATCCCTGT TGGTTTCTTT TCCTCCGCTT ATTGATATGC TTAAGTTCAG CGGGTATTCC CAATCCCTGT TGGTTTCTTT TCCTCCGCTT ATTGATATGC TTAAGTTCAG CGGGTATTCC CAATCCCTGT TGGTTTCTTT TCCTCCGCTT ATTGATATGC TTAAGTTCAG CGGGTATTCC CAATCCCTGT TGGTTTCTTT TCCTCCGCTT ATTGATATGC TTAAGTTCAG CGGGTATTCC CAATCCCTGT TGGTTTCTTT TCCTCCGCTT ATTGATATGC TTAAGTTCAG CGGGTATTCC CAATCCCTGT TGGTTTCTTT TCCTCCGCTT ATTGATATGC TTAAGTTCAG CGGGTATTCC CAATCCCTGT TGGTTTCTTT TCCTCCGCTT ATTGATATGC TTAAGTTCAG CGGGTATTCC CAATCCCTGT TGGTTTCTTT TCCTCCGCTT ATTGATATGC TTAAGTTCAG CGGGTATTCC CAATCCCTGT TGGTTTCTTT TCCTCCGCTT ATTGATATGC TTAAGTTCAG CGGGTATTCC CAATCCCTGT TGGTTTCTTT TCCTCCGCTT ATTGATATGC TTAAGTTCAG CGGGTATTCC     VPH HM VPH HM VPH HM EF026005.1 GU183118.1 AB360370.1 AB360367.1 AB378513.1 AB360356.1 AB360363.1 AB378527.1 AB378516.1 AY129552.1 28 S TACCTGATCC GAGGTCAAC TACCTGATCC GAGGTCAAC TACCTGATCC GAGGTCAAC TACCTGATCC GAGGTCAAC TACCTGATCC GAGGTCAAC TACCTGATCC GAGGTCAAC TACCTGATCC GAGGTCAAC TACCTGATCC GAGGTCAAC TACCTGATTC GAGGTCAAC TACCTGATCC GAGGTCAAC TACCTGATCC GAGGTCAAC TACCTGATTC GAGGTCAAC TACCTGATCC GAGGTCAAC VPH HM VPH HM VPH HM EF026005.1 GU183118.1 AB360370.1 AB360367.1 AB378513.1 AB360356.1 AB360363.1 AB378527.1 AB378516.1 AY129552.1 TTCCGGTGCG AGTGGTTGTT ACTACGCAGA GGTCGCCGCG GACGGGCCGC CACTCCATTT TTCCGGTGCG AGTGGTTGTT ACTACGCAGA GGTCGCCGCG GACGGGCCGC CACTCCATTT TTCCGGTGCG AGTGGTTGTT ACTACGCAGA GGTCGCCGCG GACGGGCCGC CACTCCATTT TTCCGGTGCG AG-TTGGATT ACTACGCAGA GGTCGCCGCG GACGGGCCGC CACTCCATTT TTCCGGTGCG AGGTTGAGTT ACTACGCAGA GGTCGCCGTG ACGGGGCCGC CACTGTATTT TTCCGGTGCG AGGTTGAGTT ACTACGCAGA GGTCGCCGCG GACGGGCCGC CACTCCATTT TTCCGGTGCG AGGTTGGATT ACTACGCAGA GGTCGCCGCG GACGGGCCGC CACTCCATTT TTCCGGTGCG AG-TTGGATT ACTACGCAGA GGTCGCCGCG GACGGGCCGC CACTTCATTT TCCCGATGCG AGGTTGAGTT ACTACGCAGA GGTCGCCGCG GACGGGCCGC CACTCCATTT TTCCGGTGCG AGGTTGGATT ACTACGCAGA GGTCGCCGCG GACGGGCCGC CACTCCATTT TTCCGGTGCG AGGTTGAGTT ACTACGCAGA GGTCGCCGTG ACGGGGCCGC CACTGTATTT ATCCGGTGCG AG-TGGATTT ACTACGCAAA GGTCCGCCGG GCGGGGCCGC CACTCCATTT TTCCGGTGCG AG-TTGGATT ACTACGCAGA GGTCGCCGCG GACGGGCCGC CACTCCATTT VPH HM VPH HM VPH HM EF026005.1 GU183118.1 AB360370.1 AB360367.1 AB378513.1 AB360356.1 AB360363.1 AB378527.1 AB378516.1 AY129552.1 CGGGGCCGGC GG -TACAG CCGATCCCCA ACGCCGGGCT CCCCGAAGGG AGCTCGAGGG CGGGGCCGGC GG -TACAG CCGATCCCCA ACGCCGGGCT CCCCGAAGGG AGCTCGAGGG CGGGGCCGGC GG -TACAG CCGATCCCCA ACGCCGGGCT CCCCGAAGGG AGCTCGAGGG CGGGGCCGGC GGTA-TGCTG CCGTTCCCCA ACGCCGATTT CCCCAAAGGG AAGTCGAGGG CGGGGTCGGC GGT AGAGG CCGGTCCCCA ACGCCGGGCT CCCCAAGGGG AGCTCGAGGG CGGGGCCGGC TA-G-TGCTG CCGATCCCCA ACACCGATTT CCCCAAAGGG AAGTCGAGGG CGGGGCCGGC GGTA-TACTG CCGGTCCCCA ACGCCGACTT CCCCAAGGGG AGGTCGAGGG CGGGGCCGGC GGTA-TGCTG CCGTTCCCCA ACGCCGATTT CCCCAAAGGG AAGTCGAGGG CGGGGCCGGC GGTGTTAGTG CCGGTCCCCA ACGCCGGGCC CCCCAAGGGG GGCTCGAGGG CGGGGCCGGC GGTA-TGCTG CCGGTCCCCA ACGCCGATTT CCCCAAAGGG AAGTCGAGGG CGGGGTCGGC GGT AGAGG CCGGTCCCCA ACGCCGGGCT CCCCAAGGGG AGCTCGAGGG CGGGGCCGGC AGTGTAAGTG CCGCTCCCCA ACGCCGGGCT CCCCAAGGGG AGCTCGAGGG CGGGGCCGGC GGTA-TGCTG CCGTTCCCCA ACACCGATTT CCCCAAAGGG AAGTCGAGGG VPH HM VPH HM VPH HM EF026005.1 GU183118.1 AB360370.1 AB360367.1 AB378513.1 AB360356.1 AB360363.1 AB378527.1 AB378516.1 AY129552.1 ITS TTGAAATGA TTGAAATGA TTGAAATGA TTGAAATGA TTGAAATGA TTGAAATGA TTGAAATGA TTGAAATGA TTGAAATGA TTGAAATGA TTGAAATGA TTGAAATGA TTGAAATGA VPH HM VPH HM VPH HM EF026005.1 GU183118.1 AB360370.1 AB360367.1 AB378513.1 AB360356.1 AAGATTCGAT GATTCACTGA ATTCTGCAAT TCACATTACT TATCGCATTT CGCTGCGTTC AAGATTCGAT GATTCACTGA ATTCTGCAAT TCACATTACT TATCGCATTT CGCTGCGTTC AAGATTCGAT GATTCACTGA ATTCTGCAAT TCACATTACT TATCGCATTT CGCTGCGTTC AAGATTCGAT GATTCACTGA ATTCTGCAAT TCACATTACT TATCGCATTT CGCTGCGTTC AAGATTCGAT GATTCACTGA ATTCTGCAAT TCACATTACT TATCGCATTT CGCTGCGTTC AAGATTCGAT GATTCACTGA ATTCTGCAAT TCACATTACT TATCGCATTT CGCTGCGTTC AAGATTCGAT GATTCACTGA ATTCTGCAAT TCACATTACT TATCGCATTT CGCTGCGTTC AAGATTCGAT GATTCACTGA ATTCTGCAAT TCACATTACT TATCGCATTT CGCTGCGTTC AAGATTCGAT GATTCACTGA ATTCTGCAAT TCACATTACT TATCGCATTT CGCTGCGTTC   ITS G TTCAGAAAGT TGGGTGTTTT ACGGCGTGGC CACGTCGGGG G TTCAGAAAGT TGGGTGTTTT ACGGCGTGGC CACGTCGGGG G TTCAGAAAGT TGGGTGTTTT ACGGCGTGGC CACGTCGGGG G TTCAGAA-GT TGGGTGTTTT ACGGCGTGGC CACGTCGGGG G TTCAGAA-GT GGGGTGTTTT ACGGCGTGGC CACGTCGGGT G TTCAGAAAGT TGGGTGTTTT ACGGCGTGGC CACGTCGGGG G TTCAGAAAGT TGGGGGTTTT ACGGCGTGGC CACGTCGGGG G TTCAGAA-GT TGGGTGTTTT ACGGCGTGGC CACGTCGGGG G TTCAGAAAGT TGGGTGTTTT ACGGCGTGGC CGCGCCCGGG G TTCAGAAAGT GGGGTGTTTT ACGGCGTGGC CACGTCGGGG G TTCAGAA-GT GGGGTGTTTT ACGGCGTGGC CACGTCGGGT G TTCAGAAAGT TGGGTGTTTT ACGGCGTGGC CGGGCCCGGG G TTCAGAA-GT TGGGTGTTTT ACGGCGTGGC CACGTCGGGA 5.8 S C GCTCGAACAG GCATGCCCGC CAGAATGCTG GCGGGCGCAA TGTGCGTTCA C GCTCGAACAG GCATGCCCGC CAGAATGCTG GCGGGCGCAA TGTGCGTTCA C GCTCGAACAG GCATGCCCGC CAGAATGCTG GCGGGCGCAA TGTGCGTTCA C GCTCGAACAG GCATGCCCGC CAGAATGCTG GCGGGCGCAA TGTGCGTTCA C GCTCGAACAG GCATGCCCGC CAGAATGCTG GCGGGCGCAA TGTGCGTTCA C GCTCGAACAG GCATGCCCGC CAGAATGCTG GCGGGCGCAA TGTGCGTTCA C GCTCGAACAG GCATGCCCGC CAGAATGCTG GCGGGCGCAA TGTGCGTTCA C GCTCGAACAG GCATGCCCGC CAGAATGCTG GCGGGCGCAA TGTGCGTTCA C GCTCGAACAG GCATGCCCGC CAGAATACTG GCGGGCGCAA TGTGCGTTCA C GCTCGAACAG GCATGCCCGC CAGAATGCTG GCGGGCGCAA TGTGCGTTCA C GCTCGAACAG GCATGCCCGC CAGAATGCTG GCGGGCGCAA TGTGCGTTCA C GCTCGAACAG GCATGCCCGC CAGAATGCTG GCGGGCGCAA TGTGCGTTCA CGCTCGAACAG GCATGCCCGC CAGAATGCTG GCGGGCGCAA TGTGCGTTCA   AB360363.1 AB378527.1 AB378516.1 AY129552.1 AAGATTCGAT GATTCACTGA ATTCTGCAAT TCACATTACT TATCGCATTT CGCTGCGTTC AAGATTCGAT GATTCACTGA ATTCTGCAAT TCACATTACT TATCGCATTT CGCTGCGTTC AAGATTCGAT GATTCACTGA ATTCTGCAAT TCACATTACT TATCGCATTT CGCTGCGTTC AAGATTCGAT GATTCACTGA ATTCTGCAAT TCACATTACT TATCGCATTT CGCTGCGTTC VPH HM VPH HM VPH HM EF026005.1 GU183118.1 AB360370.1 AB360367.1 AB378513.1 AB360356.1 AB360363.1 AB378527.1 AB378516.1 AY129552.1 5.8 S TTCATCGATG CCAGAACCAA GAGATCCGTT GTTGAAAGTT TT TTCATCGATG CCAGAACCAA GAGATCCGTT GTTGAAAGTT TT TTCATCGATG CCAGAACCAA GAGATCCGTT GTTGAAAGTT TT TTCATCGATG CCAGAACCAA GAGATCCGTT GTTGAAAGTT TT TTCATCGATG CCAGAACCAA GAGATCCGTT GTTGAAAGTT TT TTCATCGATG CCAGAACCAA GAGATCCGTT GTTGAAAGTT TT TTCATCGATG CCAGAACCAA GAGATCCGTT GTTGAAAGTT TT TTCATCGATG CCAGAACCAA GAGATCCGTT GTTGAAAGTT TT TTCATCGATG CCAGAACCAA GAGATCCGTT GTTGAAAGTT TT TTCATCGATG CCAGAACCAA GAGATCCGTT GTTGAAAGTT TT TTCATCGATG CCAGAACCAA GAGATCCGTT GTTGAAAGTT TT TTCATCGATG CCAGAACCAA GAGATCCGTT GTTGAAAGTT TT TTCATCGATG CCAGAACCAA GAGATCCGTT GTTGAAAGTT TT VPH HM VPH HM VPH HM EF026005.1 GU183118.1 AB360370.1 AB360367.1 AB378513.1 AB360356.1 AB360363.1 AB378527.1 AB378516.1 AY129552.1 CCTTGCGGCG GATTCAGAAG ACACTGAGAA TACAAAAAGT TTTGGTTGGG TCCCCGGCGC CCTTGCGGCG GATTCAGAAG ACACTGAGAA TACAAAAAGT TTTGGTTGGG TCCCCGGCGC CCTTGCGGCG GATTCAGAAG ACACTGAGAA TACAAAAAGT TTTGGTTGGG TCCCCGGCGC CCTTGCGGCG GATTCAGAAA ATGCTGATAA TACAGA -G TTTAGA GG TCTCCGGCGG CCTTGCGGCG GATTCAGAAG ATACTGGTAA TACAAAGAGT TTGAAT GG CCTCCGGCGG CCTTGCGGCG AATTCAGAAG ATTCTCATAA TACAAA-GAG TTTGGT GG TCTCCGGCGG CCTTGCGGCG GATTCAGAAT ACACTGATAA TACAAA-GAG TTTGGT GG TCTCCGGCGG CCTTGCGGCG GATTCAGAAA ATGCTGATAA TACAGA -G TTTGGG GG TCTCCGGCGG CCTTGCGGCA CGTTCAGAAG ATACTGTAAA AACAGAAGAG TTTGTG -G CCTCCGGCGG CCTTGCGGCG GATTCAGAAG ATACTCATGA TACAAAAGAG TTTGGT GG TCTCCGGCGG CCTTGCGGCG GATTCAGAAG ATACTGGTAA TACAAAGAGT TTGAAT GG CCTCCGGCGG CCTTGCGGCA CACTCAGAAG ATACTGTAAG AAACAGAAGT TTTGTG -G CCTCCGGCGG CCTTGCGGCG AATTCAGAAG ATGCTGATAA TACAGA -G TTTGGG GG TCTCCGGCGG VPH HM VPH HM VPH HM EF026005.1 GU183118.1 AB360370.1 AB360367.1 AB378513.1 AB360356.1 AB360363.1 AB378527.1 AB378516.1 AY129552.1 CCGCCTGGGT CCGGGTCGCG GCCGGCCGTG TGGGGCCGTC CGGACGCCGG TGCGGGGTAA CCGCCTGGGT CCGGGTCGCG GCCGGCCGTG TGGGGCCGTC CGGACGCCGG TGCGGGGTAA CCGCCTGGGT CCGGGTCGCG GCCGGCCGTG TGGGGCCGTC CGGACGCCGG TGCGGGGTAA CCGCCTGGGT CCGGGCCGCG GGCGGC -G CGAGGCCGTC CGGACGCCGG GGCGAGTC-TCGCCTGGTT CCAGGCCGCG GGCGGC -G CAAGGCCACC CGGACGCTGG GACGAGTC-CCGCCTGGGT CCGGGCCGCG GGCGAC -G CTAGGTCGTC CGGACGCCGG GGCGGGTC-CCGCCTGGAT CCGGGCCGCG GGCGGC -G CTAGGCCGTC CGGACGCCGG GGCGAGTC-CCGCCTGGGT CCGGGCCGCG GGCGGC -G CGAGGCCGTC CGGACGCCGG GGCGAGTC-GCGCCTGGTT CCGGGCCGCG A AAC TCTCGTTC CGGGCGCCGG GGCGGCTC-CCGCCTGAGT CCGGGCCGCG GGCGGC -G CTAGGCCGTC CGGACGCCGG GGCGAGTC-TCGCCTGGTT CCAGGCCGCG GGCGGC -G CAAGGCCACC CGGACGCTGG GACGAGTC-GCGCCTGGTT CCGGGCCGCG A AAC TGG-GTTC CGGGCGCCGG GGCGGCTC-CCGCCTGGGT CCGGGCCGCG GGCGGC -G CGAGGCCGTC CGGACGCCGG GGCGAGTC— VPH HM VPH HM VPH HM EF026005.1 GU183118.1 AB360370.1 AB360367.1 AB378513.1 AB360356.1 AB360363.1 AB378527.1 AB378516.1 AY129552.1 ITS1 CGCCGAAGCA AC-GATGGGT A-TGTTCACA TTTGGGTTTT CGCCGAAGCA AC-GATGGGT A-TGTTCACA TTTGGGTTTT CGCCGAAGCA AC-GATGGGT A-TGTTCACA TTTGGGTTTT CGCCGAAGCA AC-AGTAGGT A-TGTTCACA TAAGGGTTTCGCCGAAGCA AC-GATTGGT A-TGTTCACA TTTGGGTTTCGCCGAAGCA AC-AATAGGT A-TGTTCACA TA-GGGTTTCGCCGAAGCA AC-TGTAGGT A-TGTTCACA TA-GGGTTTCGCCGAAGCA AC-AGTAGGT A-TGTTCACA TAAGGGTTTCGCCGAAGCA ACATAATGGT A-TGTTCACA T GGGTTTCGCCGAAGCA ACATCTTGGT A-TGTTCACA TAAGGGTTTCGCCGAAGCA AC-GATTGGT A-TGTTCACA TTTGGGTTTCGCCGAAGCA ACATGTAGGT AATGTTCACA T GGGTTTCGCCGAAGCA AC-AGTAGGT A-TGTTCACA GAAGGGTGT-   ITS GATTCATT TGTTT -TG GATTCATT TGTTT -TG GATTCATT TGTTT -TG GATTCATT TGTTT -TG GATTCATT TGTTT -TG GATTCATT TGTTT -TG GATTCATT TGTTT -TG GATTCATT TGTTT -TG GATTCATT TGTTTGTT-G GATTCATT TGTTT -TG GATTCATT TGTTT -TG GATTCATT TGTTTGTTTG GATTCATT TGTTT -TG 18 S GGGAG GGGAG GGGAG GGGAG GGGAG GGGAG GGGAG GGGAG GGGAG GGGAG GGGAG GGGAG GGGAG   PHỤ LỤC Kết xử lí thống kê phân tích hiệu lực gây chết mẫu nấm rệp Rhopalosiphum maidis phòng thí nghiệm thời gian ngày theo dõi Ngày ANALYSIS OF VARIANCE TABLE K Source Value Degrees of Freedom Sum of Squares Mean Square F Value Prob Factor A 0.003 0.001 0.0923 0.0000 Factor B 0.050 0.017 1.6501 0.1794 AB 0.048 0.005 0.5237 0.0601 -7 Error 32 0.326 0.010 Total 47 0.428 Coefficient of Variation: 21.77% Ngày ANALYSIS OF VARIANCE TABLE K Source Value Degrees of Freedom Sum of Squares Mean Square F Value Prob Factor A 0.018 0.006 1.6407 0.0009 Factor B 0.017 0.006 0.1995 0.2275 AB 0.014 0.002 1.5224 0.427 -7 Error 32 0.119 0.004 Total 47 0.168 Coefficient of Variation: 33.81% Ngày ANALYSIS OF VARIANCE TABLE K Source Value Degrees of Freedom Sum of Squares Mean Square F Value Prob Factor A 0.192 0.064 7.1072 0.0009 Factor B 0.240 0.080 8.8612 0.0002 AB 0.108 0.012 1.3255 0.2629 -7 Error 32 0.289 0.009 Total 47 0.829 Coefficient of Variation: 31.13%     Ngày ANALYSIS OF VARIANCE TABLE K Source Value Degrees of Freedom Sum of Squares Mean Square F Value Prob Factor A 0.818 0.273 58.5384 0.0000 Factor B 0.760 0.253 54.3887 0.0000 AB 0.162 0.018 3.8676 0.0021 -7 Error 32 0.149 0.005 Total 47 1.889 Coefficient of Variation: 14.87% Ngày ANALYSIS OF VARIANCE TABLE K Source Value Degrees of Freedom Sum of Squares Mean Square F Value Prob Factor A 2.055 0.685 61.6524 0.0000 Factor B 0.561 0.187 16.8256 0.0000 AB 0.063 0.007 0.6257 0.0011 -7 Error 32 0.356 0.011 Total 47 3.034 Coefficient of Variation: 19.11% Duncan's Multiple Range Test LSD value = 0.2783 s_ = 0.06055 at alpha = 0.010 Original Order Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean   1= 2= 3= 4= 5= 6= 7= 8= 9= 10 = 11 = 12 = 13 = 0.5400 AB 0.5600 AB 0.7500 A 0.8100 A 0.5500 AB 0.5800 AB 0.7700 A 0.7900 A 0.5300 AB 0.6300 AB 0.7400 A 0.8100 A 0.1000 C Ranked Order Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean 4= 12 = 8= 7= 3= 11 = 10 = 6= 2= 5= 1= 9= 16 = 0.8100 A 0.8100 A 0.7900 A 0.7700 A 0.7500 A 0.7400 A 0.6300 AB 0.5800 AB 0.5600 AB 0.5500 AB 0.5400 AB 0.5300 AB 0.4000 BC   Mean Mean Mean Mean 14 = 15 = 16 = 17 = 0.1200 0.1500 0.4000 0.1600 C C BC C Mean Mean Mean Mean 17 = 15 = 14 = 13 = 0.1600 0.1500 0.1200 0.1000 C C C C Ngày ANALYSIS OF VARIANCE TABLE K Source Value Degrees of Freedom Sum of Squares Mean Square F Value Prob Factor A 1.995 0.665 50.9106 0.0000 Factor B 0.464 0.155 11.8392 0.0000 AB 0.143 0.016 1.2156 0.3200 -7 Error 32 0.418 0.013 Total 47 3.019 Coefficient of Variation: 15.59% Duncan's Multiple Range Test LSD value = 0.3025 s_ = 0.06583 at alpha = 0.010 Original Order   Ranked Order Mean = 0.7700 ABCD Mean 12 = Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean 2= 3= 4= 5= 6= 7= 8= 9= 10 = 11 = 12 = 13 = 14 = 15 = 16 = 17 = 0.8600 ABC 0.9600 AB 1.040 A 0.7200 ABCD 0.7500 ABCD 0.8900 AB 0.8200 ABC 0.6300 BCD 0.8700 ABC 0.8200 ABC 1.060 A 0.2800 EF 0.2900 EF 0.4400 DEF 0.5400 CDE 0.1600 F 4= 3= 7= 10 = 2= 11 = 8= 1= 6= 5= 9= 16 = 15 = 14 = 13 = 17 = 1.060 A 1.040 A 0.9600 AB 0.8900 AB 0.8700 ABC 0.8600 ABC 0.8200 ABC 0.8200 ABC 0.7700 ABCD 0.7500 ABCD 0.7200 ABCD 0.6300 BCD 0.5400 CDE 0.4400 DEF 0.2900 EF 0.2800 EF 0.1600 F   Ngày ANALYSIS OF VARIANCE TABLE K Source Value Degrees of Freedom Sum of Squares Mean Square F Value Prob Factor A 2.665 0.888 94.7719 0.0000 Factor B 0.541 0.180 19.2262 0.0000 AB 0.021 0.002 0.2507 0.0001 -7 Error 32 0.300 0.009 Total 47 3.527 Coefficient of Variation: 11.96% Duncan's Multiple Range Test LSD value = 0.2517 s_ = 0.05477 at alpha = 0.010 Original Order Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean   1= 2= 3= 4= 5= 6= 7= 8= 9= 10 = 11 = 12 = 13 = 14 = 15 = 16 = 17 = 0.8300 BC 0.8500 BC 1.020 ABC 1.100 AB 0.7700 CD 0.8600 BC 0.9500 ABC 1.070 AB 0.8600 BC 0.8800 BC 0.9700 ABC 1.160 A 0.3100 EF 0.3300 EF 0.4400 EF 0.5300 DE 0.2500 F Ranked Order Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean 12 = 4= 8= 3= 11 = 7= 10 = 9= 6= 2= 1= 5= 16 = 15 = 14 = 13 = 17 = 1.160 A 1.100 AB 1.070 AB 1.020 ABC 0.9700 ABC 0.9500 ABC 0.8800 BC 0.8600 BC 0.8600 BC 0.8500 BC 0.8300 BC 0.7700 CD 0.5300 DE 0.4400 EF 0.3300 EF 0.3100 EF 0.2500 F   PHỤ LỤC Kết xử lí thống kê phân tích hiệu lực gây chết mẫu nấm rệp Rhopalosiphum maidis nhà lưới thời gian ngày theo dõi Ngày ANALYSIS OF VARIANCE TABLE K Source Value Degrees of Freedom Sum of Squares Mean Square F Value Prob Factor A 0.010 0.005 0.7319 0.0013 Factor B 0.031 0.016 2.3011 0.1289 AB 0.004 0.001 0.1648 0.0602 -7 Error 18 0.121 0.007 Total 26 0.167 Coefficient of Variation: 142.10% Ngày ANALYSIS OF VARIANCE TABLE K Source Value Degrees of Freedom Sum of Squares Mean Square F Value Prob Factor A 0.039 0.019 6.5574 0.0073 Factor B 0.037 0.018 6.2057 0.0089 AB 0.021 0.005 1.7768 0.1775 -7 Error 18 0.053 0.003 Total 26 0.150 Coefficient of Variation: 22.71% Ngày ANALYSIS OF VARIANCE TABLE K Source Value Degrees of Freedom Sum of Squares Mean Square F Value Prob Factor A 0.061 0.030 3.3762 0.0569 Factor B 0.589 0.295 32.6616 0.0000 AB 0.042 0.010 1.1641 0.3594 -7 Error 18 0.162 0.009 Total 26 0.854 Coefficient of Variation: 20.27%     Duncan's Multiple Range Test LSD value = 0.3566 s_ = 0.05477 at alpha = 0.010 Original Order Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean 1= 2= 3= 4= 5= 6= 7= 8= 9= 10 = Ranked Order 0.4400 AB 0.4500 AB 0.7100 A 0.2400 BC 0.4300 AB 0.6000 AB 0.2800 BC 0.3700 AB 0.6900 A 0.0000 C Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean 3= 9= 6= 2= 1= 5= 8= 7= 4= 10 = 0.7100 A 0.6900 A 0.6000 AB 0.4500 AB 0.4400 AB 0.4300 AB 0.3700 AB 0.2800 BC 0.2400 BC 0.0000 C Ngày ANALYSIS OF VARIANCE TABLE K Source Value Degrees of Freedom Sum of Squares Mean Square F Value Prob Factor A 0.105 0.052 3.8988 0.0392 Factor B 1.440 0.720 53.6164 0.0000 AB 0.088 0.022 1.6355 0.2087 -7 Error 18 0.242 0.013 Total 26 1.874 Coefficient of Variation: 21.94% Duncan's Multiple Range Test LSD value = 0.4286 s_ = 0.06583 at alpha = 0.010 Original Order Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean   1= 2= 3= 4= 5= 6= 7= 8= 9= 10 = 0.2600 CD 0.5200 BCD 0.9900 A 0.3200 CD 0.4700 BCD 0.8600 AB 0.2500 CD 0.4200 BCD 0.6600 ABC 0.1700 D Ranked Order Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean 3= 6= 9= 2= 5= 8= 4= 1= 7= 10 = 0.9900 A 0.8600 AB 0.6600 ABC 0.5200 BCD 0.4700 BCD 0.4200 BCD 0.3200 CD 0.2600 CD 0.2500 CD 0.1700 D   Ngày ANALYSIS OF VARIANCE TABLE K Source Value Degrees of Freedom Sum of Squares Mean Square F Value Prob Factor A 0.093 0.047 5.3499 0.0150 Factor B 1.749 0.874 100.3754 0.0000 AB 0.293 0.073 8.4162 0.0005 -7 Error 18 0.157 0.009 Total 26 2.292 Coefficient of Variation: 13.85% Duncan's Multiple Range Test LSD value = 0.3566 s_ = 0.05477 at alpha = 0.010 Original Order Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean 1= 2= 3= 4= 5= 6= 7= 8= 9= 10 = Ranked Order 0.2600 DE 0.9600 AB 1.040 A 0.3600 CDE 0.6500 BC 0.9600 AB 0.4200 CDE 0.5100 CD 0.9100 AB 0.1300 E Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean 3= 2= 6= 9= 5= 8= 7= 4= 1= 10 = 1.040 A 0.9600 AB 0.9600 AB 0.9100 AB 0.6500 BC 0.5100 CD 0.4200 CDE 0.3600 CDE 0.2600 DE 0.1300 E Ngày ANALYSIS OF VARIANCE TABLE K Source Value Degrees of Freedom Sum of Squares Mean Square F Value Prob Factor A 0.110 0.055 1.7682 0.1990 Factor B 1.851 0.925 29.7479 0.0000 AB 0.077 0.019 0.6166 0.0013 -7 Error 18 0.560 0.031 Total 26 2.597 Coefficient of Variation: 25.80% Duncan's Multiple Range Test     LSD value = 0.6619 s_ = 0.1017 at alpha = 0.010 Original Order Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean 1= 2= 3= 4= 5= 6= 7= 8= 9= 10 = Ranked Order 0.3500 BC 0.7600 ABC 1.040 A 0.2400 C 0.5600 ABC 0.9800 AB 0.5200 ABC 0.7000 ABC 1.000 AB 0.1900 C Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean 3= 9= 6= 2= 8= 5= 7= 1= 4= 10 = 1.040 A 1.000 AB 0.9800 AB 0.7600 ABC 0.7000 ABC 0.5600 ABC 0.5200 ABC 0.3500 BC 0.2400 C 0.1900 C Ngày ANALYSIS OF VARIANCE TABLE K Source Value Degrees of Freedom Sum of Squares Mean Square F Value Prob Factor A 0.047 0.024 1.0779 0.3613 Factor B 1.494 0.747 34.2389 0.0000 AB 0.168 0.042 1.9232 0.01502 -7 Error 18 0.393 0.022 Total 26 2.101 Coefficient of Variation: 18.50% Duncan's Multiple Range Test LSD value = 0.5576 s_ = 0.08563 at alpha = 0.010 Original Order Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean   1= 2= 3= 4= 5= 6= 7= 8= 9= 10 = 0.5000 BCD 0.8000 ABC 1.160 A 0.3800 CD 0.7400 ABC 1.010 AB 0.7300 ABC 0.7100 ABC 1.060 AB 0.1300 D Ranked Order Mean Mean Mean Mean Mean Mean Mean Mean Mean Mean 3= 9= 6= 2= 5= 7= 8= 1= 4= 10 = 1.160 A 1.060 AB 1.010 AB 0.8000 ABC 0.7400 ABC 0.7300 ABC 0.7100 ABC 0.5000 BCD 0.3800 CD 0.1300 D   PHỤ LỤC Số lượng rệp chết sau xử lí nấm điều kiện phòng thí nghiệm ngày theo dõi Ngày (1) (bào tử/ml) LLL1 (2) LLL3 LLL1 LLL2 LLL3 LLL1 LLL2 LLL3 LLL1 LLL2 LLL3 (5) (6) (7) (8) (9) (10) (11) (12) (13) (14) 0 0 0 0 0 0 0 0 0 0 0 0 1 x 10 0 0 0 0 Đối chứng x 10 0 0 0 1 0 2 1 1 1 1 0 2 1 1 x 10 x 10 x 10 Đối chứng   BW-CC (4) x 10 VPH-HM (3) x 10 LLL2 VPH-HM x 10 VPH-HM Nồng độ bào tử 0 x 10 1 3 2 x 10 3 3 1 5 6 x 10 4 2 Đối chứng 1 x 10   (1) (2) (3) (4) (5) (6) (7) (8) (9) (10) (11) (12) (13) (14) x 104 3 4 5 4 6 5 2 10 10 9 7 x 10 11 13 10 12 12 10 10 11 11 Đối chứng x 10 x 10 2 7 3 8 9 10 14 11 10 11 12 13 11 10 13 x 10 13 15 11 14 13 11 14 12 13 6 Đối chứng x 10 x 10 5 x 10 15 12 10 13 11 10 11 5 14 16 13 14 12 10 15 14 15 6 18 16 15 18 14 13 17 12 11 7 x 10 20 17 15 12 17 11 20 18 15 8 Đối chứng 3 x 104 13 14 15 12 13 13 14 14 16 5 x 105 14 13 16 15 14 15 16 15 14 5 x 106 17 19 17 16 17 16 19 16 15 6 x 107 19 16 20 20 16 18 20 20 17 Đối chứng 5 x 10 x 10   x 10   PHỤ LỤC Số lượng rệp chết sau xử lí nấm điều kiện nhà lưới ngày theo dõi Ngày (1)   VPH HM Nồng độ bào tử VPH HM VPH HM (bào tử/ml) LLL1 LLL2 LLL3 LLL1 LLL2 LLL3 LLL1 LLL2 LLL3 (2) (3) (4) (5) (6) (7) (8) (9) (10) (11) x 10 0 0 x 10 0 0 0 x 10 1 1 Đối chứng 0 x 106 5 x 107 3 2 x 108 4 4 Đối chứng 2 x 106 10 6 x 107 7 8 6 x 108 17 14 16 14 13 12 15 13 Đối chứng x 106 4 6 5 x 107 12 15 11 x 108 24 26 26 16 23 24 19 17 15 Đối chứng   (1)   (2) (3) (4) (5) (6) (7) (8) (9) (10) (11) x 106 6 9 x 107 17 22 12 15 11 13 12 x 108 25 27 28 28 23 22 22 27 19 Đối chứng x 106 12 14 16 x 107 24 22 23 15 11 16 16 14 17 x 108 25 27 28 29 20 25 23 28 26 Đối chứng x 106 14 13 15 19 17 x 107 28 22 23 16 26 10 15 16 18 x 108 28 29 30 27 30 26 26 27 29 Đối chứng ... BỘ MƠN CƠNG NGHỆ SINH HỌC KHÓA LUẬN TỐT NGHIỆP NGHIÊN CỨU KHẢ NĂNG GÂY BỆNH CỦA NẤM Lecanicillium spp LÊN RỆP Rhopalosiphum maidis GÂY HẠI TRÊN NGÔ Hướng dẫn khoa học Sinh viên thực ThS TRẦN... khó khăn Đề tài Nghiên cứu khả gây bệnh nấm Lecanicillium spp lên rệp Rhopalosiphum maidis gây hại ngô thực nhằm đánh giá hiệu kiểm soát rệp Lecanicillium spp Thí nghiệm thực khảo sát đặc điểm... tiễn đó, đề tài: Nghiên cứu khả gây bệnh Lecanicillium spp lên rệp Rhopalosiphum maidis gây hại ngô tiến hành thực 1.2 Yêu cầu Tìm hiểu đặc điểm sinh học nấm Lecanicillium spp., sở áp dụng điều
- Xem thêm -

Xem thêm: NGHIÊN CỨU KHẢ NĂNG GÂY BỆNH CỦA NẤM Lecanicillium spp. LÊN RỆP Rhopalosiphum maidis GÂY HẠI TRÊN NGÔ , NGHIÊN CỨU KHẢ NĂNG GÂY BỆNH CỦA NẤM Lecanicillium spp. LÊN RỆP Rhopalosiphum maidis GÂY HẠI TRÊN NGÔ

Gợi ý tài liệu liên quan cho bạn

Nhận lời giải ngay chưa đến 10 phút Đăng bài tập ngay