Chọn giống hồ tiêu

46 5 0
  • Loading ...
1/46 trang

Thông tin tài liệu

Ngày đăng: 25/02/2019, 21:53

Chọn giống Hồ tiêu (Piper nigrum) Mục lục I Kỹ thuật nhân giống II Tài nguyên di truyền Chi Piper Các giống phổ biến Việt Nam III Phương pháp chọn giống truyền thống Chọn lọc Lai giống Lai khác loài IV Các phương pháp chọn giống đại - Ứng dụng công nghệ sinh học Chỉ thị phân tử Molecular Marker Nhân giống vơ tính Chuyển gen I Kỹ thuật nhân giống • Nhân giống hạt: chủ yếu nghiên cứu tạo giống, phát triển kém, tính di truyền khơng ổn định lâu cho hạt • Nhân giống phận sinh dưỡng: + Dây lươn: Cây mọc từ dây lươn chậm cho trái, thường - năm sau trồng Tiêu trồng từ hom lươn cho suất cao, ổn định lâu cỗi so với dây thân + Dây thân: Cây mọc từ dây thân mau trái, năm sau trồng Cây non ươm từ cành thân mọc khỏe, suất cao tuổi thọ tương đối dài từ 15 - 20 năm + Cành quả: tiêu mọc từ cành mau hoa khơng có khả bám trụ leo lên, suất thấp mau cỗi Trong thực tế sản xuất không dùng cành để nhân giống tiêu I Kỹ thuật nhân giống • Ni cấy mơ: hệ giống nhân giống cao, chất lượng đồng Phương pháp áp dụng sản xuất cần thời gian huấn luyện dài trình nhân giống khả biến dị xảy với tỷ lệ cao • Ghép :Do cấu tạo tế bào mạch dẫn hồ tiêu không thuận lợi cho việc ghép nên tiếp hợp gốc ghép chồi ghép II Tài nguyên di truyền Trung tâm India Institute of Spices Research (IISR) Kozhikode, Kerala trung tâm bảo tồn sưu tập quỹ gen hồ tiêu lớn giới Tài nguyên di truyền Chi Piper •Chi lớn Họ Piperaceae •Gồm 3000 lồi •Có mặt khắp vùng nhiệt đới cận nhiệt đới II.1.1 Các loài họ hàng Ấn Độ P Longum L (Tiêu lốt):  Là loài quan trọng hệ thống dược liệu  Dùng chất kích thích, thuốc long đờm, thuốc tống hơi, loại thuốc bổ thay làm giảm ho viêm phế quản II.1.1 Các loài họ hàng Ấn Độ Quả P longum khơ Rễ P longum khơ II.1.1 Các lồi họ hàng Ấn Độ Piper betle L (Trầu không):  Là thuốc  Cây leo sống lâu năm  Cho to dùng để nhai II.1.2 Các loài họ hàng trung tâm phân bố khác  Các loài cách xa nhau, đa dạng vùng nhiệt đới châu Mỹ (700 loài)  Vài lồi tìm thấy Thái Bình Dương Một số lồi Trung Nam Mỹ  P aduncum L., P amalago L., P colubrinum Link .v.v b Kết Dựa trình tự hai mồi thiết kế cho thị SCAR: - Mồi xuôi (MA1): 5’ GCCCTTCCAATAAAAGGAAC 3’ - Mồi ngược (MA2): 5’ CTTCGAGTTGGAGTGTGATG 3’ Phản ứng kiểm tra hai mồi MA1, MA2 khuếch đại cho trình tự đặc biệt ~ 360 bp có có tính kháng trung bình IV.1.3 Xác định số giống Piper nigrum L thông qua thị phân tử marker RAPD a Vật liệu – phương pháp - 13giống địa giống tiên tiến loài P nigrum - DNA chúng chiết xuất để tiến hành phản ứng PCR - Tổng cộng có 34 cặp mồi ngẫu nhiên b Kết IV.2 Nhân giống vơ tính IV.2.1 Giới thiệu Mục đích nhân nhanh giống Mơi trường cho q trình tìm đột biến soma Nghiên cứu mơi trường ni cấy chuyển gen hồ tiêu IV.2.1 Giới thiệu Các bước q trình ni cấy: - Chọn lọc mô cấy Chuẩn bị môi trường Tái sinh chồi Tạo rễ Chuyển môi trường tự nhiên IV.2.2 Nuôi cấy mô hồ tiêu a Chọn lọc mô cấy - Chọn lọc mơ cấy từ thân, lá, chồi ngọn, đầu rễ hạt - Mẫu sau rửa xử lý vơ trùng tác nhân cồn, nước giaven, HgCl (0.1-1%), chất kháng sinh Cefotaxin, Tetrecylin, Stretomycin… b Mơi trường ni cấy • MS (Murashige Skoog, 1962) • SH (Schenk Hildebrandt, 1972) • WP (Lloyd McCown, 1980), • Mơi trường ni cấy thích hợp cho mẫu hình thành phát triển mơ sẹo môi trường MS + mg/l BA + mg/l IBA Mơi trường ni cấy thích hợp tái sinh chồi môi trường MS + mg/l BA + 0.3 mg/l TDZ (thidiazuron) • Mơi trường ni cấy thích hợp cho mẫu chồi hình thành mơ sẹo mơi trường bổ sung 1,5 mg/l BA Tái sinh chồi tốt môi trường bổ sung 0,5 mg/l BA Các hình thành rễ tốt môi trường bổ sung 1,5 mg/l IBA b Môi trường ni cấy • Mơi trường ni cấy thích hợp cho mẫu chồi hình thành mơ sẹo mơi trường bổ sung 1,5 mg/l BA Tái sinh chồi tốt môi trường bổ sung 0,5 mg/l BA Các hình thành rễ tốt mơi trường bổ sung 1,5 mg/l IBA • Mơi trường ni cấy thích hợp tạo chồi từ đốt hồ tiêu môi trường bổ sung mg/l BA + 0.5 mg/l IBA Tái sinh chồi từ mô sẹo phát sinh đốt thân tốt môi trường bổ sung mg/l BA + 0.5 mg/l IBA + 0.5 mg/l Kin Các hình thành rễ dễ dàng mơi trường ½ MS bổ sung 0.1-0.2 mg/l NAA IV.3 Chuyển gen – genetic tranformation IV.3.1 Giới thiệu Các bước trình chuyển gen: - Phân lập gen có ích từ thể cho - Loại bỏ T-DNA khỏi Ti-Plasmid dòng vi khuẩn chọn lọc - Chuyển DNA lạ vào Ti-Plasmid với gen khởi động gen thị có khả chọn lọc dễ dàng - Đưa plasmid biến đổi trở lại Agrobacterium để nhân - Chuyển plasmid biến đổi vào tế bào thực vật - Chọn tế bào chuyển nạp gen - Tái sinh tế bào chuyển nạp - Chọn biểu gen chuyển nạp (cây chuyển gen) IV.3.2 Chuyển gen hồ tiêu • Chưa có nhiều nghiên cứu chuyển thành công gen lạ vào hồ tiêu • Năm 2011, Jiby Mary Varghese, Alangar Ishwara Bhat (IISR, Idia) tiến hành khảo sát ảnh hưởng môi trường chuyển thành công vector pBI121 thông qua A tumefaciens chủng EHA 105 Vùng T-DNA pBI121 chứa gen neomycin phosphotransferase II (NPT II)dưới kiểm soát synthase nopaline (NOS) promoter β-glucuronidase (GUS) với intron (GUS-intron) hợp với CaMV 35S promoter • • Năm 2012, T.T Maju E.V.Soniya (Ấn Độ) thành công chuyển vector pCAMPIA1301 thông qua chủng A tumefaciens EHA 105 Vector pCAMPIA1301 có khả mang đoạn gen cần chuyển vào hồ tiêu pCAMPIA1301 chứa gen GUS gen thị cho gen mục tiêu gen kháng kháng sinh hygromycin phosphotranferase (htp) kiểm sốt promoter CaMV 35S • Một số báo cáo cho biết nhà khoa học IISR, India thành cơng chuyển gen mã hóa osmotin (PR-5) - phân lập từ loài P colubrinum giúp cho hồ tiêu khả kháng bệnh ... sẻ Ấn Độ Phú Quốc Tiêu Trâu III Phương pháp chọn giống truyền thống Chọn lọc 1.1 Chọn lọc vơ tính (Clonal Selection) Sơ đồ chương trình chọn lọc vơ tính giống hồ tiêu III.1.1 Chọn lọc vơ tính... Kỹ thuật nhân giống II Tài nguyên di truyền Chi Piper Các giống phổ biến Việt Nam III Phương pháp chọn giống truyền thống Chọn lọc Lai giống Lai khác loài IV Các phương pháp chọn giống đại - Ứng... thiện giống Lai dòng Lai phức tạp Lai hồi giao III.2 Lai giống (Intercultivar Hybridization) Sơ đồ chương trình chọn giống lai đặc biệt trọng đến tính chống chịu bệnh thối gốc hồ tiêu III.2 Lai giống
- Xem thêm -

Xem thêm: Chọn giống hồ tiêu , Chọn giống hồ tiêu , a. Vật liệu và phương pháp

Gợi ý tài liệu liên quan cho bạn

Nhận lời giải ngay chưa đến 10 phút Đăng bài tập ngay