ÔN THI DƯỢC DI TRUYỀN HỌC

7 8 0
  • Loading ...
1/7 trang

Thông tin tài liệu

Ngày đăng: 29/11/2018, 14:02

Trạm Mã đề TRƯỜNG ĐẠI HỌC Y DƯỢC CẦN THƠ ĐỀ THI HKI NĂM HỌC 2014-2015 (Lần 2) KHOA KHOA HỌC CƠ BẢN Môn: SINH HỌC DI TRUYỀN BM SINH HOC DI TRUYỀN ĐỐI TƯỢNG: RHM-YHCT-YHDP K40 Đề 101 Thời gian: 49 phút trạm (mỗi trạm phút) CHỌN MỘT ĐÁP ÁN ĐÚNG NHẤT LÀM BÀI TRÊN PHIẾU TRẢ LỜI Trong tế bào, hoạt động tổng hợp prôtêin xảy : A Ribosome C Lưới nội chất D Nhân Chất sau cấu tạo từ nguyên tố hoá học C,H,O,N,P? A Protein B Nhân B Acid nucleic C Lipid D Carbohydrate Đặc điểm có tế bào động vật mà khơng có tế bào thực vật là: A Trong tế bào chất có nhiều loại bào quan B Có vách tế bào chất cellulose C Có trung thể D Cả a,b,c Bào quan có chức cung cấp lượng cho hoạt động tế bào A Mạng nội chất B Nhân C Trung thể D Ti thể Để điều trị cho người mắc bệnh máu khó đơng người ta thường: A Sửa chữa cấu trúc gen đột biến B Tiêm chất sinh sợi huyết C Thay gen đột biến gen bình thường D Cả ba đáp án Các chất vận chuyển qua lại màng tế bào có tham gia protein xuyên màng không cần lượng ATP đặc điểm vận chuyển A Chủ động B Vận chuyển trung gian (có trợ lực) C Thụ động Trong trình phát sinh trứng động vật, thể cực tạo A Trong lần phân bào thứ B Trong lần phân bào thứ hai C Trong hai lần phân bào D Câu C D A, B Trong nhóm NST người, NST có vệ tinh đặc điểm có A nhóm A B nhóm B C Nhóm D D Nhóm G Ở người bệnh bạch tạng gen lặn b chi phối, gen lành B, gen nằm nhiễm sắc thể thường Trong quần thể có tỷ lệ người mắc bệnh bạch tạng (bb) 1/10000 Tỷ lệ người mang gen bệnh trạng thái dị hợp quần thể xấp xỉ: A 0.5% 10 B % C 1,4% D 1,5 % (Sử dụng thông tin câu trên) tần số alen b (quy định bệnh bạch tạng) quần thể A 10% B 5% C 1% D 0,1 % 11 Chọn cặp ghép phù hợp kiểu sàng lọc với bệnh/tật di truyền Teo Duchenne X Sàng lọc di truyền trước sinh Galactose huyết Y Sàng lọc di truyền trẻ sơ sinh Trạm 23 Hội chứng Down A 1-X, 2-Y, 3-Z 12 Z Sàng lọc di truyền cộng đồng B 1-Z, 2-Y, 3-X C 1-Y, 2-X, 3-Z Ở trình nguyên phân, NST tồn dạng kép, ngoại trừ: D 1-Z, 2-X, 3Y A Kỳ trung gian 13 B Kỳ đầu C Kỳ Mã đề: D Kỳ sau Bộ ba sau ba kết thúc? A 5' AUG3' 14 B 3' UGA 5' C 3'UAG5’ D 3' AGU 5' Khác với tế bào động vật,tế bào thực vật có: A Mạng hệ nội thất B Không bào trung tâm C Phức hệ Golgi D Các khơng bào 15 Một trẻ sơ sinh nhận kháng thể (là phân tử protein lớn) từ sữa mẹ Các phân tử kháng thể qua tế bào lót bên ống ruột trẻ bằng: A Sự thẩm thấu B Sự vận chuyển thụ động C Bơm màng D Sự nhập bào 16 Đặc điểm có tinh trùng trứng? A Có tế bào chất B Có nhiễm sắc thể đơn bội C Có lương ti thể lớn D Có nhiều túi chứa enzyme tiêu hóa 17 Khi hồn thành pha S kỳ trung gian nguyên phân, số nhiễm sắc thể tế bào là: A 4n, trạng thái đơn B 4n, trạng thái kép 18 C 2n, trạng thái đơn D 2n, trạng thái kép Chu kỳ lưỡng bội chu kỳ sống người bắt đầu A Sự chào đời em bé sinh B Sự giảm phân C Sự thụ tinh D Lần phân chia hợp tử 19 Đoạn gen mã hóa cho tối đa acid amin chuỗi polypeptide 3’… ATCAAACATTACGGCATCGGCG…5’ A) B) C) D) 20 Lựa chọn bước kiểm soát để phân tử mARN sơ cấp (bản nháp) biến đổi thành mARN thứ cấp (mARN chức năng) P Bản sơ cấp mARN gấp khúc xoắn cuộn lại để trở thành mARN chức Q mARN sơ cấp phải chui khỏi nhân tới tế bào chất X Gắn mũ 7-methyl guanosine vào đầu 5’ Y Gắn đuôi poly A (khoảng 100-200) vào đầu 3’ Z Cắt di dời cắc intron, nối exon lại với W Cắt bỏ mã mở đầu f-methionine để thành protein hoàn chỉnh Chọn đáp án sau A P, Q, X, Y B X, Y, Z, C Q, X, Y Trạm 21 A Da D Z, Y, Z, W Mã đề: Loại tế bào sau có thời gian sống ngắn B Tế bào biểu mơ tiêu hóa C Tế bào bạch cầu trung tính D Gan 22 Tinh bào bậc II giảm nhiễm tạo chứa nhiễm sắc thể A Tinh nguyên bào, 2n 23 B Tinh tử, n C Tinh trùng, n D Tinh tử, 2n Bước q trình chết tế bào có chương trình A Phá hủy khung xương nhân DNA kết đặc lại B Phá hủy enzym nhân đôi enzym sửa chữa AND C Thu nhận tín hiệu chết D Chuyển số phospholipid từ bên màng tế bào phía ngồi 24 Hoa vân vòng đầu ngón tay dải vân gồm đường theo hình vòng tròn hình bầu dục, có (X ) chạc ba hai bên tâm dải vân X là: A 25 B C D Purine gồm có…….loại; là…… A ; A, T B ; A, G 26 Loại đường tham gia cấu tạo Số(I) số (II) : A deoxyribose, C5H10O4 C ; T, C D ; G, C đơn phân ARN (I) cơng thức (II) B Ribose, C6H12O6 C deoxyribose, C6H12O6 D Ribose, C5H10O5 27 Thông tin di truyền truyền đạt tương đối ổn định từ tế bào sang tế bào khác, từ hệ sang hệ khác loài nhờ: A Hoạt động mã ADN B Cơ chế nhân đôi ADN C Hoạt động nguyên phân, giảm phân thụ tinh D A, B C 28 Tế bào có hình kỳ phân bào? A Kỳ phân bào giảm nhiễm B Kỳ sau phân bào giảm nhiễm C Kỳ phân bào nguyên nhiễm D Kỳ sau phân bào nguyên nhiễm 29 Chọn kiểu ghép phù hợp với tên gọi chức enzyme trình tự nhân đôi ADN tế bào chân hạch Giữ sợi DNA không xoắn lại với a Primase Cắt đứt liên kết hydro DNA tạo sợi đơn b Ligase Tổng hợp đoạn mồi c SSB Bổ sung nu, tổng hợp sợi DNA d DNA polymerase III Loại bỏ đoạn mồi mạch muộn e DNA polymerase I Nối đoạn Okazaki lại với nha f Helicase A 1-a, 2-b, 3c, 4-d, 5-e, 6-f B 1-c, 2-a, 3-f, 4-d, 5-e, 6-b C 1-f, 2-c, 3- b, 4-d, 5-e, 6-a D 1-c, 2-f, 3-a, 4-d, 5-e, 6-b 30 Các phân tử ARN tổng hợp từ ….và sau thực chức A Nhân, nhân B Nhân, tế bào chất C Tế bào chất, tế bào chất Trạm D Tế bào chất, nhân Mã đề: 31 Q trình nhân đơi ADN gọi là: I Tự nhân đôi II Sao mã III Tái sinh IV Giải mã V Sinh tổng hợp VI Tái A I, VI 32 B I, III C II, IV D II, VI Điểm giống loại ARN tế bào là: A Đều có cấu trúc mạch B Đều có vai trò q trình tổng hợp prơtêin C Đều tạo từ khuôn mẫu phân tử AND 33 D Cả a,b c Cho mạch ADN có trình tự 5’ AAG GGT TCC TTC 3’ Trình tự mạch bổ sung A 3’ TTC CCA AGG AAG 5’ B 5’ TT C CCA AGG AAG 3’ C 3’ TTC GGA AGG AAG 5’ D 5’ TTC GGA AGG AAG 3’ 34 Ở sinh vật nhân chuẩn (Eukaryote), aa mở đầu cho việc tổng hợp chuỗi polypeptide A pheninalanin 35 B methionin C formyl methionin D Glutamin Điểm khác gen cấu trúc gen điều hoà A cấu trúc gen B chức Prôtêin gen tổng hợp C khả phiên mã gen D vị trí phân bố gen 36 ADN NST tế bào chân hạch A phân tử xoắn kép mạch vòng B phân tử xoắn kép mạch thẳng C phân tử sợi đơn mạch thẳng D nhiều phân tử sợi đơn mạch vòng 37 Ở Lac-operon, có đường lactose q trình phiên mã diễn lactose gắn với A chất ức chế làm cho bị bất hoạt B protein điều hồ làm kích hoạt tổng hợp prơtêin C vùng vận hành, kích hoạt vùng vận hành D enzyme ARN polomerase kích hoạt enzyme 38 Giai đoạn kéo dài chuỗi polypeptid trình lắp ráp acid amin theo trình tự định mã hoá mARN tạo thành chuỗi polypeptid đặc hiệu Mã mARN đọc theo hướng từ: A 5’ đến 3’ 39 B 3’ đến 5’ C 5’ đến 3’hoặc 3’ đến 5’ D 5’ đến 3’ 3’ đến 5’ Bệnh cúm gia cầm loại bệnh do: A Virus gây B Vi khuẩn gây C A B D A B sai 40 Một đoạn ADN lồi có 600 cặp nucleotide, có 30% G Số lượng cặp A-T phân tử …… A 360 B 120 C 180 D 240 41 Một gen bị đột biến thành phần số lượng nucleotide gen không thay đổi Dạng đột biến xảy gen A thay cặp A-T cặp T-A B thay cặp A-T cặp G-C C cặp T-A D thêm cặp T-A 42 Trong trình điện di AND/protein phân tử có kích thước lớn A Di chuyển nhanh phân tử có kích thước nhỏ B Tích điện âm lớn C Di chuyển chậm phân tử có kích thước nhỏ D Tích điện dương lớn Trạm 43 Mã đề: Theo mô hình Jacob- Monod, chất cảm ứng tế bào vi khuẩn A gắn vào vùng huy, hoạt hóa operon tương ứng B gắn vào gen cấu trúc, kích thích chúng tổng hợp ARNm C gắn vào protein ức chế làm bất hoạt protein D gắn vào protein ức chế làm cho ARN polymerase hoạt động 44 Nếu gen cấu trúc bị đột biến thay cặp G – C cặp A – T số liên kết hydrơ A tăng 45 B tăng D giảm Trong acid nucleic, base nitric gắn vào carbon thứ … phân tử đường A 5’ 46 C giảm B 4’ C 3’ D 1’ Enzyme giới hạn có đặc điểm: A Vị trí cắt xác định B Được tách chiết từ vi khuẩn C Vị trí nhận biết có trình tự đối xứng đảo ngược D Cả ba 47 Vùng huy operon vi khuẩn A mã hóa cho protein ức chế B mã hóa cho chất cảm ứng C vị trí gắn chất ức chế 48 D vị trí gắn ARN polymerase Lac- operon ví dụ A kiểm soát giải mã B kiểm soát chép C kiểm soát phiên mã D kiểm soát trước phiên mã 49 Phía trước exon phía sau exon cuối operon thường vùng: A Không phiên mã B Không dịch mã C Không tự nhân đôi D Cả ba câu sai 50 Bệnh hẹp mơn vị bẩm sinh có tần số gặp nam cao nữ lần A Hiệu ngưỡng bệnh nam thấp nữ B Hiệu ngưỡng bệnh nam cao nữ C Hiệu ngưỡng bệnh nam nữ D Hiệu ngưỡng bệnh không ảnh hưởng 51 Ở người bệnh mù màu đột biến NST giới tính X gây Gen M quy định mắt bình thường Bệnh bạch tạng gen đột biến lặn b NST thường gây ra, gen B quy định da bình thường Một cặp vợ chồng bình thường sinh trai bị bạch tạng, trai bị mù màu Ông bà nội ngoại hai đứa trẻ bình thường Người mẹ hai đứa trai có kiểu gen nào? A BbXMXM B BbXMXm C BBXMXm D A B 52 Hai nhóm triệu chứng bệnh Thalassemia thiếu máu tan máu ứ đọng sắt nội quan Người bình thường có gen α nằm NST số (I) gen β nằm NST số (II) Số (I) (II) là: A 16, 53 B 16, 11 C 11, 16 D 9, 16 Nghiên cứu di truyền học người có khó khăn do: A Khả sinh sản lồi người chậm C Bộ nhiễm sắc thể số lượng nhiều, kích thước nhỏ B Các lí xã hội D Tất 54 Qua nghiên cứu phả hệ tính trạng dứơi người tính trạng trội: A Da trắng Trạm B Tóc thẳng C Mơi mỏng D Lông mi cong dài Mã đề: 55 Bệnh bạch tạng người gây A Thiếu sắc tố mêlanin C Tyrosin biến thành sắc tố mêlanin 56 B Khơng có khả tổng hợp enzym tyrosinase D Tất Trong nuôi cấy tế bào lympho máu ngoại vi, PHA dùng để A Kích thích tế bào phân chia B Dừng tế bào kỳ C Biến tính ADN D Phá vỡ màng tế bào 57 Quan sát phả hệ mô tả di truyền bệnh qua ba hệ: A Đột biến gen trội NST thường B Đột biến gen lặn NST thưng C Đột biến gen lặn NST giới tính X D Đột biến gen trội NST giới tính X 58 Đối với bệnh di truyền gen đột biến lặn nằm NST thường quy định, hai bố mẹ bình thường, tỉ lệ họ mắc bệnh là: A 100% B 50% C 25% D 0% 59 Trên phả hệ bệnh di truyền gen lặn nhiễm sắc thể (NST) giới tính X bệnh di truyền NST Y thấy biểu nam Làm để phân biệt hai tượng này: A Ở bệnh gen đột biến NST Y bố mắc bệnh truyền lại cho tất trai B Ở bệnh gen đột biến NST Y bố không mắc bệnh khơng có mắc bệnh C Ở bệnh gen đột biến NST Y gái mắc bệnh D Tất 60 Phương pháp nghiên cứu di truyền tế bào nghiên cứu loại bệnh di truyền người? A Bệnh đột biến cấu trúc NST B Đột biến điểm, thay cặp nucleotide C Bệnh đột biến số lượng NST D Bệnh đột biến cấu trúc NST dạng đảo đoạn 61 Ghép cho phù hợp quy luật di truyền với đặc điểm loại di truyền đơn gen 100% bệnh mẹ mắc bệnh A Alen trội hoàn toàn NST thường Thường di truyền chéo qua hệ B Alen lặn NST thường Di truyền thẳng theo dòng bố C Alen trội hồn tồn NST giới tính X Khơng có nam bình thường mang gen D Alen lặn NST giới tính X bệnh Có kiểu hình E Di truyền liên kết NST giới tính Y Có tỉ lệ mắc bệnh thấp cộng đồng F Di truyền ty thể Có tỉ lệ mắc bệnh cao cộng đồng G Alen trội khơng hồn tồn NST thường Các cặp ghép sau nhất: A A-6; B-7, C-4, D- 2, E- 3, F-3, G-5 B A-7; B-6, C-4, D- 2, E- 3, F-1, G-5 C A-5; B-7, C-4, D- 2, E- 3, F-3, G-1 C A-7; B-6, C-2, D- 4, E- 3, F-1, G-5 62 Sinh thiết tua thai thực hiện, ngoại trừ: Trạm B Qua ngã âm đạo A Qua thành bụng cung C Kết hợp siêu âm D Qua cổ tử 63 Tripple test phương pháp dùng sàng lọc di truyền : A Trước sinh B Trẻ sơ sinh C Cộng đồng D A, B Mã đề: 64 Ký hiệu NST người nữ, có chuyển đoạn xảy NST số nhánh dài vùng băng với NST số 22 nhánh dài vùng băng ghi sau: A 46,XY,t(9q11)(22q12) B 46,XX,t(9q11)(22q12) C 46,XX,inv(9q11)(22q12) D 46,XX,ins(9q11)(22q12) 65 Bộ NST người gồm 46 NST, xếp thành nhóm, ký hiệu A, B, C, D, E, F, G; chủ yếu tiêu chuẩn: A Chiều dài, số tâm chiều dài tương đối NST B Chiều dài, số tâm số lượng gen có NST C Chiều dài, số tâm vị trí băng NST D Chiều dài, eo thắt thứ eo thắt thứ hai 66 Một người mẹ (mother) làm đơn xin truy nhận cha cho (child) u cầu hỗ trợ ni đến năm 18 tuổi Người đàn ơng bị tình nghi (Alleged father) từ chối trách nhiệm tuyên bố khơng có với người phụ nữ Tòa án dựa vào lời khai người phụ nữ yêu cầu làm xét nghiệm dấu phân tử ADN C/AF Mix kết phân tích ADN trộn hai mẫu ADN đứa ADN người cha bị tình nghi Dựa vào kết cho biết phán xử sao? A Người đàn ông cha đứa bé B Người đàn ơng cha đứa bé C Chưa thể kết luận quan hệ huyết thống từ kết D Kết dấu phân tử ADN không đáng tin cậy 67 Một cặp vợ chồng bình thường sinh gái bình thường, trai mù màu trai mắc bệnh máu khó đơng Kiểu gen hai vợ chồng nào? Cho biết gen h gây bệnh máu khó đơng, gen m gây bệnh mù màu alen bình thường ứng H M A) Bố XmHY, mẹ XMhXmh B) Bố XmhY, mẹ XMhXmH C) bố XMHYmẹ XMHxMH D) Bố XMHY; mẹ XMhXmH 68 Chỉ số IQ (Intelligence Quotatient) người đựợc tính 115, người liệt vào mức biểu thị trí tuệ là: A Thiên tài B Rất thông minh C Thông minh D Kiệt xuất 69 Một đứa bé sinh phát cháu bé bị mắc chứng bệnh phenylxeto niệu Câu tư vấn di truyền cho tình trên? A Cần thay máu cho cháu bé B Cần dùng liệu pháp gen, đưa gen lành vào người bệnh B Cần loại bỏ phenylalanin khẩn phần ăn D Cần thay sữa mẹ sữa hộp Cán coi thi không giải thích thêm! ... số nhánh dài vùng băng với NST số 22 nhánh dài vùng băng ghi sau: A 46,XY,t(9q 11) (22 q 12) B 46,XX,t(9q 11) (22 q 12) C 46,XX,inv(9q 11) (22 q 12) D 46,XX,ins(9q 11) (22 q 12) 65 Bộ NST người gồm 46 NST, xếp... 52 Hai nhóm triệu chứng bệnh Thalassemia thi u máu tan máu ứ đọng sắt nội quan Người bình thường có gen α nằm NST số (I) gen β nằm NST số (II) Số (I) (II) là: A 16 , 53 B 16 , 11 C 11 , 16 D 9, 16 ... nhất: A A-6; B-7, C-4, D- 2, E- 3, F-3, G-5 B A-7; B-6, C-4, D- 2, E- 3, F -1, G-5 C A-5; B-7, C-4, D- 2, E- 3, F-3, G -1 C A-7; B-6, C -2, D- 4, E- 3, F -1, G-5 62 Sinh thi t tua thai thực hiện,
- Xem thêm -

Xem thêm: ÔN THI DƯỢC DI TRUYỀN HỌC, ÔN THI DƯỢC DI TRUYỀN HỌC

Gợi ý tài liệu liên quan cho bạn

Nhận lời giải ngay chưa đến 10 phút Đăng bài tập ngay