Nghiên cứu cải tiến năng suất một số dònggiống lúa bằng chỉ thị phân tử

175 22 0
  • Loading ...
1/175 trang
Tải xuống

Thông tin tài liệu

Ngày đăng: 25/11/2018, 12:23

Những năm gần đây, với sự phát triển mạnh mẽ của công nghệ sinh học hiện đại, nhiều chỉ thị phân tử liên kết với các tính trạng cấu thành năng suất được xác định. Các nhà khoa học, các nhà chọn giống bắt đầu quan tâm nhiều hơn tới vấn đề ứng dụng chỉ thị phân tử trong chọn tạo giống. Phương pháp chọn giống nhờ chỉ thị phân tử và lai trở lại (MABC) được đưa ra nhằm chọn tạo giống nhanh chóng và hiệu quả. Từ những vấn đề nêu trên cho thấy việc ứng dụng chỉ thị phân tử và lai trở lại trong việc lai chuyển các QTLgen tăng năng suất vào giống lúa trồng đại trà là một vấn đề cấp thiết. i BỘ GIÁO DỤC VÀ ĐÀO TẠO BỘ NÔNG NGHIỆP VÀ PTNT VIỆN KHOA HỌC NÔNG NGHIỆP VIỆT NAM NGUYỄN THỊ THÚY ANH NGHIÊN CỨU CẢI TIẾN NĂNG SUẤT MỘT SỐ DÒNG/GIỐNG LÚA BẰNG CHỈ THỊ PHÂN TỬ LUẬN ÁN TIẾN SĨ NÔNG NGHIỆP HÀ NỘI, 2018 ii BỘ GIÁO DỤC VÀ ĐÀO TẠO BỘ NÔNG NGHIỆP VÀ PTNT VIỆN KHOA HỌC NÔNG NGHIỆP VIỆT NAM NGUYỄN THỊ THÚY ANH NGHIÊN CỨU CẢI TIẾN NĂNG SUẤT MỘT SỐ DÒNG/GIỐNG LÚA BẰNG CHỈ THỊ PHÂN TỬ Chuyên ngành: Công nghệ sinh học Mã số: 42 02 01 LUẬN ÁN TIẾN SĨ NÔNG NGHIỆP Người hướng dẫn Khoa học: GS.TS Trần Trung PGS.TS Trần Đăng Khánh HÀ NỘI, 2018 i LỜI CAM ĐOAN Tôi xin cam đoan cơng trình nghiên cứu tơi nhóm tác giả Toàn số liệu kết nghiên cứu luận án trung thực chƣa đƣợc sử dụng để cơng bố cơng trình nghiên cứu nhận học vị, thơng tin trích dẫn luận án đƣợc rõ nguồn gốc Hà Nội, ngày tháng Tác giả luận án Nguyễn Thị Thúy Anh năm 2018 ii LỜI CẢM ƠN Lời đầu tiên, tơi xin đƣợc bày tỏ lòng kính trọng biết ơn sâu sắc tới GS.TS.Trần Trung, PGS.TS.Trần Đăng Khánh, ngƣời thầy tận tình hƣớng dẫn, giúp đỡ tạo điều kiện thuận lợi để tơi hồn thành cơng trình nghiên cứu Luận án nhận đƣợc hỗ trợ kinh phí từ đề tài độc lập cấp Nhà nƣớc mã số ĐTĐL.2012-G36 đề tài KC.06.12/11-15 Tôi trân trọng cảm ơn Ban lãnh đạo Viện Khoa học Nông nghiệp Việt Nam, tập thể lãnh đạo cán Ban đào tạo sau đại học tạo điều kiện thuận lợi cho tơi suốt q trình học tập nghiên cứu Đặc biệt, xin chân thành cảm ơn tập thể cán Bộ môn Sinh học Phân tử, Bộ môn Kỹ thuật Di truyền - Viện Di truyền Nông nghiệp, nơi thực nội dung luận án, giúp đỡ tơi đóng góp nhiều ý kiến quý báu trình thực hồn thành luận án Tơi xin gửi lời cảm ơn sâu sắc đến Lãnh đạo trƣờng Đại học Sƣ phạm Kỹ thuật Hƣng Yên, đồng nghiệp Khoa Cơng nghệ Hóa học Mơi trƣờng hỗ trợ, giúp đỡ động viên suốt thời gian học tập nghiên cứu Cuối cùng, xin gửi lời cảm ơn sâu sắc tới gia đình, bạn bè ngƣời thân bên cạnh chia sẻ, động viên, giúp đỡ tơi q trình học tập, nghiên cứu hoàn thành luận án Hà Nội, ngày tháng năm 2018 Tác giả luận án Nguyễn Thị Thúy Anh iii MỤC LỤC LỜI CAM ĐOAN i LỜI CẢM ƠN ii MỤC LỤC .iii DANH MỤC CHỮ VIẾT TẮT vi DANH MỤC BẢNG viii DANH MỤC HÌNH ………………………………………………………………………x MỞ ĐẦU 1 Tính cấp thiết đề tài Mục tiêu nghiên cứu Đối tƣợng phạm vi nghiên cứu Những đóng góp luận án CHƢƠNG TỔNG QUAN TÀI LIỆU 1.1 Ứng dụng thị di truyền chọn tạo giống lúa 1.1.1 Khái niệm phân loại thị di truyền 1.1.2 Ứng dụng thị phân tử nghiên cứu chọn giống 1.2 Ứng dụng thị phân tử cải tiến suất lúa 16 1.2.1 Khái quát suất yếu tố cấu thành suất 16 1.2.2 Các QTL/gen liên kết với tính trạng suất 17 1.2.3 Ứng dụng thị phân tử cải tiến suất lúa 29 1.3 Nghiên cứu ứng dụng thị phân tử chọn tạo giống lúa Việt Nam 40 CHƢƠNG VẬT LIỆU, NỘI DUNG VÀ PHƢƠNG PHÁP NGHIÊN CỨU 43 2.1 Vật liệu 43 2.1.1 Các dòng/giống lúa làm vật liệu nghiên cứu 43 2.1.2 Chỉ thị phân tử dùng nghiên cứu 44 2.1.3 Hóa chất thiết bị 45 2.1.4 Địa điểm thời gian nghiên cứu 45 2.2 Nội dung nghiên cứu 45 iv 2.2.1 Đánh giá nguồn vật liệu phục vụ cho công tác chọn tạo giống lúa 45 2.2.2 Sử dụng thị phân tử để khảo sát đa hình ADN dòng/giống cho nhận QTL/gen tăng số hạt bơng nhiễm sắc thể 45 2.2.3 Cải tiến suất giống lúa trồng đại trà cho đồng sơng Hồng dòng NPT1 (Dạng hình mới) triển vọng thị phân tử lai trở lại 46 2.2.4 Trồng thử nghiệm đánh giá số dòng/giống triển vọng 46 2.3 Phƣơng pháp nghiên cứu 46 2.3.1 Phƣơng pháp bố trí thí nghiệm đồng ruộng 46 2.3.2 Phƣơng pháp lai hữu tính, lai trở lại giống cho nhận QTL/gen 46 2.3.3 Phƣơng pháp chọn giống nhờ thị phân tử 47 2.3.4 Các tiêu phƣơng pháp đánh giá khả chống chịu dòng, giống lúa nghiên cứu 49 2.3.5 Các tiêu phƣơng pháp đánh giá đặc điểm sinh trƣởng, hình thái suất, yếu tố cấu thành suất…………………………………………… 50 2.3.6 Một số kỹ thuật sử dụng phòng thí nghiệm 52 2.3.7 Phƣơng pháp phân tích kết xử lý số liệu 57 CHƢƠNG KẾT QUẢ VÀ THẢO LUẬN 58 3.1 Đánh giá nguồn vật liệu phục vụ cho công tác chọn tạo giống lúa 58 3.1.1 Đánh giá tiêu hình thái sinh trƣởng phát triển, tiêu suất yếu tố cấu thành suất dòng/giống lúa dùng làm dòng cho gen 58 3.1.2 Đánh giá tiêu hình thái sinh trƣởng phát triển, tiêu suất yếu tố cấu thành suất dòng/giống lúa dùng làm dòng nhận gen 61 3.2 Sử dụng thị phân tử khảo sát đa hình ADN dòng/giống cho nhận QTL/gen tăng số hạt trên nhiễm sắc thể 62 3.2.1 Kết xác định thị phân tử đa hình vị trí QTL/gen quy định tính trạng tăng số hạt bơng dòng/giống cho nhận QTL/gen 62 3.2.2 Kết khảo sát đa hình 12 NST dòng/giống cho nhận QTL/gen quy định tính trạng tăng số hạt 64 v 3.3 Cải tiến suất giống lúa trồng đại trà cho đồng sông Hồng dòng NPT1 (dạng hình mới) triển vọng thị phân tử lai trở lại 69 3.3.1 Kết sử dụng thị phân tử đa hình chọn lọc cá thể lai tổ hợp lai Khang dân 18/KC25 69 3.3.2 Kết sử dụng thị phân tử đa hình chọn lọc cá thể lai tổ hợp lai NPT1/KC25 86 3.4 Trồng thử nghiệm đánh giá số dòng/giống triển vọng 100 3.4.1 Kết trồng thử nghiệm đánh giá số dòng/giống triển vọng tổ hợp KD18 x KC25 100 3.4.2 Kết trồng thử nghiệm đánh giá số dòng/giống triển vọng tổ hợp NPT1 x KC25 110 3.4.3 Kết đánh giá dòng K2 (thế hệ BC3F5 tổ hợp KD18/KC25) dòng N8 (thế hệ BC3F5 tổ hợp NPT1/KC25) 119 KẾT LUẬN VÀ KIẾN NGHỊ 123 Kết luận 123 Kiến nghị 123 DANH MỤC CÔNG TRÌNH ĐÃ CƠNG BỐ LIÊN QUAN ĐẾN LUẬN ÁN 124 TÀI LIỆU THAM KHẢO 125 PHỤ LỤC 138 vi DANH MỤC CHỮ VIẾT TẮT Chữ viết tắt Giải thích thuật ngữ ADN Axit deoxyribonucleic ARN Axit ribonucleic AFLP Amplified fragment length polymophism (Đa hình chiều dài đoạn đƣợc nhân bản) BC Backcross (Lai trở lại) B/K Số bơng/khóm Cs Cộng CCC Chiều cao CV% Coefficient of variation (Hệ số biến động) DP Donor parent (Cây cho gen) đ/c Đối chứng HVNN Học viện Nông nghiệp HC/B Hạt chắc/bông HD Heading day (Thời gian sinh trƣởng) HI Haverst index (Chỉ số thu hoạch) HL/B Hạt lép/bông GA Gibberellin GGT Graphical Genotypes GN Grain number (Số hạt bông) GL Grain length (Chiều dài hạt) GS Grain size (Kích thƣớc hạt) GW Grain weight (Khối lƣợng hạt) IRRI International rice research institute (Viện Nghiên cứu lúa Quốc tế) KD18 Khang dân 18 LSD Least significant difference (Sự sai khác có ý nghĩa) NIL Near-isogenic line (Dòng cận đẳng gen) vii NPT New plant type (Dạng hình mới) NST Nhiễm sắc thể NSLT Năng suất lý thuyết NSTT Năng suất thực thu MAS Marker assisted selection (Chọn lọc nhờ thị phân tử) MABC Marker assisted backcrossing (Chọn lọc nhờ thị phân tử lai trở lại) KL1000 Khối lƣợng nghìn hạt PBP Branches per panicle (Số nhánh bông) PCR Polymerase chain reaction (Chuỗi phản ứng trùng hợp) PL Panicle length (Chiều dài bông) PN Panicle number (Số bơng) QTL Quantitative trait locus (Locus tính trạng số lƣợng) RAPD RFLP Randomly amplified polymorphic DNA (Đa hình đoạn ADN khuyếch đại ngẫu nhiên) Restriction fragment length polymorphism (Đa hình chiều dài đoạn phân cắt giới hạn) RP Recipient parent (Cây nhận gen) TB Trung bình TGST Thời gian sinh trƣởng TS Tổng số TT Thứ tự SNP Single nucleotide polymorphisms (Đa hình nucleotide đơn) viii DANH MỤC BẢNG TT bảng 1.1 Tên bảng Kết dự kiến chƣơng trình MABC kết hợp sử dụng chọn lọc gen mục tiêu chọn lọc di truyền Trang 14 1.2 Các QTL/gen kiểm sốt tính trạng đẻ nhánh lúa 19 1.3 Các QTL/gen liên kết tính trạng số hạt 25 1.4 Các QTL/gen quy định tính trạng hình dạng hạt 27 1.5 Tóm tắt số nghiên cứu ứng dụng thị phân tử để cải tiến suất lúa 34 2.1 Danh sách 13 dòng dùng làm dòng cho QTL/gen 43 2.2 Tên trình tự nucleotide mồi đƣợc sử dụng 44 2.3 Thành phần hàm lƣợng tham gia phản ứng PCR 53 2.4 Chƣơng trình phản ứng PCR 54 Kết theo dõi tiêu hình thái sinh trƣởng phát triển, 3.1 yếu tố cấu thành suất suất thực thu 58 dòng cho gen vụ Xuân 2013 Từ Liêm - Hà Nội Kết đánh giá mức độ nhiễm sâu bệnh, chống đổ độ 3.2 đồng ruộng dòng thí nghiệm vụ Xn 2013 Từ Liêm 60 - Hà Nội Kết theo dõi tiêu hình thái sinh trƣởng, yếu tố 3.3 cấu thành suất suất dòng nhận gen vụ 61 Xuân 2013 Từ Liêm - Hà Nội 3.4 Thống kê thị SSR đa hình Khang dân 18/KC25 65 3.5 Thống kê thị SSR đa hình dòng NPT1/KC25 66 3.6 3.7 3.8 Tỉ lệ phần trăm alen giống nhận gen 32 cá thể BC1F1 mang QTL/gen Tỉ lệ phần trăm alen giống nhận gen 15 cá thể BC2F1mang QTL/gen Các cá thể đồng hợp tử giống bố hệ BC3F2 tổ hợp 72 77 84 146 :PAGE nang suat thuc thu cac dong cho gen MEANS FOR EFFECT CT$ CT$ 10 11 12 13 NOS 3 3 3 3 3 3 NL 2.00000 2.00000 2.00000 2.00000 2.00000 2.00000 2.00000 2.00000 2.00000 2.00000 2.00000 2.00000 2.00000 NSTT 45.2000 61.1000 64.8000 60.2000 56.3000 58.9000 60.3000 63.2000 61.4000 61.8000 60.7000 60.8000 63.6000 SE(N= 3) 0.577350 2.99131 5%LSD 26DF 1.67828 8.69534 ANALYSIS OF VARIANCE SUMMARY TABLE FILE NSTT1 4/ 1/16 17:29 :PAGE nang suat thuc thu cac dong cho gen F-PROBABLIITY VALUES FOR EACH EFFECT IN THE MODEL SECTION - VARIATE NL NSTT GRADN MEAN (N= 39) NO OBS 39 2.0000 39 59.869 STADNARD DEVIATION C OF V |CT$ SD/MEAN | BASED ON BASED ON % | TOTAL SS RESID SS | 0.82717 1.0000 50.0 1.0000 6.4089 5.1811 8.7 0.0173 | | | | Năng suất lý thuyết dòng nhận gen BALANCED ANOVA FOR VARIATE NL FILE NSLT 4/ 1/16 15:42 :PAGE nang suat ly thuyet cua cac dong nhan gen VARIATE V001 NL LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= CT$ 66 0.000000 0.000000 0.00 1.000 * RESIDUAL 134 134.000 1.00000 * TOTAL (CORRECTED) 200 134.000 670000 BALANCED ANOVA FOR VARIATE NSLT FILE NSLT 4/ 1/16 15:42 :PAGE nang suat ly thuyet cua cac dong nhan gen VARIATE V003 NSLT LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= CT$ 66 12728.2 192.851 4.19 0.000 * RESIDUAL 134 6165.60 46.0119 147 * TOTAL (CORRECTED) 200 18893.8 94.4688 TABLE OF MEANS FOR FACTORIAL EFFECTS FILE NSLT 4/ 1/16 15:42 :PAGE nang suat ly thuyet cua cac dong nhan gen MEANS FOR EFFECT CT$ CT$ NOS 3 NL NSLT 2.00000 2.00000 85.8000 105.600 SE(N= 3) 0.577350 3.91629 5%LSD 134DF 1.61471 10.9529 ANALYSIS OF VARIANCE SUMMARY TABLE FILE NSLT 4/ 1/16 15:42 :PAGE nang suat ly thuyet cua cac dong nhan gen F-PROBABLIITY VALUES FOR EACH EFFECT IN THE MODEL SECTION - VARIATE NL NSLT GRADN MEAN (N= 201) NO OBS 201 2.0000 201 84.330 STADNARD DEVIATION C OF V |CT$ SD/MEAN | BASED ON BASED ON % | TOTAL SS RESID SS | 0.81854 1.0000 50.0 1.0000 9.7195 6.7832 8.0 0.0000 | | | | Năng suất thực thu dòng nhận gen BALANCED ANOVA FOR VARIATE NL FILE NSTT 4/ 1/16 16: :PAGE nang suat thuc thu cua cac dong nhan gen VARIATE V001 NL LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= CT$ 66 0.000000 0.000000 0.00 1.000 * RESIDUAL 134 134.000 1.00000 * TOTAL (CORRECTED) 200 134.000 670000 BALANCED ANOVA FOR VARIATE NSTT FILE NSTT 4/ 1/16 16: :PAGE nang suat thuc thu cua cac dong nhan gen VARIATE V003 NSTT LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= CT$ 66 5511.69 83.5105 3.28 0.000 * RESIDUAL 134 3412.28 25.4648 * TOTAL (CORRECTED) 200 8923.97 44.6199 TABLE OF MEANS FOR FACTORIAL EFFECTS FILE NSTT 4/ 1/16 16: 148 :PAGE nang suat thuc thu cua cac dong nhan gen MEANS FOR EFFECT CT$ CT$ NOS 3 NL NSTT 2.00000 2.00000 57.9000 73.3000 SE(N= 3) 0.577350 2.91346 5%LSD 134DF 1.61471 8.14825 ANALYSIS OF VARIANCE SUMMARY TABLE FILE NSTT 4/ 1/16 16: :PAGE nang suat thuc thu cua cac dong nhan gen F-PROBABLIITY VALUES FOR EACH EFFECT IN THE MODEL SECTION - VARIATE NL NSTT GRADN MEAN (N= 201) NO OBS 201 2.0000 201 59.012 STADNARD DEVIATION C OF V |CT$ SD/MEAN | BASED ON BASED ON % | TOTAL SS RESID SS | 0.81854 1.0000 50.0 1.0000 6.6798 5.0463 8.6 0.0000 | | | | Năng suất lý thuyết dòng triển vọng BALANCED ANOVA FOR VARIATE NL FILE 6NSLT 25/ 1/17 6:15 :PAGE nang suat ly thuyet cac dong trien vong VARIATE V002 NL LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= CT$ 11 0.000000 0.000000 0.00 1.000 * RESIDUAL 24 32.0000 1.00000 * TOTAL (CORRECTED) 35 32.0000 680851 BALANCED ANOVA FOR VARIATE NSLT FILE 6NSLT 25/ 1/17 6:15 :PAGE nang suat ly thuyet cac dong trien vong VARIATE V003 NSLT LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= CT$ 11 10654.0 710.263 5.46 0.000 * RESIDUAL 24 4164.40 130.138 * TOTAL (CORRECTED) 35 14818.4 315.284 TABLE OF MEANS FOR FACTORIAL EFFECTS FILE 6NSLT 25/ 1/17 6:15 :PAGE nang suat ly thuyet cac dong trien vong 149 MEANS FOR EFFECT CT$ CT$ ĐC K1 K2 K3 K4 K5 K6 K7 K8 K9 K10 K11 NOS 3 3 3 3 3 3 NL 2.00000 2.00000 2.00000 2.00000 2.00000 2.00000 2.00000 2.00000 2.00000 2.00000 2.00000 2.00000 NSLT 74.7000 106.500 113.200 92.6000 86.6000 107.700 89.1000 115.500 101.500 107.200 83.8000 112.400 SE(N= 3) 0.577350 6.58629 5%LSD 24DF 1.66307 20.0219 ANALYSIS OF VARIANCE SUMMARY TABLE FILE 6NSLT 25/ 1/17 6:15 :PAGE nang suat ly thuyet cac dong trien vong F-PROBABLIITY VALUES FOR EACH EFFECT IN THE MODEL SECTION - VARIATE (N= 36) NL NSLT GRADN MEAN STADNARD DEVIATION SD/MEAN | NO BASED ON BASED ON OBS TOTAL SS RESID SS 36 2.0000 0.82514 1.0000 36 99.243 17.756 11.408 C OF V |CT$ | % | | 50.0 1.0000 11.2 0.0000 | | | Năng suất thực thu dòng triển vọng BALANCED ANOVA FOR VARIATE NL FILE 6NSTT 25/ 1/17 6:19 :PAGE nang suat thuc thu cac dong trien vong VARIATE V002 NL LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= CT$ 11 0.000000 0.000000 0.00 1.000 * RESIDUAL 24 32.0000 1.00000 * TOTAL (CORRECTED) 35 32.0000 680851 BALANCED ANOVA FOR VARIATE NSTT FILE 6NSTT 25/ 1/17 6:19 :PAGE nang suat thuc thu cac dong trien vong VARIATE V003 NSTT LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= CT$ 11 3635.19 242.346 3.42 0.002 * RESIDUAL 24 2267.64 70.8637 * TOTAL (CORRECTED) 35 5902.83 125.592 - 150 TABLE OF MEANS FOR FACTORIAL EFFECTS FILE 6NSTT 25/ 1/17 6:19 :PAGE nang suat thuc thu cac dong trien vong MEANS FOR EFFECT CT$ CT$ ĐC K1 K2 K3 K4 K5 K6 K7 K8 K9 K10 K11 NOS 3 3 3 3 3 3 NL 2.00000 2.00000 2.00000 2.00000 2.00000 2.00000 2.00000 2.00000 2.00000 2.00000 2.00000 2.00000 NSTT 54.8000 71.4000 72.3000 64.3000 60.7000 73.9000 61.8000 75.1000 70.4000 72.9000 55.7000 70.3000 SE(N= 3) 0.577350 4.86017 5%LSD 24DF 1.66307 13.4498 ANALYSIS OF VARIANCE SUMMARY TABLE FILE 6NSTT 25/ 1/17 6:19 :PAGE nang suat thuc thu cac dong trien vong F-PROBABLIITY VALUES FOR EACH EFFECT IN THE MODEL SECTION - VARIATE NL NSTT GRADN MEAN (N= 36) NO OBS 36 2.0000 36 62.415 STADNARD DEVIATION C OF V |CT$ SD/MEAN | BASED ON BASED ON % | TOTAL SS RESID SS | 0.82514 1.0000 50.0 1.0000 11.207 8.4181 10.7 0.0017 | | | | Năng suất lý thuyết dòng chọn lọc BALANCED ANOVA FOR VARIATE NL FILE 5NSLT 25/ 1/17 6:26 :PAGE nang suat ly thuyet cac dong trien vong VARIATE V002 NL LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= CT$ 0.000000 0.000000 0.00 1.000 * RESIDUAL 16 28.0000 1.00000 * TOTAL (CORRECTED) 23 28.0000 682927 BALANCED ANOVA FOR VARIATE NSLT FILE 5NSLT 25/ 1/17 6:26 :PAGE nang suat ly thuyet cac dong trien vong VARIATE V003 NSLT LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= 151 CT$ 3508.42 269.879 1.20 0.331 * RESIDUAL 16 6308.48 225.303 * TOTAL (CORRECTED) 23 9816.90 239.437 TABLE OF MEANS FOR FACTORIAL EFFECTS FILE 5NSLT 25/ 1/17 6:26 :PAGE nang suat ly thuyet cac dong trien vong MEANS FOR EFFECT CT$ CT ĐC K1 K2 K5 K7 K8 K9 K11 NOS 3 3 3 3 NL 2.00000 2.00000 2.00000 2.00000 2.00000 2.00000 2.00000 2.00000 NSLT 75.4000 108.700 110.300 107.000 96.8000 111.200 113.000 111.800 SE(N= 3) 0.577350 8.66608 5%LSD 16DF 1.67245 17.8037 ANALYSIS OF VARIANCE SUMMARY TABLE FILE 5NSLT 25/ 1/17 6:26 :PAGE nang suat ly thuyet cac dong trien vong F-PROBABLIITY VALUES FOR EACH EFFECT IN THE MODEL SECTION - VARIATE NL NSLT GRADN MEAN (N= 23) NO OBS 42 2.0000 42 98.026 STADNARD DEVIATION C OF V |CT$ SD/MEAN | BASED ON BASED ON % | TOTAL SS RESID SS | 0.82639 1.0000 50.0 1.0000 15.474 15.010 9.7 0.3307 | | | | Năng suất thực thu dòng chọn lọc BALANCED ANOVA FOR VARIATE NL FILE 5NSTT 25/ 1/17 6:29 :PAGE nang suat thuc thu cac dong chon loc VARIATE V002 NL LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= CT$ 0.000000 0.000000 0.00 1.000 * RESIDUAL 16 28.0000 1.00000 * TOTAL (CORRECTED) 23 28.0000 682927 BALANCED ANOVA FOR VARIATE NSTT FILE 5NSTT 25/ 1/17 6:29 :PAGE nang suat thuc thu cac dong chon loc VARIATE V003 NSTT LN SOURCE OF VARIATION DF SUMS OF SQUARES MEAN SQUARES F RATIO PROB ER LN 152 ============================================================================= CT$ 1032.04 79.3874 1.46 0.193 * RESIDUAL 16 1518.36 54.2271 * TOTAL (CORRECTED) 23 2550.40 62.2048 TABLE OF MEANS FOR FACTORIAL EFFECTS FILE 5NSTT 25/ 1/17 6:29 :PAGE nang suat thuc thu cac dong chon loc MEANS FOR EFFECT CT$ CT$ ĐC K1 K2 K5 K7 K8 K9 K11 NOS 3 3 3 3 NL 2.00000 2.00000 2.00000 2.00000 2.00000 2.00000 2.00000 2.00000 NSTT 57.7000 71.9000 73.2000 70.3000 62.7000 70.4000 72.9000 71.9000 SE(N= 3) 0.577350 4.25155 5%LSD 16DF 1.67245 10.8158 ANALYSIS OF VARIANCE SUMMARY TABLE FILE 5NSTT 25/ 1/17 6:29 :PAGE nang suat thuc thu cac dong chon loc F-PROBABLIITY VALUES FOR EACH EFFECT IN THE MODEL SECTION - VARIATE NL NSTT GRADN MEAN (N= 42) NO OBS 42 2.0000 42 64.806 STADNARD DEVIATION C OF V |CT$ SD/MEAN | BASED ON BASED ON % | TOTAL SS RESID SS | 0.82639 1.0000 50.0 1.0000 7.8870 7.3639 8.1 0.1926 | | | | 153 PHỤ LỤC 4: DANH SÁCH 156 CHỈ THỊ SÀNG LỌC ĐA HÌNH TRÊN 12 NST Trình tự mồi ngƣợc Vị trí (Mb) Nhiệt độ gắn mồi (oC) STT Tên thị 10 11 12 13 14 15 16 17 18 RM10916 CATCTCAAAGTCTCAAACCCTAGCC CTCGTGCTCCCTGTACCTACTCC 15,0 296 55 RM10136 GGTGGGACTGAGGCTTAATCG GTACACCGTGGTGAACAACTTGC 2,6 255 60 RM10965 AGCTCAAGGCCTCTAAACTCCTATCC GCAGACGATGAGGATCCATGC 16,3 81 60 RM10968 TCCTTCACCTCCGCCTCAAACC CCATGGAGACTAGGTGGAACTTGAGG 16,4 117 55 RM10986 TGGAGAGGAATGGGTGAGAAGC CCTCTACAGTCCTCCACCAGAGG 17,2 163 55 RM12038 AGACGCACGCAACATCACTCG GGGTATACCATACTCCCTCCGTTGC 39,2 384 55 RM11062 CCGAATCGTGGTGGTGTGAGC GCGAGCTCGATTCCTTGCTTCC 19,3 219 55 RM11504 TCGTCTTTGAGCCCACCATATTCG CGCACCAGCACCCTTGTATCC 27,8 281 55 RM11757 GCTTGTTGCCTGTGAACAGTAGC TGTCAGCATGCAACATCAATCC 33,4 598 55 RM11745 CTCCTACATGTCCACGATAACAGC AGGAGGGTGAGTGAATGTGTCC 33,2 196 60 RM11799 CCGTAGTATGTTACGGACATGAGG TGTTATGGCAGAGTGGTAGATGC 34,5 196 55 RM11847 TCTTCATTGCATTGCTGCTACG AACCAACCGTACTGTTTCTTCTCC 35,7 278 55 RM11438 GCACGGTTCTCTTTCTGTGATAGC TTTCGAAGACCGTAGTAGCAGTGG 26,5 175 60 RM7643 TCCTCCTATTCGGTCGAAAC ACCAACGAAATACCGGCAC 28,1 160 61 RM8094 AAGTTTGTACACATCGTATACA CGCGACCAGTACTACTACTA 11,2 209 55 RM8094A AAGTTTGTACACATCGTATACA CGCGACCAGTACTACTACTA 11,2 209 55 RM8094B AAGTTTGTACACATCGTATACA CGCGACCAGTACTACTACTA 11,2 209 55 RM10757 GGCGCTAGTTATGGTAGAGATTTCG AACAAATCTAGCGGCTGTTTCC 11,9 157 55 NST Trình tự mồi xuôi Sản phẩm PCR (bp) 154 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 RM10793 GACTTGCCAACTCCTTCAATTCG TCGTCGAGTAGCTTCCCTCTCTACC 12,6 123 60 RM10800 CGTACGCCCTCACATCACCTTTCC CTCTCCGGGAGCTCACTTGTCG 12,7 143 55 RM10825 GGACACAAGTCCATGATCCTATCC GTTTCCTTTCCATCCTTGTTGC 13,3 97 60 RM10829 TCATCCGTGGAGCAAGGAGAGG CCTAGCTAATTGGAGTCCGGGTTGG 13,3 122 60 RM10115 ACAAGACGAGGTAACACGCAAGC GCGAAGGATCAACGATGATATGG 2,1 245 60 RM10649 GACCAATATGGAGTGGTCTCTTGG ACGCTCCGCCTGCTATTTAGG 10,2 444 55 RM10681 CGAAGAGCAGCCACATAACAAGC TAGAGACGGTTGGGAGTTGTTGG 10,8 199 55 RM10694A TTTCCCTGGTTTCAAGCTTACG AGTACGGTACCTTGATGGTAGAAAGG 10,9 194 60 RM10694 TTTCCCTGGTTTCAAGCTTACG AGTACGGTACCTTGATGGTAGAAAGG 10,9 194 60 RM10720 GCAAACGTCTACGTGAGAAACAAGC GCATGTGGTGCCTTAACATTTGG 11,4 204 55 RM10741 AGGTCGCCTGAGTTTCATACCC TGTGCGGTTTAAGATAGAGTGAGC 11,6 195 55 RM10782 CTACTGATATGCCCGTACCAACG CCAAACTGGAGTAGTATTAGGTGTGG 12,4 201 55 RM10806 TTAGAGCGCCACTTAGCAGCTTGG TCTTTCTTCGCCTTTGTCGTTTCG 12,8 201 55 RM10815 CCACCCGCAACTCACTAGTCC ATCTAAAGTGACCCTGATCGAACG 13,1 207 55 RM10820 ACCCTAGCTAGCCACCATGAACC GAAAGCCCTTCTTTCTCCACTCTACC 13,2 263 55 RM8115 TATATAGTAAATTTGTTTGGTGTAGG ACAGATGGATATTATAAGAAGTAACA 12,6 112 55 RM7075 TATGGACTGGAGCAAACCTC GGCACAGCACCAATGTCTC 15,1 155 55 RM5461 GCCTCCCATATAAACCGGC AGCGAAGGGAACACGACAG 26,9 134 55 RM7278 GCTAGTCTGATGAATGCCG TTAGAACACCACATGGCAGC 1,8 175 55 RM3482 TTGTTGTCAAGCTACGGTGG CTGCTTCGTGATGTTGTTGG 39,7 101 55 RM3412b AAAGCAGGTTTTCCTCCTCC CCCATGTGCAATGTGTCTTC 11,5 211 55 RM3412a AAAGCAGGTTTTCCTCCTCC CCCATGTGCAATGTGTCTTC 11,5 211 55 RM3412 AAAGCAGGTTTTCCTCCTCC CCCATGTGCAATGTGTCTTC 11,5 211 55 RM5365 TCTGTTCGATGTTCCCATCG TAAACTCAAACAGGCTGGGC 14,5 180 55 155 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 RM493 TAGCTCCAACAGGATCGACC GTACGTAAACGCGGAAGGTG 12,3 211 55 RM1287 GTGAAGAAAGCATGGTAAATG CTCAGCTTGCTTGTGGTTAG 10,8 162 55 RM 1125 GGGGCCAGAGTTTTCTTCAG GTACGCGCAGAAAATGAGAG 20,5 147 50 RM449 TTGGGAGGTGTTGATAAGGC ACCACCAGCGTCTCTCTCTC 15,1 116 55 RM312 GTATGCATATTTGATAAGAG AAGTCACCGAGTTTACCTTC - 97 55 RM240 CCTTAATGGGTAGTGTGCAC TGTAACCATTCCTTCCATCC 31,4 132 55 RM1 GCGAAAACACAATGCAAAAA GCGTTGGTTGGACCTGAC 5,0 113 55 RM11229 TGACAGAAACAAAGCGGAAGG TCCAAACCGCTATTCTTGTAGC 22,3 393 55 RM11300 GGTGAGGGAGGTACCGAACTAGG AACTAGGGCGCTGGGAGAGG 23,8 492 55 RM207 CCATTCGTGAGAAGATCTGA CACCTCATCCTCGTAACGCC 35,3 118 55 RM6 GTCCCCTCCACCCAATTC CGTCTAGCGTTGGCTGCAC 29,5 163 55 RM425 CCAACGAAGATTCGAAGCTC CAGCACCATGAAGTCGCC 32,3 126 55 RM1243 TTTCGGGAGGGATTATGACC GTGACCCCCGATACAAACAC 3,5 157 50 RM526 CCCAAGCAATACGTCCCTAG ACCTGGTCATGACAAGGAGG 26,6 240 55 RM5356 AGAGCACTTGGAGTGAAGAGG AAGCGAGGGAGACAGATGC 9,4 152 61 RM7355 GAACCCACCCAAACAAACAC GCTTCGGTTTTTCGTGAGAG 7,1 193 55 RM12769 GAAGCAGAAGGCGTAACCTATCG CACAGCAGAAAGAGACACACAGC 7,2 163 55 RM13197 AAACCCTCCGGCTCATTCTTGC ACTCGAATCGTATCGGCTTGAGG 16,4 182 55 RM13155 TACCAACAGGGAGTTGTCTCTCG AGCGACGGTGTAAAGAATAAGTCG 15,2 478 55 RM148 ATACAACATTAGGGATGAGGCTGG TCCTTAAAGGTGGTGCAATGCGAG 35,6 129 55 RM282 CTGTGTCGAAAGGCTGCAC CAGTCCTGTGTTGCCAGCAAG 12,4 136 55 RM1164 CGTTTCTCCGAGAAAAGTCG CAAGGTGGTCGTTGAGGC 14,8 200 55 RM5480 AAGAAGAGGATTTCCTCGCC GTCCAAGATTTCGCAACGG 5,3 186 55 RM5548 TCAGCACTGATCGAACAATAGG GCAATGCTGAAATTCTCTGTGG 35,7 144 55 156 67 68 69 70 71 72 73 74 75 RM3297 CTCGTACTCCTCTTCCACCG GTAACCTAGCTGCCCCTTCC 13,2 163 55 RM3654 GAAGAGACATTGTAGGCGGC CCTCCTGCGATGGTCATC 8,8 112 61 RM7389 AGCGACGGATGCATGATC TTGAGCCGGAGGTAGTCTTG 36,1 111 55 RM7431 CGGGACTTCTCATAGGCATG ACTACTGGCTTCCCACAACG 19,5 145 55 RM1332 AACTACATGTATTGCAATGA AGAACACTCCAGATTATTTC 2,4 122 55 RM14795 GCGCGATAAACGTTTGAGAGAAGG AAATCAGTCGCGGTTGCTGTCC 10,3 160 55 RM14820 AGGTCGTCGATGTCCCTCTCC AAACCATCGTGGCATCATCTCC 10,8 189 55 RM16589 GTCCTTATCCCTACCCACGTCAACC CTCTTTGTCCACGCGCTAGAAGG 11,2 195 55 RM16820 CCCTGCACCTGGATTCTCTCTCC 18,4 173 55 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 RM17391 ACTTTGCTCTGAACTTGCAGTGG ATTGACGCCACAGACAAGAACAAGA CG GTCAGCTGCTATCAGGATTCACG 29.3 175 60 RM17411 ACATCCCACACATTCACAATCTGC GAGTCCTGTTGGCTAGACTTTCAGC 29,8 168 60 RM3333 GAAGCAAAAGCTATCGACAC GAGCTTGTTGGCACCTTAC 34,7 201 55 RM537 CCGTCCCTCTCTCTCCTTTC ACAGGGAAACCATCCTCCTC 0,2 236 55 RM344 CAGAGACAATAGTCCCTGCAC GTAGGAGGAGATGGATGATGG 9,8 163 55 RM551 AGCCCAGACTAGCATGATTG GAAGGCGAGAAGGATCACAG 0,17 192 55 RM335 GTACACACCCACATCGAGAAG GCTCTATGCGAGTATCCATGG 0,7 104 55 RM349 TTGCCATTCGCGTGGAGGCGC GTCCATCATCCCTATGGTCG 32,5 136 55 RM280 ACACGATCCACTTGCGC TGTGTCTTGAGCAGCCAGG 34,9 155 RM31 GATCACGATCCACTGGAGCT AAGTCCATTACTCTCCTCCC 28,6 140 55 RM249 GGCGTAAAGGTTTTGCATGT ATGATGCCATGAAGGTCAGC 10,7 121 55 RM334 GTTCAGTGTTCAGTGCCACC GACTTTGATCTTTGGTGGACG - 182 55 RM3215 CGGCGTAGCTAAATTTGGAC ATGGCGAGCAAGGAAGTAAG 8,5 197 55 RM3327 CGGGAGAACCGAGCAATC TCGAGTGTCGAGACATCCAC 22,4 135 61 RM7027 AGGACCTGGACTTTATGGGC CCTGCACTGCTCCACAGTAC 15,8 85 55 157 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 RM19034 CTTCAACCTCCGGCAAGTAATGG CAAGCAACCCGCTATTCTCACC 26,7 120 55 RM19199 GCTCTACCAGGTATTATAGCCGATCC AACTCCTCCAAGGTTCCATAGCC 29 158 55 RM18161 GAAGGCCTGAATAGTAGGATGG GATACCCATGGATAATGCTTGC 8,1 357 60 RM3 ACACTGTAGCGGCCACTG CCTCCACTGCTCCACATCTT 19,5 145 55 RM345 ATTGGTAGCTCAATGCAAGC GTGCAACAACCCCACATG 30,8 167 55 RM564 ATGCAGAGGATTGGCTTGAG ATGCAGAGGATTGGCTTGAG 11,8 228 55 RM494 GGGAGGGGATCGAGATAGAC TTTAACCTTCCTTCCGCTCC 31 203 55 RM527 GGCTCGATCTAGAAAATCCG TTGCACAGGTTGCGATAGAAG 9,8 233 55 RM528 GGCATCCAATTTTACCCCTC AAATGGGAGCATGGAGGTCAC 26,5 232 55 RM7434 GGAGGAAAGGTTGGAGAAGG TTTCCCGTATTCCATGAGCC 23,9 143 50 RM19238 GACTGGGAGGATGAAAGAGATGG AGGTCAGTCGCTGTTCTCTTACG 0,29 168 55 RM20163 CCATCGAGGAAACCAAAGTAAAGG TTCTCACGCACCTTAGTCAATGG 19,7 183 55 RM20192 CACTCGATTCACCCAGATCC TTATCCCCTCCTCTTTAGGC 20,3 208 55 RM19545 TAGTTGGGTGGAAATGGTCATCC TAAGACGAGTGGTCACACAGTGC 5,0 465 55 RM19840 TTATACACAGATGACGCACACG TGGGTTAAGGGACACACTTAGG 10,8 254 60 RM20019 GGTTAGAGGTGGCCTGGGTAGG CTGGCAATCCAGTGATAGTGAGC 15,7 246 55 RM21539 GCCCAACTACTTCGACAGCTTCC CAATGACCTGAGTAGCATCCAAGG 16,5 394 55 RM20848 AAAGTGGGCACTGAGATACAACG AGCGAAGGCAGTGAAGTTTCG 0,8 610 55 RM21584 CACCGTGAGGAGCCTACCATTCC TAAGGCCAGGGAGGAGCAGTGG 17,4 187 55 RM21645 GCACGGACAGGTCCAGAAGAGC ATCGCCCTAGCGAAATCAGAAATCC 18,8 168 55 RM21471 TCTTGCCATCACATAGCAACAGG ACTCGGTGAGCATCCAATGTCC 14,6 160 60 RM7338 CTTATCTCTCGGCAAGCAGC CTCACACGCATGGATCAATC 15,4 164 55 RM3635 CGTGAGAGCGTGAGAGACAG ACTTTGGTGTTCCCTCCCTC 11,0 109 55 RM3753 GAATGAGCTAAGAACACGCC CTGATGGCCCAAGACTTTTG 23,6 119 50 158 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 RM320 CAACGTGATCGAGGATGATC GATTTGCTTACCACAGTC 18,7 167 55 RM487 CAGCTGGGGAAGAGAGAGAG TCAGAAACTAAACGCACCCC 25,9 205 55 RM11 TCTCCTCTTCCCCCGATC ATAGCGGGCGAGGCTTAG 19,2 140 55 RM125 ATCAGCAGCCATGGCAGCGACC AGGGGATCATGTGCCGAAGGCC - 127 55 RM248 TCCTTGTGAAATCTGGTCCC GTAGCCTAGCATGGTGCATG 29,3 102 55 RM210 TCACATTCGGTGGCATTG CGAGGATGGTTGTTCACTTG 22,5 140 55 RM80 TTGAAGGCGCTGAAGGAG CATCAACCTCGTCTTCACCG 24,5 142 55 RM447 CCCTTGTGCTGTCTCCTCTC ACGGGCTTCTTCTCCTTCTC 26,5 111 55 RM331 GAACCAGAGGACAAAAATGC CATCATCACTTTGCAGCCAG 12,3 176 55 RM22825 AGCACATCACAAACCTACCCTACC CCTAATTAATCCCGCGGAACC 11,7 160 55 RM23060 CAGCAGCTGCCTCAGTGTCACC AACGTTGTCGGTGAAGGTCCATCC 19,2 126 55 RM22786 CAAAGAGGATCGAGATGCTCACC CCTATGATCTGACGCCCTTCTCC 11,1 184 60 RM22897 AGAGAGGAGCGACAGGGAGGAAGG TGGCCCAAGTCGGCTTAGATGC 14,7 372 55 RM22870 CCCGGTAGTAGTGGGTTATGTCC CTAGTCGCCCTGAGAAGAAGACC 13,9 248 55 RM23654 CTCCGATGCCTTCTTCCTCTTGC AAAGGGAGTAGCAAGCCGAGTGG 0,1 186 60 RM7175 ACAGTAAACGTGGTGCCTCC AGAAGTAGCCTCGAGGACCC 16,8 105 55 RM1026 GCCTCTGGCAGAATAGCATC TATCACTTTGCTGCCTAGGC 22,6 194 55 RM105 GTCGTCGACCCATCGGAGCCAC TGGTCGAGGTGGGGATCGGGTC 2,0 134 55 RM296 CACATGGCACCAACCTCC GCCAAGTCATTCACTACTCTGG 4,61 123 55 RM311 10 TGGTAGTATAGGTACTAAACAT TCCTATACACATACAAACATAC 9,5 179 55 RM333 10 GTACGACTACGAGTGTCACCAA GTCTTCGCGATCACTCGC 22,1 191 55 RM5392 10 GCCGTCTACCTCATGGTCAC CCATAACCGTGGTGTTTGAG 17,3 149 55 RM3628 10 AATCATGCCTAGAGCATCGG GTTCAACATGGGTGCAGATG 23,7 126 55 RM25181 10 AAAGAGCTTCCCTAATGGCTTCG GAGAGAATGACCTCTCCCAAGACC 8,8 162 55 159 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 RM25271 10 AGACGCTACTCCCACCTGTAACC ATATCATTGCCGCAACACAAGC 11,2 185 55 RM24865 10 TTGAGTGAGGAGACTATCTGTACG TTGTTTGGTCAGAGTAGCTTGG 0,15 195 55 RM25022 10 ACATTCCGCGTTTGTGTGTAGC GCTTGGTAGTTGGGCTGATGG 3,6 225 60 RM25955 11 TTGGAGGGAGTAGTGTGTATGC CACCTATCAGTAAACGGTACAGC 0,2 152 55 RM25972 11 GCGAGTCACCAAGACGATAGACAGC CTCCTCCTCAAGCTCCTCCTTCC 0,4 263 55 RM7283 11 GGGGCATATAACGCAAACAC ATTTTAGGAGGCTCACGTGG 9,1 183 55 RM3625 11 CTTGCAATTCAATTGCTTAC GGTGGCCTAGTGAAACTAAA 6,6 143 55 RM3137 11 GTTAGGAATTCCATGCTGCG TGCCCGTGCTCGATAAGG 6,1 197 61 RM341 11 CAAGAAACCTCAATCCGAGC CTCCTCCCGATCCCAATC 20 172 55 RM1124 11 AAGCTATCCCCCTTTTTGGC AGGGATCGGTAGACCCAATC 3,8 180 55 RM287 11 TTCCCTGTTAAGAGAGAAATC GTGTATTTGGTGAAAGCAAC 16,7 118 55 RM209 11 ATATGAGTTGCTGTCGTGCG CAACTTGCATCCTCCCCTCC 17,7 134 55 RM206 11 CCCATGCGTTTAACTATTCT CGTTCCATCGATCCGTATGG 22 147 55 RM247 12 TAGTGCCGATCGATGTAACG CATCTGGTTTTGACAAAGCG 3,1 131 55 RM1194 12 GTGGAGATTGGAGAGAAGCG AATACGCTCTCTGTCCCTGC 25,8 170 55 RM1208 12 GCAGGGGACACGAGATTTC TGTGCTCTGCTTGGAGAGTG 1,0 187 55 RM7102 12 TTGAGAGCGTTTTTAGGATG TCGGTTTACTTGGTTACTCG 13,2 169 55 RM7558 12 CAGTAGCAGGCTCCCTTTTG ATCAGGAACACCAGAGACGG 27,0 149 55 160 ... nay, thị phân tử ADN đƣợc sử dụng phổ biến [8] * Chỉ thị phân tử Chỉ thị phân tử thị có chất đa hình ADN Chỉ thị phân tử đƣợc định nghĩa nhƣ đoạn ADN đặc hiệu, biểu khác biệt mức độ phân tử hệ... NGHIỆP VIỆT NAM NGUYỄN THỊ THÚY ANH NGHIÊN CỨU CẢI TIẾN NĂNG SUẤT MỘT SỐ DÒNG/GIỐNG LÚA BẰNG CHỈ THỊ PHÂN TỬ Chuyên ngành: Công nghệ sinh học Mã số: 42 02 01 LUẬN ÁN TIẾN SĨ NÔNG NGHIỆP Người... trạng suất 17 1.2.3 Ứng dụng thị phân tử cải tiến suất lúa 29 1.3 Nghiên cứu ứng dụng thị phân tử chọn tạo giống lúa Việt Nam 40 CHƢƠNG VẬT LIỆU, NỘI DUNG VÀ PHƢƠNG PHÁP NGHIÊN CỨU
- Xem thêm -

Xem thêm: Nghiên cứu cải tiến năng suất một số dònggiống lúa bằng chỉ thị phân tử, Nghiên cứu cải tiến năng suất một số dònggiống lúa bằng chỉ thị phân tử

Từ khóa liên quan

Gợi ý tài liệu liên quan cho bạn

Nhận lời giải ngay chưa đến 10 phút Đăng bài tập ngay