Nghiên cứu sử dụng hệ xúc tác tế bào e coli tái tổ hợp dựa trên hệ thống cyp264b1 để chuyển hóa một số hợp chất sesquiterpene

112 6 0
  • Loading ...
1/112 trang
Tải xuống

Thông tin tài liệu

Ngày đăng: 05/11/2018, 06:20

ĐẠI HỌC THÁI NGUYÊN TRƯỜNG ĐẠI HỌC KHOA HỌC - TRẦN THỊ MAI NGHIÊN CỨU SỬ DỤNG HỆ XÚC TÁC TẾ BÀO E.COLI TÁI TỔ HỢP DỰA TRÊN HỆ THỐNG CYP264B1 ĐỂ CHUYỂN HÓA MỘT SỐ HỢP CHẤT SESQUITERPENE LUẬN VĂN THẠC SĨ CÔNG NGHỆ SINH HỌC THÁI NGUYÊN - 2015 Số hóa Trung tâm Học liệu – ĐHTN http://www.lrc.tnu.edu.vn ĐẠI HỌC THÁI NGUYÊN TRƯỜNG ĐẠI HỌC KHOA HỌC - TRẦN THỊ MAI NGHIÊN CỨU SỬ DỤNG HỆ XÚC TÁC TẾ BÀO E.COLI TÁI TỔ HỢP DỰA TRÊN HỆ THỐNG CYP264B1 ĐỂ CHUYỂN HÓA MỘT SỐ HỢP CHẤT SESQUITERPENE Chuyên ngành: Công nghệ sinh học Mã số: 60420201 LUẬN VĂN THẠC SĨ CÔNG NGHỆ SINH HỌC NGƯỜI HƯỚNG DẪN KHOA HỌC: TS LÝ THỊ BÍCH THỦY THÁI NGUYÊN - 2015 Số hóa Trung tâm Học liệu – ĐHTN http://www.lrc.tnu.edu.vn LỜI CAM ĐOAN Tôi xin cam đoan kết nghiên cứu tơi nhóm cộng nghiên cứu phòng Sinh hóa thực vật – Viện Công nghệ sinh học – Viện Hàn lâm Khoa học Công nghệ Việt Nam thực từ tháng năm 2014 đến tháng năm 2015 Thái Nguyên, ngày… tháng … năm 201… Học viên Trần Thị Mai Số hóa Trung tâm Học liệu – ĐHTN http://www.lrc.tnu.edu.vn LỜI CẢM ƠN Để hồn thành luận văn này, tơi xin bày tỏ lòng biết ơn sâu sắc đến TS Lý Thị Bích Thủy – Nghiên cứu viên phòng Sinh hóa thực vật – Viên Công nghệ sinh học – Viện Hàn lâm Khoa học Công nghệ Việt Nam định hướng nghiên cứu, hướng dẫn tạo điều kiện kinh phí, hóa chất thiết bị suốt thời gian tơi thực luận văn phòng Tơi xin chân thành cảm ơn CN Đoàn Hữu Thanh chú, anh chị cán phòng Sinh hóa thực vật – Viện Cơng nghệ sinh học – Viện Hàn lâm Khoa học Công Nghệ Việt Nam nhiệt tình hướng dẫn, giúp đỡ đóng góp nhiều ý kiến q báu để tơi hồn thành luận văn Tôi xin cảm ơn PGS.TS Nguyễn Vũ Thanh Thanh thầy cô giáo nhà trường Đại học Khoa học – Đại học Thái Nguyên, thầy cô Viện Công nghệ sinh học – Viện Hàn lâm Khoa học Công nghệ Việt Nam tạo điều kiện thuận lợi cho tơi suốt q trình học tập Tôi xin cảm ơn Quỹ phát triển khoa học công nghệ quốc gia (NAFOSTED) cung cấp kinh phí để chúng tơi thực nghiên cứu đề tài mã số 106-NN.02-2013.57 Cuối cùng, xin bày tỏ lòng biết ơn sâu sắc tới gia đình bạn bè người ln bên tơi, động viên góp ý cho tơi suốt q trình học tập thực luận văn Bằng lòng biết ơn sâu sắc tơi xin chân thành cảm ơn! Thái Nguyên, ngày… tháng … năm 201… Học viên Trần Thị Mai Số hóa Trung tâm Học liệu – ĐHTN http://www.lrc.tnu.edu.vn CÁC TỪ VIẾT TẮT Chữ viết tắt Giải thích µg Micro gram µM Micromol µl Microlit AdR Adrenodoxin reductase Adx Adrenodoxin APS Amonium persulphate bp Base pair CYP Cytochrome P450 CPR Cytochrcome P450 reductase DNA Deoxyribonucleic acid dNTP Deoxyribonucleotide triphosphate FAD Flavin adenin dinucleotid Fdx Ferredoxin FdR Ferredoxin reductase Fldx Flavodoxin FMN Flavin mononucleotide GCMS Gas chromatography mass spectometry HPLC High pressure liquid chromatography IPTG Isopropyl-beta-D-thiogalactopyranoside kDa Kilo dalton KppG Kali phosphate glycerol LB Lysogeny broth Số hóa Trung tâm Học liệu – ĐHTN http://www.lrc.tnu.edu.vn NMR Nuclear Magnetic Resonance NADH Nicotinamide adenine dinucleotide NADPH Nicotinamide adenine dinucleotide phosphate PCB Polychlorinate biphenyl PCR Polymerase chain reaction SDS – PAGE Sodium dodecyl sulphate – polyacrylamide gel electrophoresis TB Terrific Broth TLC Thin layer chromatography v/p Vòng/phút Số hóa Trung tâm Học liệu – ĐHTN http://www.lrc.tnu.edu.vn MỤC LỤC LỜI CAM ĐOAN i LỜI CẢM ƠN II MỤC LỤC .V DANH MỤC CÁC HÌNH VII DANH MỤC CÁC BẢNG IX MỞ ĐẦU .1 CHƯƠNG TỔNG QUAN TÀI LIỆU 1.1 Cytochrome P450 1.1.1 Định nghĩa phân loại 1.1.2 Cấu trúc cytochrome P450 1.1.3 Cơ chế xúc tác cytochrome P450 1.1.4 Ứng dụng cytochrome P450 1.2 Nghiên cứu CYP264B1 10 1.3 Hợp chất sesquiterpene 13 1.3.1 Định nghĩa nguồn gốc 13 1.3.2 Phân loại sesquiterpene 13 1.3.3 Vai trò ứng dụng sesquiterpene 15 1.4 Hệ xúc tác tế bào E coli tái tổ hợp dựa hệ thống cytochrome P450 16 1.5 Tình hình nghiên cứu ứng dụng hệ xúc tác tế bào để chuyển hóa sesquiterpene giới Việt Nam 19 CHƯƠNG VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 20 Vật liệu nghiên cứu 20 2.1.1 Vật liệu 20 2.1.2 Thiết bị thí nghiệm 21 2.1.3 Hóa chất 22 2.1.4 Dung dịch đệm 22 2.1.5 Môi trường 23 2.2 Phương pháp nghiên cứu 24 Số hóa Trung tâm Học liệu – ĐHTN http://www.lrc.tnu.edu.vn 2.2.1 Nuôi cấy E.coli 24 2.2.2 Biến nạp plasmid tái tổ hợp vào tế bào E.coli phương pháp sốc Số hóa Trung tâm Học liệu – ĐHTN http://www.lrc.tnu.edu.vn nhiệt 24 2.2.3 Kiểm tra có mặt gene CYP264B1, AdR Adx 25 2.2.4 Kiểm tra khả biểu gene 27 2.2.5 Kiểm tra khả chuyển hóa nootkatone 30 2.2.6 Xác định điều kiện chuyển hóa nootkatone tối ưu 30 2.2.7 Chuyển hóa số hợp chất sesquiterpene 32 CHƯƠNG 3: KẾT QUẢ VÀ THẢO LUẬN 34 3.1 Nhân dòng plasmid pETC4AA kiểm tra có mặt gene mã hóa CYP264B1, AdR Adx 34 3.2 Kiểm tra khả biểu gene 35 3.2.1 Khả biểu gene CYP264B1 35 3.2.2 Khả biểu Adx 36 3.3 Kiểm tra khả chuyển hóa nootkatone hệ xúc tác tế bào C43DE3/CYP264B1-AdR-Adx 38 3.4 Xác định điều kiện chuyển hóa nootkatone tối ưu 39 3.4.1 Nghiên cứu ảnh hưởng mơi trường lên khả chuyển hóa chất 39 3.4.2 Ảnh hưởng mật độ tế bào lên khả chuyển hóa chất 41 3.4.3 Ảnh hưởng nhiệt độ đến khả chuyển hóa chất 42 3.4.4 Ảnh hưởng tốc độ lắc đến khả chuyển hóa chất 44 3.4.5 Lựa chọn nồng độ chất thích hợp để chuyển hóa 45 3.5 Sử dụng hệ xúc tác tế bào C43DE3/pETC4AA để chuyển hóa số hợp chất sesquiterpene 47 3.5.1 Kết chuyển hóa longipinene 48 3.5.2 Kết chuyển hóa isolongifolene 50 Số hóa Trung tâm Học liệu – ĐHTN http://www.lrc.tnu.edu.vn 3.5.3 Tinh nhận dạng sản phẩm chuyển hóa 51 KẾT LUẬN VÀ ĐỀ XUẤT 54 TÀI LIỆU THAM KHẢO 55 PHỤ LỤC 60 Số hóa Trung tâm Học liệu – ĐHTN http://www.lrc.tnu.edu.vn Đối với chuyển hóa isolongifolene, lượng sản phẩm thu sau tinh 61 chưa đủ để phân tích NMR (dưới mg) Nguyên nhân trình tinh chưa tối ưu, dẫn đến lượng sản phẩm bị nhiều sau q trình Hiện nay, chúng tơi tiến hành tinh để nhận dạng sản phẩm chuyển hóa isolongifolene NMR 62 KẾT LUẬN VÀ ĐỀ NGHỊ KẾT LUẬ N Qua thí nghiệm trình bày trên, đề tài rút số kết luận sau: Điều kiện để hệ xúc tác tế bào C43DE3/pETC4AA hoạt động tối ưu - Môi trường biểu hiện: TB - Mơi trường chuyển hóa: KppG - Mật độ tế bào: 20 g/l o - Nhiệt độ biểu chuyển hóa chất: 30 C - Tốc độ lắc: 180 v/p - Nồng độ chất: 200 µM Sử dụng thành công hệ xúc tác tế bào E.coli C43DE3/pETC4AA để chuyển hóa hợp chất sesquiterpenes longipinene isolongifolene K ết chuyển hóa hợp chất cho thấy chúng chuyển hóa thành sản phẩm Tinh xác định cấu trúc sản phẩm chuyển hóa longipinene phương pháp NMR, sản phẩm có cơng thức phân tử C15H24O nhận dạng 15-OH-longipinene Đã tinh sản phẩm chuyển hóa isolongifolene, sản phẩm có độ tương đồng cao (89%) với 9-hydoxy isolongifolene, có cơng thức phân tử C15H24O Sản phẩm tiếp tục chuyển hóa tinh để gửi phân tích phương pháp NMR ĐỀ NGHỊ Tiếp tục tinh để nhận dạng sản phẩm chuyển hóa isolongifolene Chúng tơi gợi ý thêm số sesquiterpene thú vị có hàm lượng cao hoạt tính dược học tinh dầu để chuyển hóa hệ xúc tác tế bào C43DE3/pETC4AA như: caryophyllene (chiếm 19,22% tinh dầu ngải cứu); selinene (chiếm 68,54% tinh dầu cúc tần); curcumen có dầu nghệ, có tác dụng diệt khuẩn, làm vết thương chóng thành sẹo, chữa loét tá tràng; zingiberen thành phần chủ yếu dầu gừng Đánh giá so sánh hoạt tính sinh học sesquiterpene sản phẩm chuyển hóa chúng qua khả chống xi hóa, kháng viêm, kháng khuẩn… 63 TÀI LIỆU THAM KHẢO Tài liệu tiếng việt Đào Hùng Cường Huỳnh Thị Thanh Hương (2009), “Nghiên cứu xác định thành phần terpenoid tinh dầu rái Đại Lộc – Quảng Nam”, Tạp ch hoa học Công nghệ, Đại học Đà Nẵng 6(35) Nguyễn Thị Ngọc Dao (2011), Cytochrome – P450, NXB Khoa học tự nhiên Công nghệ Hà Nội, 17-41, 167-185 Nguyễn Thị Ngọc Dao, Đái Duy Ban, Nguyễn Thị Bích Nhi (1985), “Tách chiết làm phần cytochrome P450”, Báo cáo nghiên cứu khoa học – Trung tâm Sinh lý Hóa sinh Người Động vật – Viện Khoa học Việt Nam 1975-1985, Hà Nội, 370-374 Nguyễn Văn Tuyến, Trần Văn Lộc, Nguyễn Đức Vinh, Đặng Thị Tuyết Anh Trần Văn Sung (2012), “Nghiên cứu tổng hợp sesquitecpen lacton thuộc khung pseudoguainolide với hệ vòng -lacton -metyl”, Tạp chí Hóa học 50 (4B):83-86 Tài liệu tiếng anh Bar R (1989), “Cyclodextrin aided bioconversions and fermentations”, Trends Biotechnol 7:2– Bernhardt R (1996), “Cytochrome P450 : structure, function, and generation of reative oxygen species”, Rev Physiol Biochem Pharmacol, 127, pp, 137-221 Bernhardt R (2006), “Cytochromes P450 as versatile biocatalysts”, J Biotechnol.124:128-145 Chu SS, Jiang GH, Liu ZL (2011), Insecticidal compounds from the essential oil of Chinese medicinal herb Atractylodes chinensis, Pest Manag Sci 67:1253-1257 Denisov IG, Makris TM, Sligar SG, and Schlichting I (2005), “Structure and chemistry of cytochrome P450”, Chem Rev 105:2253–2278 10 Ewen KM, Hannemann F, Khatri Y, Perlova O, Kappl R, Krug D, Hüttermann J, Müller R, Bernhardt R (2009), “Genome mining in Sorangium cellulosum So ce56: identification and characterization of the homologous electron transfer proteins of a myxobacterial cytochrome P450”, J Biol Chem 284:28590–28598 64 11 Fraga BM (2006), “Natural sesquiterpenoids”, Nat Prod Rep 23:943–72 65 12 Gabriela Paun, Saadia Zrira, Amale Boutakiout, Oana Ungureanu, Demetra Simion, Ciprian Chelaru and Gabriel Lucian Radu (2013), “Chemical composition, antioxidant and antibacterial activity of essential oils from moroccan aromatic herbs”, Rev Roum Chim., 58(11-12), 891-897 13 Hannemann F, Bichet A, Ewen KM, Bernhardt R (2007), “Cytochrome P450 systems-biological variations of electron transport chains”, Biochim Biophys Acta, 1770(3):330-44 14 Imai M, Shimada H, Watanabe Y, Matsushima-Hibiya Y, Makino R, Koga H, Horiuchi T and Ishimura Y (1989), “Uncoupling of the cytochrome P-450cam monooxygenase reaction by a single”, Proc Natl Acad Sci USA 86:7823–7827 15 Jörg Degenhardt, Tobias G Köllner, Jonathan Gershenzon (2009), Monoterpene and sesquiterpene synthases and the origin of terpene skeletal diversity in plants, Phytochemistry, 1621-1637 16 Khatri Y, Hannemann F, Perlova O, Müller R, Bernhardt R (2011), “Investigation of cytochromes P450 in myxobacteria: excavation of cytochromes P450 from the genome of Sorangium cellulosum So ce56”, FEBS Lett, 585:1506– 1513 17 Kimata Y, Shimada H, Hirose T, Ishimura Y (1995), “Role of Thr-252 in cytochrome P450cam: a study with unnatural amino acid mutagenesis”, Biochem Biophys Res Commun 208:96–102 18 Kowsalya Rangasamy and Elangovan Namasivayam (2014), “In vitro Antioxidant and Free Radical Scavengin Activity of Isolongifolene”, Asian Journal of Biological Science Doi: 10.3923/ajbs.2014 19 Laemmli UK (1970), “Cleavage of structural proteins during the assembly of the head of bacteriophage T4”, Nature, 1970;227:680–5 20 Lamb DC, Lei L, Warrilow AG, Lepesheva GI, Mullins JG, Waterman MR and Kelly SL (2009), “The first virally encoded cytochrome P450”, J Virol 83:8266– 8269 21 Larsen KL (2002), “Large cyclodextrins”, J Inclusion Phenom Macro 43:1–13 66 22 Legault J and Pichette A (2007), “Potentiating effect of beta-caryophyllene on 67 anticancer activity of alpha-humulene, isocaryophyllene and paclitaxel”, J Pharm Pharmacol 59(12):1643-7 23 Liu Q, Majdi M, Cankar K, Goedbloed M, Charnikhova T, Verstappen FW, de Vos RC, Beekwilder J, van der Krol S, Bouwmeester HJ (2011), “Reconstitution of the costunolide biosynthetic pathway in yeast and Nicotiana benthamiana”, PLoS One 6(8):e23255 24 Loeber DE, Russell SW, Toube TP, Weedon BCL, and Diment J (1971), “Carotenoids and related compounds Part XXVIII Syntheses of zeaxanthin, βcryptoxanthin, and zeinoxanthin ( -cryptoxanthin)”, J Chem Soc 404–408 25 Luo DQ, Wang F, Bian XY, Liu JK (2005), “Rufuslactone, a New Antifungal Sesquiterpene from the Fruiting Bodies of the Basidiomycete Lactarius rufus”, J Antibiot 58(7): 456-459 26 Ly TT, Khatri Y, Zapp J, Hutter MC, Bernhardt R (2012), “CYP264B1 from Sorangium cellulosum So ce56: a fascinating norisoprenoid and sesquiterpene hydroxylase” Appl Microbiol Biotechnol 95(1):123-33 27 Mahato SB, Garai S (1997), Advances in microbial steroid biotransformation, Steroids 62:332–45 28 Mansuy D (1998), The great diversity of reactions catalyzed by cytochromes P450, Comp Biochem Physiol C Pharmacol Toxicol Endocrinol 121:5–14 29 Martinis SA, Atkins WM, Stayton PS, Sligar SG (1989), “A conserved residue of cytochrome P450 is involved in heme-oxygen stability and activation”, J Am Chem Soc 111:9252–9253 30 Másson M, Loftssona T , Mássonb G, Stefánsson E (1999), “Cyclodextrins as permeation enhancers: some theoretical evaluations and in vitro testing”, Journal of Controlled Release 59:107–118 31 McGarvey DJ and Croteau R (1995), Terpenoid Metabolism, The Plant Cell 7:1015–1026 32 Munoz-Botella S, del Castillo B, Martin MA (1995), Cyclodetrin properties and applications of inclusion complex formation, Ars Pharm 36:187–98 68 33 Nelson D.R (2009), The cytochroem P450 homepage, Hum Genomics, 4(1), 69 pp, 59-65 34 Nonaka Y, Murakami H, Yabusaki Y, Kuramitsu S, Kagamiyama H, Yamano T, Okamoto M (1987), Molecular cloning and sequence analysis of full-length cDNA for mRNA of adrenodoxin oxidoreductase from bovine adrenal cortex, Biochem Biophys Res Commun 1987 Jun 30;145(3):1239-47 35 Omura T and Sato R (1964), “The Carbon Monoxide-Binding Pigment of Liver Microsomes”, Ii Solubilization, Purification, and Properties J Biol Chem 239:2379–85 36 Pylypenko O, Schlichting I (2004), “Structural aspects of ligand binding to and electron transfer in bacterial and fungal P450s”, Annu Rev Biochem 73:991–1018 37 Ringle M, Khatri Y, Zapp J, Hannemann F, Bernhardt R (2012), “Application of a new versatile electron transfer system for cytochrome P450-based Escherichia coli whole-cell bioconversions”, Appl Microbiol Biotechnol 2012 Dec 20 38 Sahdev S, Khattar SK, and Saini KS (2008), Production of active eukaryotic proteins through bacterial expression systems: A review of the existing biotechnology strategies, Mol Cell Biochem 307:249–264 39 Sakaki T (2012), Practical Application of Cytochrome P450 Biol, Pharm Bull 35(6) 844–849 40 Shirano Y and Shibata D (1990), Low temperature cultivation of Escherichia coli carrying a rice lipoxygenase L-2 cDNA produces a soluble and active enzyme at a high level, FEBS Lett 271:128–130 41 Singer Y, Shity H, and Bar R (1991), Microbial transformations in a cyclodextrin medium Part Reduction of androstenedione to testosterone by Saccharomyces cerevisiae Appi Microbiol Biotechnol 35:731–737 42 Singh M, Sharma R, Banerjee UC (2002), Biotechnological applications of cyclodextrins, Biotechnology Advances 20:341–359 43 Szejtli J (1998), “Introduction and General Overview of Cyclodextrin Chemistry”, Chem Rev 98:1743–1753 44 Takahashi S, Yeo YS, Zhao Y, O'Maille PE, Greenhagene BT, Noel JP, Coates RM, Chappell J (2007), “Functional characterization of premnaspirodiene 70 oxygenease, a cytochrome P450 catalyzing regio- and stereo-specifc hydroxylations of diverse sesquiterpene substrates” J Biol Chem 282(43):3174454 45 Urlacher VB, Lutz-Wahl S, Schmid RD (2004), “Microbial P450 enzymes in biotechnology”, Appl Microbiol Biotechnol 64:317–325 46 Urlacher VB, Girhard M (2012), Cytochrome P450 monooxygenases: an update on perspectives for synthetic application, Trends Biotechnol 30(1):26-36 47 Urlacher VB, Makhsumkhanov A, Schmid RD (2006), Biotransformation of betaionone by engineered cytochrome P450 BM-3, Appl Microbiol Biotechnol 70:53–9 48 Volonte F, Marinelli F, Gastaldo L, Sacchi S, Pilone MS, Pollegioni L, and Molla G (2008), Optimization of glutaryl-7- aminocephalosporanic acid acylase expression in E.coli, Protein Expr Purif 61:131–137 49 Walton AZ, Stewart JD (2004), Understanding and Improving NADPHDependent Reactions by NongrowingEscherichia coliCells, Biotechnol Prog 2004;20:403–11 50 Yu F, Okamoto S, Harada H, Yamasaki K, Misawa N, Utsumi R (2011), Zingiber zerumbet CYP71BA1 catalyzes the conversion of α-humulene to 8hydroxy-α humulene in zerumbone biosynthesis, Cell Mol Life Sci 68:1033– 1040 51 Zhao B, Lin X, Lei L, Lamb DC, Kelly SL, Waterman MR, Cane DE (2008), Biosynthesis of the sesquiterpene antibiotic albaflavenone in Streptomyces coelicolor A3(2), J Biol Chem 283(13):8183-9 71 PHỤ LỤC I Vector pET17b II Trình tự gene mã hóa cho CYP264B1, AdR Adx Trình t gene mã hóa cho CYP264B1 atgggcactcaagaacaaaccccccagatctgtgtggtgggcagtggcccagctggcttttacacggcccagcacctg ctaaagcaccactcccgggcccacgtggatatctacgagaaacagctggtgcccttcggcctggtgcgctttggcgtgg cgcctgaccaccccgaggtcaagaatgttatcaacacctttacccagacggcccgctctgaccgctgtgccttctatggc aacgtggaggtgggcagggatgtgactgtgcaggagctgcaggacgcctaccacgccgtggtgctgagctatgggg cagaggaccatcaggccctggatatccctggtgaggagttgcccggcgtgttctcggcccgggcctttgtgggctggta caatgggcttcctgagaaccgggagctggccccggacctgagctgtgacacagccgtgattctggggcaggggaatg tggctctggacgtggcccggatcctgctgaccccccccgaccacctggagaaaacggacatcactgaggccgccctg ggagccctgagacagagtcgggtgaagacggtgtggatcgtgggccgacgtggacccctacaagtggccttcaccat aaaggagcttcgggagatgattcagttaccaggaactcggcccatgttggatcctgcggatttcttgggtctccaggaca gaatcaaggaggccgctcgcccgaggaagcggctgatggaactgctgcttcgaacagccacggagaagccagggg tggaggaggctgcccgccgggcatcagcctcccgtgcctggggcctccgcttcttccgaagcccgcagcaggtcctg 60 ccctcgccagatgggcggcgggcggcaggcatccgcctggcagtcaccagactggagggcattggagaggccacc cgggcagtgcccactggggatgtggaggacctcccctgtgggctggtgctgagcagcattgggtataagagccgccc catcgaccccagtgtgccctttgaccccaagctcggggttgtccccaatatggagggccgggttgtggatgtgccaggc ctctactgcagcggctgggtgaagcggggacccacaggtgtcatcaccaccaccatgaccgacagcttcctcaccgg ccagattctgctacaggacctgaaggccgggcacctgccgtctggccccaggccgggctctgcattcatcaaggccct gctggacagccgaggggtctggcccgtgtctttctcggactgggagaaactggatgctgaggaggtgtcccggggcc aggcctcggggaagcccagagagaagctgctggatcctcaggagatgctgcggctgctggggcactga Trình t gene mã hóa cho AdR atgggcactcaagaacaaaccccccagatctgtgtggtgggcagtggcccagctggcttttacacggcccagcacctg ctaaagcaccactcccgggcccacgtggatatctacgagaaacagctggtgcccttcggcctggtgcgctttggcgtgg cgcctgaccaccccgaggtcaagaatgttatcaacacctttacccagacggcccgctctgaccgctgtgccttctatggc aacgtggaggtgggcagggatgtgactgtgcaggagctgcaggacgcctaccacgccgtggtgctgagctatgggg cagaggaccatcaggccctggatatccctggtgaggagttgcccggcgtgttctcggcccgggcctttgtgggctggta caatgggcttcctgagaaccgggagctggccccggacctgagctgtgacacagccgtgattctggggcaggggaatg tggctctggacgtggcccggatcctgctgaccccccccgaccacctggagaaaacggacatcactgaggccgccctg ggagccctgagacagagtcgggtgaagacggtgtggatcgtgggccgacgtggacccctacaagtggccttcaccat aaaggagcttcgggagatgattcagttaccaggaactcggcccatgttggatcctgcggatttcttgggtctccaggaca gaatcaaggaggccgctcgcccgaggaagcggctgatggaactgctgcttcgaacagccacggagaagccagggg tggaggaggctgcccgccgggcatcagcctcccgtgcctggggcctccgcttcttccgaagcccgcagcaggtcctg ccctcgccagatgggcggcgggcggcaggcatccgcctggcagtcaccagactggagggcattggagaggccacc cgggcagtgcccactggggatgtggaggacctcccctgtgggctggtgctgagcagcattgggtataagagccgccc catcgaccccagtgtgccctttgaccccaagctcggggttgtccccaatatggagggccgggttgtggatgtgccaggc ctctactgcagcggctgggtgaagcggggacccacaggtgtcatcaccaccaccatgaccgacagcttcctcaccgg ccagattctgctacaggacctgaaggccgggcacctgccgtctggccccaggccgggctctgcattcatcaaggccct gctggacagccgaggggtctggcccgtgtctttctcggactgggagaaactggatgctgaggaggtgtcccggggcc aggcctcggggaagcccagagagaagctgctggatcctcaggagatgctgcggctgctggggcactga Trình t gene mã hóa cho Adx atgagcagctcagaagataaaataacagtccactttataaaccgtgatggtgaaacattaacaaccaaaggaaaaa ttggtga ctctctgctagatgttgtggttcaaaataatctagatattgatggttttggtgcatgtgagggaaccttggcttgttctacc tgtcac ctcatctttgaacagcacatatttgagaaattggaagcaatcactgatgaggagaatgacatgcttgatctggcatatg 61 gactaa cagatagatcgcggttgggctgccagatctgtttgacaaaggctatggacaatatgactgttcgagtaccttaa ... ứng dụng sesquiterpene 15 1.4 Hệ xúc tác tế bào E coli tái tổ hợp dựa hệ thống cytochrome P450 16 1.5 Tình hình nghiên cứu ứng dụng hệ xúc tác tế bào để chuyển hóa sesquiterpene giới Việt... - TRẦN THỊ MAI NGHIÊN CỨU SỬ DỤNG HỆ XÚC TÁC TẾ BÀO E. COLI TÁI TỔ HỢP DỰA TRÊN HỆ THỐNG CYP264B1 ĐỂ CHUYỂN HÓA MỘT SỐ HỢP CHẤT SESQUITERPENE Chuyên ngành: Công nghệ sinh học Mã số: 60420201 LUẬN... dựng hệ xúc tác tế bào E coli tái tổ hợp để chuyển hóa hợp chất sesquiterpene, nhóm nghiên cứu thuộc phòng Sinh hóa thực vật Viện Cơng nghệ sinh học thiết kế vector tái tổ hợp chứa gene mã hóa
- Xem thêm -

Xem thêm: Nghiên cứu sử dụng hệ xúc tác tế bào e coli tái tổ hợp dựa trên hệ thống cyp264b1 để chuyển hóa một số hợp chất sesquiterpene , Nghiên cứu sử dụng hệ xúc tác tế bào e coli tái tổ hợp dựa trên hệ thống cyp264b1 để chuyển hóa một số hợp chất sesquiterpene

Gợi ý tài liệu liên quan cho bạn

Nhận lời giải ngay chưa đến 10 phút Đăng bài tập ngay