Nghiên cứu tạo kháng nguyên VP6 tái tổ hợp và kháng thể đặc hiệu để ứng dụng phát triển que thử phát hiện nhanh virus rota

162 15 0
  • Loading ...
1/162 trang
Tải xuống

Thông tin tài liệu

Ngày đăng: 04/11/2018, 22:47

BỘ GIÁO DỤ C VÀ ĐÀO TẠ O TRƯ Ờ NG ĐẠ I HỌ C BÁCH KHOA HÀ NỘ I - ĐỖ THỊ THU HÀ NGHIÊN CỨ U TẠ O KHÁNG NGUYÊN VP6 TÁI TỔ HỢ P VÀ KHÁNG THỂ ĐẶ C HIỆ U ĐỂ Ứ NG DỤ NG PHÁT TRIỂ N QUE THỬ PHÁT HIỆ N NHANH VIRUS ROTA LUẬ N ÁN TIẾ N SĨ CÔNG NGHỆ SINH HỌ C HÀ NỘ I – 2017 BỘ GIÁO DỤ C VÀ ĐÀO TẠ O TRƯ Ờ NG ĐẠ I HỌ C BÁCH KHOA HÀ NỘ I - ĐỖ THỊ THU HÀ NGHIÊN CỨ U TẠ O KHÁNG NGUYÊN VP6 TÁI TỔ HỢ P VÀ KHÁNG THỂ ĐẶ C HIỆ U ĐỂ Ứ NG DỤ NG PHÁT TRIỂ N QUE THỬ PHÁT HIỆ N NHANH VIRUS ROTA Chuyên ngành: Công nghệ sinh họ c Mã số : 62420201 LUẬ N ÁN TIẾ N SĨ CÔNG NGHỆ SINH HỌ C NGƯ Ờ I HƯ Ớ NG DẪ N KHOA HỌ C PGS TS TRƯ Ơ NG QUỐ C PHONG GS TS NGUYỄ N ĐĂNG HIỀ N HÀ NỘ I – 2017 LỜ I CAM ĐOAN Tôi xin cam đoan: Đây cơng trình nghiên u củ a mộ t số kế t cộ ng tác vớ i cộ ng khác Các số liệ u kế t trình bày luậ n án trung thự c, mộ t phầ n đư ợ c công bố tạ p chí khoa họ c chuyên ngành vớ i đồ ng ý cho phép củ a đồ ng tác giả Phầ n lạ i chư a đư ợ c tác giả công bố bấ t kỳ cơng trình nghiên u khác GVHD GVHD Nghiên u sinh PGS TS Trư ng Quố c Phong GS TS Nguyễ n Đăng Hiề n Đỗ Thị Thu Hà LỜ I CẢ M Ơ N Tơi xin bày tỏ lòng biế t n chân thành sâu sắ c tớ i PGS TS Trư ng Quố c Phong – giám đố c Trung tâm nghiên u phát triể n CNSH, Việ n CN Sinh họ c - CN Thự c phẩ m, trư ng Đạ i họ c Bách khoa Hà Nộ i GS TS Nguyễ n Đăng Hiề n – giám đố c Trung tâm nghiên u, sả n xuấ t vắ c xin sinh phẩ m y tế (Bộ Y tế ) tậ n tình hư ng dẫ n, quan tâm tạ o điề u kiệ n cho hoàn thành luậ n án này; Để hoàn thành luậ n án, nhậ n đư ợ c nhiề u giúp đỡ độ ng viên từ PSG TS Tô Kim Anh, PGS TS Khuấ t Hữ u Thanh – Nguyên ban lãnh đạ o Trung tâm nghiên u - phát triể n CNSH toàn thể bạ n bè đồ ng nghiệ p Tôi xin chân thành m giúp đỡ quý báu đó; Tôi chân thành m n tậ p thể cán mộ t số phòng nghiên u thuộ c Trung tâm nghiên u, sả n xuấ t vắ c xin sinh phẩ m y tế tạ o điề u kiệ n giúp đỡ để hồn thành nghiên u củ a mình; Vớ i tấ t lòng kính u biế t n chân thành nhấ t, xin dành cho gia đình: bố , mẹ , chồ ng con, nhữ ng ngư i thân yêu thông m, độ ng viên, tạ o điề u kiệ n chia sẻ khó khăn tơi suố t thờ i gian qua! Hà Nộ i, ngày 30 tháng 08 năm 2017 Đỗ Thị Thu Hà DANH MỤ C CHỮ VIẾ T TẮ T VI DANH MỤ C CÁC HÌNH Ả NH .IX DANH MỤ C CÁC BẢ NG X ĐẶ T VẤ N ĐỀ CHƯ Ơ NG I TỔ NG QUAN TÀI LIỆ U 1.1 TÌNH HÌNH BỆ NH TIÊU CHẢ Y DO VIRUS ROTA TRÊN THẾ GIỚ I VÀ VIỆ T NAM 1.1.1 Tình hình nhiễ m virus rota giớ i 1.1.2 Tình hình nhiễ m virus rota Việ t Nam 1.2 ĐẶ C ĐIỂ M CỦ A VIRUS ROTA 1.2.1 Phân loạ i virus rota 1.2.2 Đặ c điể m cấ u trúc củ a virus rota 1.2.3 Cơ chế xâm nhiễ m nhân lên củ a virus rota 1.3 CÁC PHƯ Ơ NG PHÁP PHÁT HIỆ N VIRUS ROTA 1.3.1 Quan sát bằ ng kính hiể n vi điệ n tử 10 1.3.2 Phư ng pháp điệ n di 10 1.3.3 Phư ng pháp Real time -PCR 11 1.3.4 Phư ng pháp giả i trình tự gen 11 1.3.5 Phư ng pháp ELISA (Enzyme-Linked ImmunoSorbent Assay) 11 1.3.6 Phư ng pháp ngư ng kế t hạ t nhự a (latex agglutination) 12 1.3.7 Kỹ thuậ t sắ c ký miễ n dị ch ( immunochromatographic) 12 1.4 ĐẶ C ĐIỂ M PROTEIN VP6 VIRUS ROTA 12 1.4.1 Gen tổ ng hợ p VP6 12 1.4.2 Đặ c điể m protein VP6 13 1.4.2.1 Cấ u trúc protein 13 1.4.2.2 Đặ c tính củ a VP6 15 1.5 PROTEIN VP6 TÁI TỔ HỢ P VÀ Ứ NG DỤ NG 18 1.5.1 Protein VP6 tái tổ hợ p 18 1.5.2 Sả n xuấ t protein tái tổ hợ p hệ biể u hiệ n E coli 20 1.5.2.1 Hệ biể u hiệ n E coli .20 1.5.2.2 Các mã hiế m biể u hiệ n protein E coli 21 1.5.3 Ứ ng dụ ng kháng thể kháng VP6 tạ o kit thử chẩ n đoán 22 1.6 MỘ T SỐ YẾ U TỐ Ả NH HƯ Ở NG ĐẾ N SINH TỔ NG HỢ P PROTEIN TÁI TỔ HỢ P 23 1.6.1 Ả nh hư ng củ a chấ t m ứ ng 24 1.6.2 Ả nh hư ng củ a nhiệ t độ 24 I 1.6.3 Ả nh hư ng củ a thờ i gian m ứ ng 25 1.6.4 Ả nh hư ng củ a tố i u hóa codons 25 1.7 TINH SẠ CH PROTEIN VP6 TÁI TỔ HỢ P 26 1.7.1 Thu nhậ n làm tan thể vùi 26 1.7.2 Tái cuộ n gấ p VP6 tái tổ hợ p 27 1.8 SẢ N XUẤ T KHÁNG THỂ ĐA DÒNG Ở ĐỘ NG VẬ T 27 1.8.1 Quy trình gây miễ n dị ch giám sát độ ng vậ t 28 1.8.1.1 Chuẩ n bị kháng nguyên 28 1.8.1.2 Lự a chọ n tá dư ợ c 29 1.8.1.3 Đư ng tiêm 29 1.8.1.4 Liề u lư ợ ng kháng nguyên, thể tích số mũi ti êm 29 1.8.1.5 Giám sát độ ng vậ t 29 1.8.1.6 Lấ y máu 30 1.8.1.7 Tinh sạ ch kháng thể .30 1.9 KỸ THUẬ T SẮ C KÝ MIỄ N DỊ CH 30 1.9.1 Nguyên lý que thử 30 1.9.2 Ðặ c tính thành phầ n que thử 31 1.9.2.1 Hạ t nano vàng (AuNPs) 31 1.9.2.2 Cộ ng hợ p kháng thể VP6 - hạ t nano vàng 32 1.9.2.3 Miế ng cộ ng hợ p 33 1.9.2.4 Miế ng thấ m mẫ u 33 1.9.2.5 Màng nitrocellulose .34 1.9.2.6 Miế ng thấ m hút (absorbent pad) 34 1.10 CÁC KIT THƯ Ơ NG MẠ I CHO CHẨ N ĐOÁN VIRUS ROTA 34 CHƯ Ơ NG ĐỐ I TƯ Ợ NG VÀ PHƯ Ơ NG NGHIÊN CỨ U 36 2.1 ĐỐ I TƯ Ợ NG, VẬ T LIỆ U, HÓA CHẤ T VÀ THẾ T BỊ 36 2.1.1 Sơ đồ tổ ng thể nghiên u 36 2.1.2 Đố i tư ợ ng nghiên u 36 2.1.3 Vậ t liệ u 36 2.1.4 Các cặ p mồ i sử dụ ng 37 2.1.5 Các kháng thể sử dụ ng 38 2.1.5.1 Kháng thể cho tạ o que thử 38 2.1.5.2 Kháng thể cho Western Blot ELISA .38 2.1.6 Hóa chấ t thiế t bị máy móc 39 2.1.6.1 Vậ t liệ u, hóa chấ t 39 II 2.1.6.2 Thiế t bị máy móc bả n .40 2.2 PHƯ Ơ NG PHÁP NGHIÊN CỨ U 40 2.2.1 Các phư ng pháp vi sinh 40 2.2.1.1 Phư ng pháp nuôi cấ y vi sinh vậ t 40 2.2.1.2 Phư ng pháp giữ giố ng vi sinh vậ t 40 2.2.2 Các phư ng pháp sinh họ c phân tử 41 2.2.2.1 Phư ng pháp tách chiế t RNA tổ ng số (QIAgen RNA extract Kit) 41 2.2.2.2 Phư ng pháp RT – PCR .41 2.2.2.3 Phư ng pháp tách chiế t plasmid [17] .42 2.2.2.4 Phư ng pháp ghép nố i gen vào vector tách dòng [182] 42 2.2.2.5 Biế n nạ p vào tế bào E.coli 43 2.2.2.6 Phư ng pháp tạ o tế bào khả biế n 43 2.2.2.7 Phư ng pháp cắ t DNA plasmid bằ ng enzyme giớ i hạ n 43 2.2.2.8 Thiế t kế vecter biể u hiệ n pET 22b(+) mang gen vp6 43 2.2.2.9 Phư ng pháp tinh sạ ch DNA từ gel agarose bằ ng QIAquick Gel Extraction kit 44 2.2.2.10 Phư ng pháp biể u hiệ n gen 44 2.2.3 Phư ng pháp hóa sinh 45 2.2.3.1 Điệ n di DNA gel agarose [110] 45 2.2.3.2 Phư ng pháp điệ n di biế n tính gel polyacrylamide – SDS .45 2.2.3.3 Phư ng pháp tách chiế t protein tổ ng số [120] 45 2.2.3.4 Phư ng pháp tách chiế t protein thể tan [169] 45 2.2.3.5 Thu nhậ n làm tan thể vùi [48, 145] 46 2.2.3.6 Phư ng pháp tinh sạ ch protein cộ t His-tag kế t hợ p tái cuộ n gấ p [32] 46 2.2.3.7 Phư ng pháp lọ c tách hạ t virus rota tiể u thể thành phầ n 46 2.2.3.8 Đị nh lư ợ ng protein bằ ng phư ng pháp Bradford [24] 47 2.2.4 Phư ng pháp miễ n dị ch họ c 47 2.2.4.1 Phư ng pháp sả n xuấ t kháng thể 47 2.2.4.2 Phư ng pháp Western Blotting [158] .48 2.2.4.3 Phư ng pháp ELISA [162] 49 2.2.4.4 Phư ng pháp tinh sạ ch IgG bằ ng cộ t sắ c ký lự c gắ n protein A-Sepharose .50 2.2.4.5 Phư ng pháp soi hiể n vi miễ n [112] 50 2.2.5 Phư ng pháp tạ o que thử sắ c ký miễ n dị ch [93, 171, 174] 51 2.2.5.1 Tìm pH tố i u cho phả n ứ ng gắ n kháng thể nano vàng .51 2.2.5.2 Phư ng pháp tạ o cộ ng hợ p kháng thể - hạ t nano vàng 51 2.2.5.3 Phư ng pháp cố đị nh kháng thể lên màng .51 III 2.2.5.4 Phư ng thứ c hoạ t độ ng que thử nhanh 52 2.2.5.5 Phư ng pháp phân tích mẫ u bằ ng que thử 52 2.2.5.6 Phư ng pháp tính độ nhạ y độ đặ c hiệ u củ a que thử 52 2.2.6 Các phư ng pháp tin sinh 53 2.2.6.1 Kiể m tra mồ i bằ ng phầ n mề m FastPCR 53 2.2.6.2 Kiể m tra vị trí củ a enzyme hạ n chế gen đích bằ ng phầ n mề m Nebcutter 53 2.2.6.3 Phân tích trình tự gen bằ ng phầ n mề m NCBI (Blast,…) 53 2.2.6.4 Chuyể n mã trình tự DNA sang trình tự axit amin bằ ng ExPASy 53 2.2.6.5 Dự đoán cấ u trúc VP6 bằ ng phầ n mề m RaptorX [124] 53 2.2.6.6 Dự đốn trình tự epitope chuỗ i axit amin bằ ng phầ n mề m SNMTriP 53 2.2.6.7 Xác đị nh độ sạ ch củ a protein VP6 sau tinh sạ ch bằ ng phầ n mề m Quanty-One 4.6.9 (Bio-rad) 53 CHƯ Ơ NG KẾ T QUẢ VÀ THẢ O LUẬ N 54 3.1 TÁCH DÒNG VÀ BIỂ U HIỆ N GEN MÃ HÓA PROTEIN VP6 TRONG E COLI 54 3.1.1 Tách dòng gen vp6 kiể u i 54 3.1.1.1 Khuế ch đạ i gen vp6 .54 3.1.1.2 Tách dòng gen vp6 vector pJET1.2 55 3.1.2 Biể u hiệ n gen vp6 mã hóa protein VP6 59 3.1.2.1 Tạ o cấ u trúc biể u hiệ n tái tổ hợ p mang gen kiể u i mã hóa protein VP6 (VP6nat) 59 3.1.2.2 Nghiên u biể u hiệ n gen vp6nat E coli BL21(DE3) 61 3.1.2.3 Tạ o cấ u trúc biể u hiệ n tái tổ hợ p mang gen tố i u mã hóa protein VP6 (VP6opt) .66 3.1.2.4 Nghiên u biể u hiệ n gen vp6 tố i u E coli BL21(DE3) 72 3.1.3 Đánh giá so sánh biể u hiệ n gen vp6nat vp6opt 77 3.2 THU NHẬ N PROTEIN VP6 TÁI TỔ HỢ P TINH SẠ CH 78 3.2.1 Tách chiế t protein VP6 78 3.2.2 Tinh sạ ch protein VP6 tái tổ hợ p tái cuộ n gấ p 80 3.2.2.1 Tinh sạ ch protein VP6 tái tổ hợ p bằ ng sắ c ký lự c gắ n Ni2+ 80 3.2.2.2 Đánh giá khả tái cuộ n gấ p củ a protein VP6 tái tổ hợ p sau tinh sạ ch 81 3.2.3 Đánh giá đặ c tính protein VP6 tái tổ hợ p sau tinh sạ ch 82 3.3 TẠ O KHÁNG THỂ KHÁNG PROTEIN VP6 VIRUS ROTA TÁI TỔ HỢ P 84 3.3.1 Quy trình gây miễ n dị ch thỏ 84 3.3.2 Xác đị nh hiệ u giá kháng thể bằ ng phư ng pháp ELISA 84 3.3.3 Thu nhậ n tinh sạ ch kháng thể kháng protein VP6 bằ ng sắ c ký lự c cộ t protein ASepharose 85 3.3.4 Xác đị nh đặ c tính kháng thể 87 3.4 TẠ O QUE THỬ CHẨ N ĐOÁN VIRUS ROTA 90 IV 3.4.1 Nghiên u điề u kiệ n cộ ng hợ p anti-VP6IgG vớ i phứ c PEG-AuPNs 91 3.4.2 Nghiên u cố đị nh kháng thể màng nitrocellulose 95 3.4.3 Tố i u dị ch ly giả i mẫ u 96 3.4.4 Khả o sát đánh giá que thử 97 3.4.4.1 Khả o sát phả n ứ ng chéo .99 3.4.4.2 Khả o sát ngư ỡ ng phát hiệ n 100 3.4.4.3 Khả o sát khả củ a que thử vớ i nhóm virus rota khác type 101 3.4.4.4 Khả o sát độ nhạ y độ đặ c hiệ u mẫ u bệ nh phẩ m 103 3.4.4.5 Khả o sát thờ i gian bả o n que thử 103 CHƯ Ơ NG KẾ T LUẬ N – KIẾ N NGHỊ 105 4.1 KẾ T LUẬ N 105 4.2 KIẾ N NGHỊ 106 DANH MỤ C CÁC CƠNG TRÌNH ĐÃ CƠNG BỐ CỦ A LUẬ N ÁN 107 TÀI LIỆ U THAM KHẢ O 108 PHỤ LỤ C 117 Phụ lụ c 1: Môi trư ng hóa chấ t 117 Phụ lụ c 2: Trình tự gen vp6 ngân hàng liệ u NCBI 119 Phụ lụ c 3: Trình tự gen vp6 vector tách dòng pJET1.2 so sánh vớ i trình tự gen (GenBank: HQ392338.1) 120 Phụ lụ c 4: Cây phân loạ i theo trình tự gen vp6 củ a virus rota 122 Phụ lụ c 5: Cây phân loạ i theo trình tự axit amin VP6 củ a virus rota 123 Phụ lụ c 6: Thông tin trình tự gen vp6 từ virus rota nhóm A G1P(8) phân lậ p Việ t Nam 124 Phụ lụ c 7: Kế t giả i trình tự gen vp6nat vector pET22b+ 126 Phụ lụ c 8: Kế t giả i trình tự gen vp6opt vector pET22b+ 129 Phụ lụ c 9: Trình tự gen VP6opt pET22b(+) so sánh vớ i trình từ gen VP6 tổ ng hợ p (Genscript) 133 Phụ lụ c 10: Kế t tín hiệ u ELISA OD450nm 135 Phụ lụ c 11: Tóm tắ t quy trình xét nghiệ m 136 Phụ lụ c 12: Kế t khả o sát thử nghiệ m kit mẫ u bệ nh phẩ m 138 Phụ lụ c 13: Nguồ n gố c mẫ u sử dụ ng nghiên u 142 V DANH MỤ C CHỮ Từ viế t tắ t VIẾ T TẮ T Tiế ng Anh Tiế ng Việ t Amp Ampicillin Kháng sinh Ampicilline AP Alkaline phosphatase Enzyme Alkaline phosphatase Anti-VP6IgG Anti VP6 protein-IgG Kháng thể kháng protein VP6 tái tổ hợ p AuNPs Gold nanoparticle Hạ t nano vàng 5-Bromo-4-chloro-3-indolyl Muố i 5-Bromo-4-chloro-3-indolyl phosphate disodium salt phosphate disodium bp Base pair Cặ p base BSA Bovine Albumine Serum Albumine huyế t bò CBB Coomassie Brilliant Blue Coomassie Brilliant Blue Complementary Chuỗ i Axit Deoxyribonucleic acid bổ Deoxyribonucleic acid sung CFU Colony forming unit Đơ n vị hình thành huẩ n lạ c dATP Deoxyadenosine triphosphate Nucleotid Adenosine -A dCTP Deoxycytidine triphosphate Nucleotid Cytidine - C dGTP Deoxyguanosine triphosphate Nucleotid Guanosine -G dTTP Deoxythymidine triphosphate Nucleotid Thymidine - T dNTPs Deoxyribonucleoic Triphosphates Chứ a nucleotid A,T,C G BCIP cDNA dsRNA DTT Double stranded Ribonucleic Acid 1,4-Dithiothreitol 1-Ethyl-3-(3- EDC dimethylaminopropyl) carbodiimide EDTA RNA sợ i đôi 1,4-Dithiothreitol 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide Ethylene diamine tetraacetic acid Ethylene diamine tetraacetic acid Enzyme-Linked ImmunoSorbent Thử nghiệ m hấ p phụ miễ n dị ch liên kế t Assay enzyme EtBr Ethidium bromide Ethidium bromide FCA Freund’ s Complete Adjuvant Tá dư ợ c toàn phầ n FIA Freund’ s Incomplete Adjuvant Tá dư ợ c khơng tồn phầ n ELISA FPLC Fast protein liquid chromatography Sắ c ký lỏ ng nhanh VI 2165728_pV 2165728_pV 2165728_pV 2165728_pV 2165728_pV 2165728_pV 2165728_pV 2165728_pV 2165728_pV 2165728_pV 2165728_pV 2165728_pV | | | | | | | | | | 960 970 980 990 1000 TGGCTTTCGC GCGCCATTTC ATCCATGCAC ACGTTATCAA TAAAATCAAT | | | | | | | | | | 1010 1020 1030 1040 1050 AAAATATTCA ATGGTGGTGC GCGCGGTTTC CACATAGTTC GCATCCAGGT | | | | | | | | | | 1060 1070 1080 1090 1100 TCAGCAGGGT GGTGCCCAGC AGGCCAAAAT CAAAGGTCCA GTTGCGAATC | | | | | | | | | | 1110 1120 1130 1140 1150 GGCAGGTTGC CAATGCCCGC CGGTCTGAAA ATCGTTGCCG TTCATGGTCA | | | | | | | | | | 1160 1170 1180 1190 1200 CAATCATCTG GTTAAACTGC TGAATCAAAT CGCTCACGTT GCTATACAGG | | | | | | | | | | 1210 1220 1230 1240 1250 GGTGCCTTCC CCAATTTTTA TCGCCGGACT TCTTTCAGGG GTTGGATCCC | | | | | | | | | | 1260 1270 1280 1290 1300 AATTAATTCC GAAATCCCAG GGCCATTGCC CGGTTTGGGG CACGAGGAAA | | | | | | | | | | 1310 1320 1330 1340 1350 ACCCAAAAAC AACCCAACCC GGTTGGCGAC ACGGGATTTT CATTGGTTAA | | | | | | | | | | 1360 1370 1380 1390 1400 TTCTTCCTAT AAAGTTACAC AATTTATTTT TCAAAGGGGA AATTGTTTCT | | | | | | | | | | 1410 1420 1430 1440 1450 CCGCCCAACT TCCCCTTAAG GGGGGCCGAT TATTTTTCCG GCGCAAAAAT | | | | | | | | | | 1460 1470 1480 1490 1500 TTCCGATCCC TTGCCGGAAT AACTTGGCGG CAGTAAACCG CGCCCACACT | GGCGTCCGG 132 Phụ lụ c 9: Trình tự gen VP6opt pET22b(+) so sánh vớ i trình từ gen VP6 tổ ng hợ p (Genscript) RBS Start pelB T7primer.pETVP6opt pt TAAGAAGGAGATATACATATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTC VP6opt pt.Seque T7primer.pETVP6opt pt CTCGCTGCCCAGCCGGCGATGGCCATGGATATCGGAATTAATTCGGATCCAACCCTGAAA VP6opt pt.Seque GGATCCAACCCTGAAA BamHI **************** T7primer.pETVP6opt pt GATGCGCGCGATAAAATTGTGGAAGGCACCCTGTATAGCAACGTGAGCGATCTGATTCAG VP6opt pt.Seque GATGCGCGCGATAAAATTGTGGAAGGCACCCTGTATAGCAACGTGAGCGATCTGATTCAG ************************************************************ T7primer.pETVP6opt pt CAGTTTAACCAGATGATTGTGACCATGAACGGCAACGATTTTCAGACCGGCGGCATTGGC VP6opt pt.Seque CAGTTTAACCAGATGATTGTGACCATGAACGGCAACGATTTTCAGACCGGCGGCATTGGC ************************************************************ T7primer.pETVP6opt pt AACCTGCCGATTCGCAACTGGACCTTTGATTTTGGCCTGCTGGGCACCACCCTGCTGAAC VP6opt pt.Seque AACCTGCCGATTCGCAACTGGACCTTTGATTTTGGCCTGCTGGGCACCACCCTGCTGAAC ************************************************************ T7primer.pETVP6opt pt CTGGATGCGAACTATGTGGAAACCGCGCGCACCACCATTGAATATTTTATTGATTTTATT VP6opt pt.Seque CTGGATGCGAACTATGTGGAAACCGCGCGCACCACCATTGAATATTTTATTGATTTTATT ************************************************************ T7primer.pETVP6opt pt GATAACGTGTGCATGGATGAAATGGCGCGCGAAAGCCAGCGCAACGGCGTGGCGCCGCAG VP6opt pt.Seque GATAACGTGTGCATGGATGAAATGGCGCGCGAAAGCCAGCGCAACGGCGTGGCGCCGCAG ************************************************************ T7primer.pETVP6opt pt AGCGAAGCGCTGCGCAAACTGGCGGGCATTAAATTTAAACGCATTAACTTTAACAACAGC VP6opt pt.Seque AGCGAAGCGCTGCGCAAACTGGCGGGCATTAAATTTAAACGCATTAACTTTAACAACAGC ************************************************************ T7primer.pETVP6opt pt AGCGAATATATTGAAAACTGGAACCTGCAGAACCGCCGCCAGCGCACCGGCTTTGTGTTT VP6opt pt.Seque AGCGAATATATTGAAAACTGGAACCTGCAGAACCGCCGCCAGCGCACCGGCTTTGTGTTT ************************************************************ T7primer.pETVP6opt pt CATAAACCGAACATTTTTCCGTATAGCGCGAGCTTTACCCTGAACCGCAGCCAGCCGATG VP6opt pt.Seque CATAAACCGAACATTTTTCCGTATAGCGCGAGCTTTACCCTGAACCGCAGCCAGCCGATG ************************************************************ T7primer.pETVP6opt pt CATGATAACCTGATGGGCACCATGTGGCTGAACGCGGGCAGCGAAATTCAGGTGGCGGGC VP6opt pt.Seque CATGATAACCTGATGGGCACCATGTGGCTGAACGCGGGCAGCGAAATTCAGGTGGCGGGC ************************************************************ T7primer.pETVP6opt pt TTTGATTATAGCTGCGCGCTGAACGCGCCGGCGAACATTCAGCAGTTTGAACATATTGTG VP6opt pt.Seque TTTGATTATAGCTGCGCGCTGAACGCGCCGGCGAACATTCAGCAGTTTGAACATATTGTG ************************************************************ T7primer.pETVP6opt pt CAGCTGCGCCGCGCGCTGACCACCGCGACCATTACCCTGCTGCCGGATGCGGAACGCTTT VP6opt pt.Seque CAGCTGCGCCGCGCGCTGACCACCGCGACCATTACCCTGCTGCCGGATGCGGAACGCTTT ************************************************************ T7primer.pETVP6opt pt AGCTTTCCGCGCGTGATTAACAGCGCGGATGGCGCGACCACCTGGTTTTTCAACCCGATT 133 VP6opt pt.Seque AGCTTTCCGCGCGTGATTAACAGCGCGGATGGCGCGACCACCTGGTTTTTCAACCCGATT ************************************************************ T7primer.pETVP6opt pt ATTCTGCGCCCGAACAACGTGGAAGTGGAATTTCTGCTGAACGGCCAGATTATTAACACC VP6opt pt.Seque ATTCTGCGCCCGAACAACGTGGAAGTGGAATTTCTGCTGAACGGCCAGATTATTAACACC ************************************************************ T7primer.pETVP6opt pt TATCAGGCGCGCTTTGGCACCATTGTGGCGCGCAACTTTGATACCATTCGCCTGAGCTTT VP6opt pt.Seque TATCAGGCGCGCTTTGGCACCATTGTGGCGCGCAACTTTGATACCATTCGCCTGAGCTTT ************************************************************ T7primer.pETVP6opt pt CAGCTGATGCGCCCGCCGAACATGACCCCGGCGGTGAACGCGCTGTTTCCGCAGGCGCAG VP6opt pt.Seque CAGCTGATGCGCCCGCCGAACATGACCCCGGCGGTGAACGCGCTGTTTCCGCAGGCGCAG ************************************************************ T7primer.pETVP6opt pt CCGTTTCAGCGCCATGCGACCGTGGGCCTGACCCTGCGCATTGAAAGCgcggtgtgcgaa VP6opt pt.Seque CCGTTTCAGCGCCATGCGACCGTGGGCCTGACCCTGCGCATTGAAAGCGCGGTGTGCGAA ************************************************************ T7primer.pETVP6opt pt agcgtgctggcggatgcgaacgaaaccctgctggcgaacgtgaccgcggtgcgccaggaa VP6opt pt.Seque AGCGTGCTGGCGGATGCGAACGAAACCCTGCTGGCGAACGTGACCGCGGTGCGCCAGGAA ************************************************************ T7primer.pETVP6opt pt tatgcgattccggtgggcccggtgtttccgccgggcatgaactggaccgaactgattacc VP6opt pt.Seque TATGCGATTCCGGTGGGCCCGGTGTTTCCGCCGGGCATGAACTGGACCGAACTGATTACC ************************************************************ T7primer.pETVP6opt pt aactatagcccgagccgcgaagataacctgcagcgcgtgtttaccgtggcgagcattcgc VP6opt pt.Seque AACTATAGCCCGAGCCGCGAAGATAACCTGCAGCGCGTGTTTACCGTGGCGAGCATTCGC ************************************************************ SalI 6xHis Stop T7primer.pETVP6opt pt gtcgacaagcttgcggccgcactcgagcaccaccaccaccaccactgagatccggctgct VP6opt pt.Seque GTCGAC -****** 134 Phụ lụ c 10: Kế t tín hiệ u ELISA OD450nm Kế t ELISA đánh giá khả tái cuộ n gấ p củ a protein VP6 TTH tinh sạ ch Giế ng Mẫ u L1 L2 Trung SD bình PBS 0,214 0,236 0,225 0,011 VB 0,530 0,571 0,550 0,021 MC 0,685 0,702 0,693 0,009 Ure 0,570 0,600 0,585 0,015 Kế t tín hiệ u ELISA đánh giá trạ ng thái cấ u trúc VP6 TTH so vớ i VP6 tự nhiên Giế ng Mẫ u PBS L2 Trung bình SD 0,223 0,207 0,215 0,002 VP6 TTH 0,678 0,708 0,693 0,033 0,578 0,007 VP6 tự L1 nhiên 0,577 0,58 Kế t ELISA đánh giá khả nhậ n biế t củ a anti-VP6IgG vớ i kháng nguyên VP6 TTH VP6 tự nhiên Trung Giế ng Mẫ u L1 L2 VP6 tự nhiên 1,429 1,416 1,423 0,007 VP6 TTH 1,673 1,647 1,660 0,013 PBS 0,197 0,204 0,201 0,004 bình SD 135 Phụ lụ c 11: Tóm tắ t quy trình xét nghiệ m I Thành phầ n xét nghiệ m - Kit thử - Tăm lấ y mẫ u - Ố ng đự ng dị ch đệ m hòa mẫ u - Hư ng dẫ n sử dụ ng - Ố ng bóp hút mẫ u II Bả o n - Bả o n kit thử nhiệ t độ phòng (1-300C) - Không bả o n nhiệ t độ âm - Không sử dụ ng kit thử túi nhôm bị rách hoặ c hỏ ng - Không sử dụ ng kit hế t hạ n sử dụ ng III Thu mẫ u bệ nh phẩ m, bả o n thậ n trọ ng Lấ y mẫ u Chuẩ n bị - Dùng tăm lấ y khoả ng 50 mg mẫ u phân - Đặ t tăm vào ố ng nghiệ m có dung mơi - Xoay tăm bơng nhấ t 10 lầ n cho đế n mẫ u đư ợ c hòa tan dung mơi Loạ i bỏ tăm bơng Hút 100 µl vào que thử Vậ n chuyể n mẫ u bả o n - Mẫ u nên sử dụ ng sau lấ y - Mẫ u đư ợ c bả o n nhiệ t độ 2-8oC 72 Trong trư ng hợ p lư u mẫ u lâu phả i bả o n nhiệ t độ âm sâu: -200C Thậ n trọ ng - Nên lấ y mẫ u triệ u ng bệ nh xuấ t hiệ n - Mẫ u phân trự c tiế p xét nghiệ m nên đư ợ c đự ng ố ng nghiệ m không a bấ t kỳ môi trư ng, chấ t bả o n hay phụ gia gây phả n ứ ng vớ i kit thử IV Quy trình xét nghiệ m Chuẩ n bị mẫ u chiế t - Que thử mẫ u đư a nhiệ t độ phòng để tiế n hành xét nghiệ m - Cho dung dị ch hòa vào ố ng nghiệ m - Lấ y khoả ng 50 mg phân bằ ng tăm bơng vơ trùng có sẵ n - Nhúng tăm bơng vào ố ng nghiệ m a dung môi - Lắ c đề u nhấ t 10 lầ n cho đế n mẫ u hòa tan đề u dung môi - Bỏ tăm khỏ i ố ng nghiệ m Quy trình thự c hiệ n 136 - Lấ y thử khỏ i túi đặ t bề mặ t phẳ ng, khơ - Hút 100 µl vào giế ng mẫ u củ a thử Khi test thử bắ t đầ u hoạ t độ ng, mộ t màu đỏ tía chạ y dọ c cử a sổ đọ c kế t V Đọ c kế t vòng 15-20 phút Nhậ n đị nh kế t • Test thử hoạ t độ ng tố t nế u xuấ t hiệ n vạ ch đỏ tía phía trái cử a sổ đọ c kế t - vạ ch ng C • Vị trí bên phả i củ a vùng đọ c kế t thử vị trí thử T Nế u thử xuấ t hiệ n vạ ch màu đỏ tía vạ ch thử T - Âm tính: xuấ t hiệ n nhấ t vạ ch màu đỏ tía vị trí C - Dư ng tính: xuấ t hiệ n vạ ch màu đỏ tía vạ ch ng C vạ ch thử T - Khơng có giá trị : khơng có vạ ch màu thử sau nhỏ mẫ u bệ nh phẩ m hoặ c xuấ t hiệ n vạ ch T Ngun nhân khơng làm theo hư ng dẫ n sử dụ ng hoặ c kit thử hỏ ng 137 Phụ lụ c 12: Kế t khả o sát thử nghiệ m kit mẫ u bệ nh phẩ m Que thử PCR ELISA OD450nm Chứ ng KC+ KC- 10 0.682 0,492 0,392 0,396 0,289 0,537 0,513 0,351 0,338 0,421 1,6.106 PBS2 Que thử PCR 138 ELISA OD450nm Chứ ng KC+ 11 KC- 12 13 14 15 16 17 18 19 20 0,231 0,689 0,401 0,489 0,378 0,513 0,536 0,413 0,322 0,253 1,6.106 PBS2 Que thử PCR ELISA OD450nm Chứ ng KC+ 21 KC- 22 23 24 25 26 27 28 29 30 0,887 0,497 0,429 0,534 0,501 0,488 0,489 0,327 0,398 0,467 1,6.106 PBS2 Hình 53: Thử nghiệ m que thử mẫ u bệ nh phẩ m dư ng tính vớ i virus rota 139 Que thử PCR ELISA OD450nm Chứ ng KC+ KC- 10 0,043 0,067 0,065 0,059 0,078 0,038 0,069 0,068 0,061 0,063 1,6.106 PBS2 Que thử PCR 140 ELISA OD450nm Chứ ng KC+ 11 KC- 12 13 14 15 16 17 18 19 20 0,047 0,047 0,066 0,053 0,069 0,048 0,055 0,055 0,058 0,050 1,6.106 PBS2 Que thử PCR ELISA OD450nm Chứ ng KC+ 21 KC- 22 23 24 25 26 27 28 29 30 0,046 0,054 0,066 0,053 0,067 0,065 0,045 0,066 0,068 0,052 1,6.106 PBS2 Hình 54: Thử nghiệ m que thử mẫ u bệ nh phẩ m âm tính vớ i virus rota 141 Phụ lụ c 13: Nguồ n gố c mẫ u sử dụ ng nghiên u 142 143 144 145 146 ... nguyên VP6 tái tổ hợ p củ a virus rota Tạ o đư ợ c kháng thể đặ c hiệ u kháng protein VP6 virus rota Thử nghiệ m ứ ng dụ ng cho phát triể n que thử phát hiệ n nhanh virus rota dự a vào nguyên. .. tái tổ hợ p có đặ c tính tư ng tự kháng - nguyên VP6 tự nhiên củ a virus rota kháng thể đa dòng kháng VP6 tái tổ hợ p Bư c đầ u thử nghiệ m ứ ng dụ ng kháng thể kháng protein VP6 tạ o que thử nhanh. .. hành nghiên u đề tài: " Nghiên u tạ o kháng nguyên VP6 tái tổ hợ p kháng thể đặ c hiệ u để ứ ng dụ ng phát triể n que thử phát hiệ n nhanh virus rota" - - - Vớ i mụ c tiêu: Tạ o đư ợ c kháng nguyên
- Xem thêm -

Xem thêm: Nghiên cứu tạo kháng nguyên VP6 tái tổ hợp và kháng thể đặc hiệu để ứng dụng phát triển que thử phát hiện nhanh virus rota , Nghiên cứu tạo kháng nguyên VP6 tái tổ hợp và kháng thể đặc hiệu để ứng dụng phát triển que thử phát hiện nhanh virus rota

Từ khóa liên quan

Gợi ý tài liệu liên quan cho bạn

Nhận lời giải ngay chưa đến 10 phút Đăng bài tập ngay