Nghiên Cứu Một Số Biến Đổi Nhiễm Sắc Thể, Gen P53 Ở Nhân Viên Y Tế Có Tiếp Xúc Nghề Nghiệp Với Phóng Xạ

14 7 0
  • Loading ...
1/14 trang

Thông tin tài liệu

Ngày đăng: 13/04/2018, 16:24

1 BỘ GIÁO DỤC VÀ ĐÀO TẠO BỘ Y TẾ VIỆN VỆ SINH DỊCH TỄ TRUNG ƯƠNG -* - NGUYỄN ĐÌNH TRUNG NGHIÊN CỨU MỘT SỐ BIẾN ĐỔI NHIỄM SẮC THỂ, GEN P53 Ở NHÂN VIÊN Y TẾ CÓ TIẾP XÚC NGHỀ NGHIỆP VỚI PHÓNG XẠ Chuyên ngành: Sức khỏe nghề nghiệp Mã số: TÓM TẮT LUẬN ÁN TIẾN SỸ Y HỌC HÀ NỘI - 2017 Cơng trình hồn thành Viện Vệ sinh Dịch tễ Trung ương 27 DANH MỤC CÁC CƠNG TRÌNH CƠNG BỐ KẾT QUẢ NGHIÊN CỨU CỦA LUẬN ÁN Người hướng dẫn khoa học: PGS TS Nguyễn Khắc Hải PGS TS Nguyễn Duy Bảo Phản biện 1: ………………………………… Phản biện 2: …………………………………… Biến đổi nhiễm sắc thể người tiếp xúc nghề nghiệp với phóng xạ Nguyễn Đình Trung, Trần Văn Khoa, Nguyễn Thị Thanh Nga, Nguyễn Thúy Huyền, Đặng Thị Hồng Tạp chí Y - Dược học Quân Vol 38 số 3, 2013 Biến đổi gen p35 người tiếp xúc nghề nghiệp với phóng xạ Nguyễn Phương Liên, Trần Phương Thảo, Nguyễn Đình Trung, Nguyễn Huy Hồng Luận án bảo vệ Hội đồng chấm luận án nhà nước họp Viện Vệ sinh Dịch tễ Trung ương, vào hồi , ngày tháng năm 20 Tạp chí Cơng nghệ Sinh học 11(4): 625-629, 2013 Thực trạng môi trường lao động nhân viên y tế tiếp xúc phóng xạ nghề nghiệp số bệnh viện khu vực Hà Nội Nguyễn Đình Trung, Nguyễn Khắc Hải, Nguyễn Duy Bảo, Có thể tìm hiểu luận án tại: Thư viện Quốc gia Thư viện Viện Vệ sinh Dịch tễ Trung ương … Tạp chí Y học Dự phòng tập XXVI, số 13 (186) 2016 26 KIẾN NGHỊ ĐẶT VẤN ĐỀ X-quang RÖentgen phát vào năm 1895 phóng xạ - Cần nghiên cứu kỹ xác định rõ liều cho phép Becquerel phát vào năm 1896 Kể từ phóng xạ ứng dụng nhiều ngành nghề khác nhau: y tế, kỹ thuật, công nghiệp phận thể để giám sát cho cán làm việc phòng chụp mạch can thiệp, xạ hình - Triển khai kỹ thuật có đề tài phân tích NST, gen P53 phòng thí nghiệm Viện Sức khỏe nghề nghiệp mơi trường phổ Bệnh tiếp xúc phóng xạ ngày chứng minh cách rõ ràng có mối liên quan bệnh với yếu tố tiếp xúc nghề nghiệp: ung thư phổi - thợ mỏ uranium, ung thư xương - công nhân tiếp xúc radium, ung thư da - bác sĩ, nhân viên xạ trị, X quang, bệnh bạch cầu biến cho sở khám bệnh nghề nghiệp khác - Mở rộng nghiên cứu xác định biến đổi NST phương pháp - bác sĩ, nhân viên xạ trị, X- quang, bệnh nhân điều trị Thực trạng an tồn phóng xạ sở y tế cần có độ nhạy cao xác định đột biến gen khác NVYT tiếp xúc với phóng xạ điều tra, nghiên cứu để đưa chứng mang tính chủ quan khách quan nhiều hình thức khác nhau: điều thực địa, đo - Mở rộng nghiên cứu xác định tác động biến đổi gen P53 xác định nghiên cứu thêm đột biến gen khác NVYT đạc vật lý, sinh học Trong số thị sinh học, tổn thương nhiễm sắc thể chứng minh có mối liên quan mật thiết với mức độ nhiễm xạ tiếp xúc với phóng xạ coi phương pháp đo liều sinh học có giá trị, mà nhiều trường hợp chứng khách quan, đáng tin cậy Ngoài ra, đột biến gen khẳng định hậu tương tác phóng xạ với vật chất di truyền gen P53 số gen thuộc nhóm gen ức chế khối u có tỷ lệ đột biến cao, 50% trường hợp ung thư nói chung Việc phát hiện, đánh giá biến đổi vật chất di truyền sử dụng để đo liều sinh học nhằm theo dõi, cảnh báotác hại phóng xạ gây Tại Việt nam, có nghiên cứu tổn thương nhiễm sắc thể gen phóng xạ nói chung phóng xạ nghề nghiệp nói riêng Vì vậy, chúng tơi tiến hành nghiên cứu đề tài “Nghiên cứu số biến đổi nhiễm sắc thể, gen P53 nhân viên y tế có tiếp xúc nghề nghiệp với phóng xạ” Với mục tiêu sau: Mơ tả điều kiện an tồn xạ nhân viên y tế tiếp xúc nghề nghiệp với phóng xạ số bệnh viện Hà Nội năm 2013 4 Xác định biến đổi nhiễm sắc thể trình tự gen P53 nhân viên y 25 KẾT LUẬN tế tiếp xúc nghề nghiệp với phóng xạ * Những đóng góp luận án - Luận án cung cấp số liệu mới, đầy đủ điều kiện lao động đưa đuợc chứng khách quan, đặc biệt yếu tố nguy gây ung thư nhân viên, biến đổi nhiễm sắc thể đột biến gen TP53 nhóm nhận viên y tế tiếp xúc với phóng xạ nghề nghiệp Trên giới nghiên cứu tương tự nghiên cứu chúng tơi khơng có nhiều Lần sử dụng só liệu thơng từ môi trường lao động, đến biến đổi nhiễm sắc thể dung biến đổi nhiễm sắc thể để đánh giá mức độ tiếp xúc phóng xạ bước đầu phát Điều kiện an toàn xạ các sở nghiên cứu địa bàn Hà Nội cho thấy nhân viên y tế tiếp xúc nghề nghiệp bảo đảm an toàn xạ: - Các phòng chụp X quang chiếu xạ sở nghiên cứu tuân thủ nghiêm quy đinh nhà nước an toàn xạ Cơ sở vật chất đầy đủ đảm bảo an tồn - Kết đo xạ mơi trường cho thấy: Liều chiếu xạ môi trường đột biến gen P53 - Điểm đề tài xác định biến đổi nhiễm sắc thể vị trí nhân viên X quang đạt tiêu chuẩn cho phép Tuy nhiên, nhân viên y tế tiếp xúc nghề nghiệp với phóng xạ Đồng thời, nghiên cứu xác định đột biến gen TP53 nhân viên y xạ hình điều kiện làm việc khó cách ly nguồn phát xạ nên có tế tiếp xúc nghề nghiệp với phóng xạ * Bố cục luận án phòng chiếu xạ cobal, phòng chụp mạch can thiệp phòng chụp điểm vượt tiêu chuẩn cho phép Đã phát nhân viên y tế tiếp xúc với phóng xạ có số biến đổi vật chất di truyền sau: Luận án bao gồm 120 trang với phần chương - Đặt vấn đề: 02 trang - Tần số tổn thương nhiễm sắc thể nhóm tiếp xúc phóng xạ nghề nghiệp cao so với nhóm chứng (pC mầu K11, K27, K28, K36, K55, XQ, VX16 vị trí 13347 G>A mầu K20, K36, K38, K41, K43 (Hình 3.11) Ngồi ra, mẫu K36 có hai điểm thay đổi nucleotide vị trí 13097 A>C 13174 G>T; mẫu VĐ41 có điểm thay đổi nucleotide vị trí 13150 C>T; mẫu K19 K27 nucleotide vị trí 13087 Các biến đổi không thấy Chương - TỔNG QUAN 1.1 Đại cương phóng xạ Bức xạ ion hố: hay gọi phóng xạ tất các loại xạ (điện từ hạt) tương tác với môi trường tạo nên ion Mọi người vật cấu tạo từ nguyên tử Một người lớn trung bình tập hợp khoảng x 1027 nguyên tử oxy, hydro, cacbon, nito, phốt nguyên tố khác 1.2 Ảnh hưởng phóng xạ tới thể công bố Ngân hàng gen nhóm chứng Sự thay đổi amino acid vị trí 165 Q>H, 184 D>N, 192 Q>H 196 R>Q Lai đồng tác giả (2002) phát bệnh nhân bị ung thư phổi Trong nghiên cứu thu kết tương tự, đặc biệt mẫu ADN nhân viên y tế mang ký hiệu K38 có ba đột biến vị trí codon 184, 192, 196 nhân viên phát có khối u phổi Vì vậy, chưa có nhiều biểu bệnh lý nhân viên có nguy cao với bệnh ung thư, đặc biệt ung thư phổi Sự thay đổi nucleotide exon đưa đến thay đổi acid amin vị trí codon 165 Q>H, 184 D>N, 192 Q>H, 196 R>Q stop codon vị trí 136 Sơ đồ.1.1: Ảnh hưởng phóng xạ tới thể 1.2.1 Sự tổn thương ADN Tổn thương ADN xạ ion hóa chia làm hai loại: tổn thương tác động trực tiếp (chiếm 35%), gián tiếp (chiếm 65%) - Các loại tổn thương ADN * Biến đổi bazơ nitơ * Biến đổi phần phân tử đường gây ra: + Đứt gãy ADN sợi đơn + Đứt gãy ADN sợi kép + Giải phóng bazơ nitơ khơng bị tổn thương * Hình thành liên kết chéo (có hai loại chính): + Liên kết chéo ADN-ADN + Liên kết chéo ADN-protein 23 - 118 giá trị liều cao cần xem xét (chiếm 0,57%): -20 mCi, đó: liều kế phơng 22 người bị liều chiếu cao cần xem xét (chiếm 0,55%) - Tổng cộng 136 người cần tiếp tục theo dõi kiểm sốt chiếu xạ nghề nghiệp, lại 17199 người kiểm soát giá trị nằm giới hạn cho phép 4.3 Biến đổi nhiễm sắc thể Những trường hợp tổn thương NST phóng xạ dạng dic/ring dạng đứt gãy (fragment) Tổn thương đặc trưng dạng dic/ring phóng Hình 1.1: Tác động phóng xạ tới ADN (nguồn Radiation protect Dosimetry, vol 122) 1.2.2 Nhiễm sắc thể tổn thương phóng xạ Thành phần cấu trúc NST ADN, tổn thương NST xuất phát từ tổn thương ADN 1.2.3 Gen P53 (protein 53): Ở người, gen mã hóa cho protein P53 nằm nhiễm sắc thể (NST) số 17 vị trí 17p13.1 Gen có kích thước 20kb với 11 exon 10 intron Khi kiểm tra thấy có sai hỏng ADN, P53 ngừng chu kỳ phân bào điểm kiểm sốt (checkpoint) hoạt hóa gen mã hóa enzyme có chức sửa chữa sai hỏng ADN Nếu ADN sửa chữa hoàn chỉnh, chu kỳ tế bào tiếp tục Nếu ADN không sửa chữa, tế bào chết theo chế “chết theo chương trình” (apoptosis) Nếu P53 bị sai hỏng chức tế bào mang ADN sai hỏng nhân lên mang theo đột biến có hại Các nghiên cứu cho thấy 50% trường hợp ung thư người có sai hỏng gen mã hóa P53 Do đó, P53 gọi gen áp chế ung thư (Tumor suppressor) xạ gây chủ yếu tập trung nhóm NVYT tiếp xúc tia X, trường hợp có tuổi nghề 10 năm trường hợp lại có tuổi nghề 20 năm 72% NVYT tiếp xúc với tia X có tổn thương dạng đứt gãy tỷ lệ 74,3% NVYT tiếp xúc với tia gama, đứt gẫy tập trung chủ yếu nhóm NVYT có tuổi nghề 15 năm Với tỷ lệ đứt gãy so sánh với nhóm chứng thấy khác biệt có ý nghĩa thống kê với p 0,05 nhiên với số lượng bạch cầu nghiên cứu thấp 1.3 Tiếp xúc với phóng xạ nghề nghiệp Khi tiếp xúc với phóng xạ gây ảnh hưởng tới mô tế bào với mức độ khác nhau: nhiều so với nghiên cứu Nguyễn Khắc Hải (7,02.109/l ) Tại nhóm nghiên cứu có 19 trường hợp số lượng bạch cầu giảm 4.109 /l, 1) Phóng xạ không đủ sức làm hư hại tế bào 2) Tế bào bị hư hại lúc đầu sau tự sửa chữa lành Đặc biệt nhóm nghiên cứu gặp trường hợp có số lượng bạch cầu là11,3 x 109/l So sánh với nghiên cứu Nguyễn Xuân Hòa tỷ lệ nhân viên xạ thiếu máu nhân viên nam chiếm tới 66,1%, có 38,9% trường hợp mạnh, giống hàng triệu tế bào bị chết thể ngày thay tế bào 3) Tế bào bị phóng xạ, tự sửa chữa khơng hoạt động bình thường trước tổn thương ADN NST nam giới có bất thường số lượng hồng cầu Số trường hợp bất thường số lượng bạch cầu 36,1% Những tế bào hình thành tế bào tiền ung thư, trở thành ung thư 4.2.4 Đo liều hấp thu cá nhân: Để đánh giá mức độ nhiễm xạ nhân viên tiếp xúc với xạ, người ta thường sử dụng phương pháp đo liều hấp thu cá nhân Kết đo 58 /60 người (96,7%) mức cho phép TCVN 4) Nhiễm phóng xạ nặng làm tế bào chết 1.4 Nghiên cứu tiếp xúc phóng xạ, biến đổi NST, gen tiếp xúc 6561-1999, có 02 người có kết đo vượt TCCP Kết nhìn chung phù hợp với kết đo liều suất thể NVYT phòng điều khiển Năm 2014 nước có 14706 trường hợp theo dõi đọc liều có: phóng xạ: 1.4.1 Tình hình nghiên cứu nước Theo Cục Kiểm sốt An tồn xạ hạt nhân (Bộ KH&CN), năm 2015 có khoảng 17.335 người 2.183 sở thường xuyên tiếp xúc với nguồn phóng xạ kiểm soát, theo dõi liều chiếu xạ quý Trong có: - 73 giá trị vượt giới hạn liều (chiếm 0,4%) > 20 mCi, đó: 15 - 23 giá trị vượt giới hạn liều (chiếm 0,13%) > 20 mSv/năm, liều kế phông 58 người bị chiếu liều (chiếm G,S9%) - 97 giá trị liều cao cần xem xét (chiếm 0,65%) > 10 mCi, đó: đó: liều kế phơng 22 người bị chiếu liều (chiếm 0,126%) liều kế phông 91 người bị liều chiếu cao cần xem xét (chiếm G,61%) - 118 giá trị liều cao cần xem xét (chiếm 0,57%): -20 mCi, đó: liều kế phông 22 người bị liều chiếu cao cần xem xét - 14536 giá trị nằm giới hạn cho phép (chiếm 98,84%) - Năm 2015 nước có 17335 trường hợp theo dõi đọc liều (chiếm 0,55%) - Tổng cộng 136 người cần tiếp tục theo dõi kiểm sốt chiếu có: - 23 giá trị vượt giới hạn liều (chiếm 0,13%) > 20 mSv/năm, xạ nghề nghiệp., lại 17199 người kiểm sốt giá trị nằm giới hạn cho phép đó: liều kế phông 22 người bị chiếu liều (chiếm 0,126%) Theo Nguyễn Khắc Hải CS (2004) liều suất tức thời phòng X quang tư nhân đo vị trí khe cửa vào từ 0,17-273µSv/h Có 34,4% số sở có điểm đo giới hạn cho phép, có vị trí cao gấp 500 lần mức cho phép (273µSv/h) bố trí hướng máy X quang chụp 4.2 Tình hình sức khỏe bệnh tật chùm tia chiếu thẳng vào cửa vào không che chắn Theo Nguyễn Duy Bảo (1999) Liều suất tức thời phòng X quang có tỷ lệ vượt mức 4.2.1 Tình hình chung NVYT tiếp xúc phóng xạ nghiên cứu: Số lượng nhân viên y tế (NVYT) tiếp xúc phóng xạ tham gia cho phép 35,8% 36,8% Trong nghiên cứu Nguyễn Cảnh Phú, liều suất đo buồng rửa phim 0,18-0,94 Sv/h, có 5/58 (8,6%) số nghiên cứu 60 người, tỷ lệ nam chiếm 78,3%, nữ giới chiếm 21,7%, tỷ lệ nam nữ nhóm chứng tương ứng 76,7 % 23,3%, sở vượt giới hạn nhiên liều vượt không nhiều (cao 0,94 µSv/h) Ở Việt Nam, việc nghiên cứu sử dụng phương pháp đo liều sinh học PX chưa phát triển khơng có khác biệt hai tỷ lệ nam nữ nhóm chứng nhóm nghiên cứu (với p>0,05) Nữ NVYT tiếp xúc với tia X có 12% tiếp xúc với tia gama 28% Tỷ lệ nam nữ làm việc mơi trường xạ ion hố có thay đổi so với trước đây, tỷ lệ nam nữ theo nghiên Trần Cẩm Vinh, Trần Quế CS (2000) nghiên cứu thực nghiệm tần số dic bạch cầu sau chiếu tia gamma khảo sát tần số sai hình cứu Nguyễn Khắc Hải tỷ lệ nam nữ 96, 7% 3,3%, tỷ lệ nữ theo nghiên cứu Nguyễn Duy Bảo 4% NST kiểu dic ngẫu nhiên nhóm dân cư Đà Lạt, Việt Nam 4.2.2 Tình hình sức khỏe bệnh tật nhân viên X quang: Phỏng vấn triệu chứng bệnh lý liên quan đến ảnh hưởng phóng 1.4.2 Tình hình nghiên cứu ngồi nước Hiện giới có khoảng 800.000 cơng nhân tiếp xúc nghề nghiệp với phóng xạ nhà máy điện nguyên tử triệu 21 xạ.cho thấy triệu chứng khô da nhóm nghiên cứu 28,7% nhóm chứng 11,7% có khác biệt có ý nghĩa thơng kê với p25 0 0 0/13 Tỷ lệ thay đổi nucleotide dẫn tới thay đổi acid amin gen P53 02 exon 5, chiếm tỷ lệ 20% tổng số NVYT xét Tuổi nghề nghiệm khơng thấy có thay đổi nhóm chứng Có 31,82% NVYT có tuổi nghề 10 năm có xuất thay đổi 45,45% nhóm tuổi nghề 11-15 Như vậy, chưa có biểu bệnh lý, trình tự gen p53 người làm việc môi trường tiếp xúc với phóng xạ có thay đổi nucleotide acid amin trình tự đoạn gen 5,6 Chương - BÀN LUẬN 4.1 Điều kiện lao động chiếu xạ môi trường lao động 4.1.1 Vệ sinh phòng ốc điều kiện làm việc Các sở nghiên cứu có điều kiện phòng ốc đạt kết môi trường lao động cho phép, kết nghiên cứu đề tài có đồng với nghiên cứu Nguyễn Xuân Hòa điều kiện sở vật chất trang thiết bị 18 13310 13320 13330 13340 13350 13360 13370 13380 13390 13400 | | | | | | .| | | | | | | | | | | | | | p 53 6-K9 6-K11 6-K12 6-K13 6-K18 6-K19 6-K20 6-K25 6-K27 6-K28 6-K30 6-K36 6-K37 6-K38 6-K41 6-K42 6-K43 6-K44 6-K45 6-K47 6-K48 6-K51 6-K55 6-K61 6-K62 6-K63 6-K71 6-C1 6-C3 6-C4 6-C5 6-C7 6-C8 6-C9 6-C11 6-XQ CCT CACTGATTG CTCTTAGGTC TGGCCCCTC CTCAGCATC TTATCCGAGT GGAAGGAAA TTTGCGTGTG GAGTATTTG GATGACAGA AACACTTTTC GAC C A A A A C A C C A A A A A A A A A A A A C A T - - A A A A C A Hình 3.11 Một số điểm thay đổi trình tự đoạn 5, mẫu nghiên cứu Sự thay đổi nucleotide exon đưa đến thay đổi acid amin vị trí codon 165 Q>H, 184 D>N, 192 Q>H, 196 R>Q stop codon vị trí 136 (Hình 3.10) 11 + Giải trình tự gen phương pháp giải trình tự deoxyribonucleic acide (ADN s-Sequencing) Phân tích biến đổi trình tự xếp acid nucleic đoạn gen (exon 5, 7,9) phần mềm đặc hiệu máy vi tính - Đánh giá mối liên quan biển đổi trình tự nucleotide gen P53 người với tiếp xúc phóng xạ Các khảo sát, khám, đo đánh giá dựa theo Thường quy kỹ thuật Sức khỏe nghề nghiệp & Mơi trường, Phân tích NST thực Học Viện Quân Y Gen P53 thực Viện CNSH Chương - KẾT QUẢ 3.1 Kết điều kiện lao động 3.1.1 Điều kiện làm việc NVYT tiếp xúc phóng xạ Nhân viên y tế làm việc tiếp xúc với phóng xạ trang bị thiết Hình 3.12 Sự thay đổi aminoacid đoạn 5, số mẫu bị bảo hộ lao động để bảo vệ số vị trí có u cầu thiết bị bảo hộ, đa số phòng chụp, chiếu có áo chì Nhân viên y tế chấp hành tốt công tác bảo hộ lao động tiếp xúc với phóng xạ Tuy nhiên, áo chì trang bị tương đối nặng gây cảm giác khó chịu mệt mỏi Hai điểm thay đổi nucleotide vị trí 13336 G>C mẫu K11, mặc thời gian dài Kính mắt chì găng tay chì chưa K27, K28, K36, K55, XQ, VX16 vị trí 13347 G>A mầu K20, K36, K38, K41, K43 (Hình 3.11) Ngồi ra, mẫu K19 K27 xảy trang bị cho cán làm can thiệp mạch phải thường xun làm việc mơi trường tiếp xúc phóng xạ thời gian dài nucleotide vị trí 13087, mẫu K36 có hai điểm đột biến vị trí 13097 A>C, 13174 G>T mẫu VĐ41 có điểm đột biến vị trí 13150 C>T Sự thay đổi nucleotide vị trí 13097 (trên mẫu K36), vị trí 13150 (trên mầu VĐ41) vị trí 13386 3.1.2 Mơi trường lao động: Điều kiện làm việc NVYT tiếp xúc phóng xạ Nhiệt độ phòng điều khiển phòng chụp, xạ giao động từ 21-30oC, cao 30oC, nhiệt độ phòng nằm giá trị mẫu không tạo thay đổi amino acid Sự thay đổi nucleotide vị trí 13174 (trên mẫu K36), 13229, 13336và 13347 đưa đến giới hạn cho phép 100% phòng đo có độ ẩm đạt giá trị giới hạn cho phép Kết đo ánh sáng bệnh viện cho thấy 100% số phòng có độ thay đổi amino acid vị trí codon 165 Q>H, 184 D>N, 192 Q>H 196 R>Q (Hình 3.10) Sự thiếu hụt nucleotide vị trí 13087 chiếu sáng đạt tiêu chuẩn cho phép 12 3.2 Mức độ phóng xạ sở nghiên cứu: Các phòng X-quang khu vực điều khiển có liều suất tức 17 đo từ 0,11-2,6 Sv/h, có vị trí đo phòng điều khiển có liều suất 2,6 Sv/h kính chì chưa đảm bảo Liều suất vượt tiêu chuẩn cho phép vị trí nhân viên X Hình 3.9 Ảnh kết điện di ADN tổng số từ mẫu máu quang: Tại phòng chụp mạch can thiệp nhân viên y tế làm việc M 10 11 12 13 14 15 16 có vị trí liều đo lên tới 71,0Sv/h vượt tiêu chuẩn cho phép, thời gian làm việc 01 phẫu thuật viên ekip mơi trường phóng xạ kéo dài từ 1- có trường hợp kéo dài đến 4-5 giờ, vị trí ngực tay phải tiếp xúc với phóng xạ 55,4 Sv/h, sau áo chì vị trí ngực phẫu Hình 3.10 Sản phẩm PCR sau tinh thuật viên đo 5,41 Sv/h Đặc biệt, đơn vị xạ hình, nguồn chứa phóng xạ thùng chứa rác trang bị thiết bị chuyên dụng phòng tiêm phòng chờ bệnh nhân có liều suất đo tương ứng 2,18-118,0 Sv/h 3,71-154,0 Sv/h 3.3 Đặc điểm đối tượng nghiên cứu Bảng 3.1 Phân bố đối tượng nghiên cứu theo tuổi đời Nhóm NC Tuổi đời Tiếp xúc phóng xạ Khơng tiếp xúc phóng xạ (so sánh) n % n % 20 - 29 15,00 11 18,33 30 - 39 17 28,3 11 18,33 40 - 49 16 26,7 18 30,00 ≥ 50 18 30,00 20 33,33 Tổng cộng 60 100 60 100 p>0,05 Giải phân tích trình tự gen p53 đoạn exon 5,6 exon đến Kết phân tích số liệu cho thấy hai điểm thay đổi nucleotide vị trí 13336 G>C mầu K11, K27, K28, K36, K55, XQ, VX16 vị trí 13347 G>A mầu K20, K36, K38, K41, K43 (Hình 3.15) Ngồi ra, mẫu K36 có hai điểm thay đổi nucleotide vị trí 13097 A>C 13174 G>T; mẫu VĐ41 có điểm thay đổi nucleotide vị trí 13150 C>T; mẫu K19 K27 nucleotide vị trí 13087 132 10 13 220 323 132 40 13 250 3260 1327 132 80 13 290 330 | | .| .| .| | | | | .| .| .| | | | | .| .| | | p53 56-K9 56-K11 56-K12 56-K13 56-K18 56-K19 56-K20 56-K25 56-K27 56-K28 56-K30 56-K36 56-K37 56-K38 56-K41 56-K42 56-K43 56-K44 56-K45 56-K47 56-K48 56-K51 56-K55 56-K61 56-K62 56-K63 56-K71 56-C1 56-C3 56-C4 56-C5 56-C7 56-C8 56-C9 56-C11 56-XQ GCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGGTGAGCAGCTGGGGCTGGAGAGACGACAGGGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATT A A A A A A A A A A .A A A A A A A A A A A A A A A A A A A A A A .G 16 13 Những trường hợp tổn thương NST phóng xạ dạng dic/ring dạng đứt gãy (fragment) 84% NVYT tiếp xúc với tia X có tổn thương 40 dạng đứt gãy tỷ lệ 77,1% NVYT tiếp xúc với tia gamma, đứt gẫy tập trung chủ yếu nhóm NVYT có tuổi nghề 20 20 năm 36.67 0-10 30 18.33 21.67 18.33 '11-15 16-20 10 21-25 >=26 Biểu đồ 3.1 Phân bố tuổi nghề đối tượng nghiên cứu Nhóm NVYT có tuổi nghề từ 1-10 năm chiếm 36,67%, nhóm thứ hai NVYT có tuổi nghề 25 năm chiếm tỷ lệ 21,6%, nhóm tuổi nghề từ 11- 15 năm 16-20 năm có tỷ lệ 18,33%, thấp nhóm tuổi nghề từ 21-25 năm chiếm tỷ lệ 5% Hình 3.5: Bộ nhiễm sắc thể bình thường K 19 Hình 3.6: Đứt nhiễm sắc tử K 25 Hình 3.7: Đứt nhiễm sắc tử mẫu U02 Hình 3.8: Trao đổi nhiễm sắc tử mẫu K61 3.6 Kết biến đổi Gen P53 3.6.1 Tách chiết tinh ADN tổng số ADN tổng số 120 mẫu máu sau tách chiết điện kiểm tra gel agarose 0,8%, kết thể điện di đồ % Biểu đồ 3.2 Nghề nghiệp NVYT tiếp xúc phóng xạ 3.4 Triệu chứng lâm sàng huyết học liên quan đến ảnh hưởng phóng xạ Triệu chứng khơ da nhóm nghiên cứu 28,3% nhóm chứng 11,7% có khác biệt có ý nghĩa thống kê với p 0,05 Số lượng tiểu cầu nhóm nghiên cứu thấp so với nhóm chứng có với khác biệt có ý nghĩa thống kê với P < 0,05 Số lượng tiểu cầu nhóm nghiên cứu thấp so với nhóm chứng Hình 3.1: Bộ nhiễm sắc thể bình thường U 01 Hình 3.2: Một dic đoạn đứt không tâm, trao đổi nhiễm sắc tử mẫu VX10 Hình 3.3: Nhiễm sắc thể hình nhẫn (ring) (phải) đoạn đứt khơng tâm (trái) mẫu VX10 Hình 3.4: Đứt chromatid VX19 có với khác biệt có ý nghĩa thống kê với p < 0,05 Có 19 trường hợp nhóm tiếp xúc số lượng tiểu cầu mức cho phép (< 150.109/l), 03 trường hợp nhóm chứng 3.5 Kết đo liều hấp thụ phóng xạ cá nhân: Bảng 3.2 Kết đo liều hấp thụ cá nhân Kết đo Liều tương đương cá nhân độ sâu da 10 mm (Hp 10) Liều tương đương cá nhân độ sâu da 0,07mm (Hp 0,07) Đánh giá kết đo Thấp giới hạn cho phép theo TCVN 6561: 1999 - 1,67mSv/tháng Vượt giới hạn cho phép mSv/tháng 0,08 - 2,65 0,08 - 3,55 n TCCP 1,67mSv/ tháng % (fragment) chưa phát thấy tượng liều cho phép trường hợp tiếp xúc tia gamma phạm vi nghiên cứu Bảng 3.3 Liên quan biến đổi NST tiếp xúc phóng xạ 118 98,3 1,7 Có 02 NVYT đơn vị Y học hạt nhân BV Ung bướu Hà Nội có kết đo liều hấp thu cá nhân vượt mức TCVN 6561 - 1999 ( 1,67 mSv/tháng) Đã phát thấy tổn thương NST phóng xạ dạng đứt gãy STT Tuổi nghề TX Tia X (n =25) TX Tia Gamma (n =35) dic+r af dư dic+r af dư 0-10 11-15 16-20 21-25 0 >25 (16%) 21(84%) Tổng cộng 27 (77,1%)
- Xem thêm -

Xem thêm: Nghiên Cứu Một Số Biến Đổi Nhiễm Sắc Thể, Gen P53 Ở Nhân Viên Y Tế Có Tiếp Xúc Nghề Nghiệp Với Phóng Xạ, Nghiên Cứu Một Số Biến Đổi Nhiễm Sắc Thể, Gen P53 Ở Nhân Viên Y Tế Có Tiếp Xúc Nghề Nghiệp Với Phóng Xạ

Gợi ý tài liệu liên quan cho bạn

Nhận lời giải ngay chưa đến 10 phút Đăng bài tập ngay