Đang tải... (xem toàn văn)
Xác định một số gen mã hóa yếu tố quyết định kháng nguyên của xoắn khuẩn Leptospira interrogans gây bệnh Leptospirosis tại Việt Nam (LV thạc sĩ)Xác định một số gen mã hóa yếu tố quyết định kháng nguyên của xoắn khuẩn Leptospira interrogans gây bệnh Leptospirosis tại Việt Nam (LV thạc sĩ)Xác định một số gen mã hóa yếu tố quyết định kháng nguyên của xoắn khuẩn Leptospira interrogans gây bệnh Leptospirosis tại Việt Nam (LV thạc sĩ)Xác định một số gen mã hóa yếu tố quyết định kháng nguyên của xoắn khuẩn Leptospira interrogans gây bệnh Leptospirosis tại Việt Nam (LV thạc sĩ)Xác định một số gen mã hóa yếu tố quyết định kháng nguyên của xoắn khuẩn Leptospira interrogans gây bệnh Leptospirosis tại Việt Nam (LV thạc sĩ)Xác định một số gen mã hóa yếu tố quyết định kháng nguyên của xoắn khuẩn Leptospira interrogans gây bệnh Leptospirosis tại Việt Nam (LV thạc sĩ)Xác định một số gen mã hóa yếu tố quyết định kháng nguyên của xoắn khuẩn Leptospira interrogans gây bệnh Leptospirosis tại Việt Nam (LV thạc sĩ)Xác định một số gen mã hóa yếu tố quyết định kháng nguyên của xoắn khuẩn Leptospira interrogans gây bệnh Leptospirosis tại Việt Nam (LV thạc sĩ)Xác định một số gen mã hóa yếu tố quyết định kháng nguyên của xoắn khuẩn Leptospira interrogans gây bệnh Leptospirosis tại Việt Nam (LV thạc sĩ)Xác định một số gen mã hóa yếu tố quyết định kháng nguyên của xoắn khuẩn Leptospira interrogans gây bệnh Leptospirosis tại Việt Nam (LV thạc sĩ)Xác định một số gen mã hóa yếu tố quyết định kháng nguyên của xoắn khuẩn Leptospira interrogans gây bệnh Leptospirosis tại Việt Nam (LV thạc sĩ)
AI HO THAI NGUYấN C TRN TH THANH HU XC NH MT S GEN M HểA YU T QUYT NH KHNG NGUYấN CA XON KHUN Leptospira interrogans GY BNH LEPTOSPIROSIS TI VIT NAM CHUYấN NGNH: CễNG NGH SINH HC M S: 60.42.02.01 LUN VN THC S SINH HC NG DNG Ngi hng dn khoa hc: TS Vừ Th Bớch Thy THI NGUYấN, NM 2017 LI CM N hon thnh lun tt nghip ny, tỏc gi xin by t lũng bit n chõn thnh v sõu sc nht ca mỡnh ti TS.Vừ Th Bớch Thy phú trng phũng H gen hc vi sinh - Vin Nghiờn cu h gen - Vin Hn lõm Khoa hc v Cụng ngh Vit Nam, ngi ó tn tỡnh ch bo, hng dn quỏ trỡnh nghiờn cu v hon thnh lun Tỏc gi xin trõn trng cm n quý thy cụ Ban giỏm hiu Trng i hc Khoa hc Thỏi Nguyờn; Ban ch nhim khoa Cụng ngh Sinh hc - Trng i hc Khoa hc Thỏi Nguyờn; Quý thy, cụ trc tip ging dy, giỳp sut quỏ trỡnh hc tp, nghiờn cu khoa hc Tỏc gi xin chõn thnh cm n PGS TS Nghiờm Ngc Minh, KS Phm Thựy Linh v cỏc anh ch em, cỏn b phũng H gen hc vi sinh - Vin Nghiờn cu h gen - Vin Hn lõm Khoa hc v Cụng ngh Vit Nam, ó nhit tỡnh hng dn, giỳp v úng gúp nhiu ý kin quý bỏu tụi hon thnh lun ny Cui cựng, xin c by t lũng yờu thng v bit n sõu sc n gia ỡnh, ng nghip - nhng ngi ó to mi iu kin giỳp , ng viờn tỏc gi quỏ trỡnh hc v hon thnh lun Thỏi Nguyờn, thỏng nm 2017 Tỏc gi Trn Th Thanh Hu LI CAM OAN Tụi xin cam oan õy l cụng trỡnh nghiờn cu tụi trc tip thc hin vi s giỳp ca cỏn b, nhõn viờn phũng H gen hc vi sinh - Vin nghiờn cu h gen, Vin Hn lõm Khoa hc v Cụng ngh Vit Nam di s hng dn khoa hc ca TS Vừ Th Bớch Thy Cỏc t liu trớch dn u cú ngun gc rừ rng, cỏc kt qu lun l trung thc v cha tng c cụng b bt k cụng trỡnh no khỏc Tỏc gi lun Trn Th Thanh Hu i v MC LC LI CM N LI CAM OAN DANH MC CAC Kí HIU, CAC CH VIT TT iii DANH MC BNG iv DANH MC HèNH v M U 1 t Mc tiờu nghiờn cu Ni dung nghiờn cu CHNG I TNG QUAN TI LIU 1.1 c im ca xon khun Leptospira 1.2 Tỡnh hỡnh nghiờn cu trờn th gii 1.2.1 Tỡnh hỡnh bnh Leptospirosis 1.2.2 Tỡnh hỡnh nghiờn cu vc xin phũng bnh Leptospirosis 10 1.3 Tỡnh hỡnh nghiờn cu nc 12 1.3.1 Tỡnh hỡnh bnh Leptospirosis 12 1.3.2 Tỡnh hỡnh nghiờn cu vc xin phũng bnh Leptospirosis 14 VT LIU V PHNG PHAP NGHIấN CU .15 2.1 Vt liu nghiờn cu 15 2.2 Húa cht, thit b 16 2.2.1 Húa cht 16 2.2.2 Thit b 17 2.3 a im nghiờn cu 17 2.4 Phng phỏp nghiờn cu .18 2.4.1 Phng phỏp tỏch chit DNA tng s 18 v 2.4.2 nh lng v kim tra tinh sch ca DNA tng s 19 2.4.3 Thit k cỏc cp mi ca cỏc gen 16S rDNA, OmpL1, LipL32, LipL41, LipL21, LigA, LigB 20 2.4.4 K thut PCR .20 2.4.5 Tinh sch sn phm PCR ca gen 16S rDNA 21 2.4.6 Gii trỡnh t gen 16S rDNA ca chng xon khun 22 2.4.7 Phõn tớch v xõy dng s hỡnh cõy phõn loi chng Leptospira 23 CHNG III KT QU V THO LUN 24 3.1 Phõn loi hc phõn t chng Leptospira 24 3.1.1 Kim tra cht lng DNA tng s .24 3.1.2 Trỡnh t cỏc cp mi ca cỏc gen 16S rDNA, OmpL1, LipL32, LipL41, LipL21, LigA, LigB 26 3.1.3 Nhõn gen vi cỏc cp mi ca gen 16S rDNA 27 3.1.4 Tinh sch sn phm PCR gen 16S rDNA 28 3.1.5 Gii trỡnh t gen 16S rDNA ca chng xon khun 29 3.1.6 Phõn tớch v xõy dng cõy phỏt sinh chng loi ca chng xon khun .30 3.2 Xỏc nh s cú mt ca cỏc gen LigA, LipL32, LigB, OmpL1, LipL21, LipL41 34 KT LUN V NGH 41 Kt lun 41 ngh 41 TI LIU THAM KHO .1 PH LC vi DANH MC CC Kí HIU, CC CH VIT TT bp Base pair dH2O Nc kh ion DNA Deoxyribonucleic acid dNTPs deoxyribonucleotide triphosphates EDTA Ethylene Diamine Tetraacetace Axit EMJH Ellinghausen - McCullough-Johnson-Harris EtBr Ethidium Bromide F- Forward Primer : Mi xuụi R- Reverse Primer: Mi ngc Kb Kilobase L Leptospira MLST Multilocus Sequence Typing OMP Protein ngoi mng (outer membrane protein) PCR Polymerase Chain Reaction RNA Ribonucleic acid SDS Sodium Dodecyl Sulfate TAE Tris-acetate-EDTA DANH MC BNG Bng Tờn bng Trang 2.1 Danh mc cỏc thit b ó s dng 17 2.2 Thnh phn phn ng nhõn gen 21 3.1 3.2 3.3 Giỏ tr mt quang ph hp th bc súng 260nm v 280nm ca chng Leptospira Trỡnh t cp mi dựng nhõn cỏc on gen Cỏc loi Leptospira quc t tham kho t c s d liu GenBank 25 27 30 DANH MC HèNH Hỡnh Tờn hỡnh Trang Leptospira interrogans Chu kỡ nhit ca phn ng PCR nhõn gen 21 3.1 Hỡnh nh in di DNA tng s ca chng Leptospira 24 3.2 Hỡnh nh in di sn phm PCR nhõn gen mó húa rRNA 16S 28 3.3 3.4 Hỡnh nh in di sn phm PCR nhõn gen mó húa rRNA 16S tinh sch Hỡnh nh cõy phỏt sinh chng loi ca chng xon khun 29 32 3.5.a Hỡnh nh in di sn phm PCR nhõn gen LigA 35 3.5.b Hỡnh nh in di sn phm PCR nhõn gen LipL32 35 3.5.c Hỡnh nh in di sn phm PCR nhõn gen LigB 36 3.5.d Hỡnh nh in di sn phm PCR nhõn gen OmpL1 36 3.5.e Hỡnh nh in di sn phm PCR nhõn gen LipL21 37 3.5.f 37 Hỡnh nh in di sn phm PCR nhõn gen LipL41 M U t Bnh Leptospirosis (bnh Xon khun) l mt nhng bnh truyn nhim cp tớnh, lan truyn t ng vt sang ngi ph bin trờn th gii, c T chc Sc khe ng vt Th gii (World Organisation for Animal HealthOIE) xp v trớ th nhúm bnh nguy him v c b sung vo nhúm bnh ngh nghip Vit Nam Nguyờn nhõn gõy bi mt loi xon khun Leptospira interrogans Leptospira interrogans l loi gõy bnh thng kớ sinh ngi v ng vt, bao gm hn 200 typ, c chia thnh 23 nhúm (trong ú Leptospira interrogans serovar Icterohaemorrhagiae thng gp nht) Xon khun ny cú kh nng gõy bnh trờn ng vt v cú th lõy sang ngi Bnh xon khun gõy cũn gi l bnh vng da, nú gõy nh hng n cỏc c quan v cú th gõy sy thai thỳ nuụi Bnh xon khun lõy nhim sang ngi qua niờm mc, da, mt hoc cỏc mng nhy tip xỳc trc tip hay giỏn tip vi nc tiu hoc mu mụ ng vt mc bnh Bnh phỏt trin khp mi ni trờn th gii, gõy thit hi ln cho ngnh chn nuụi v nh hng nghiờm trng n sc khe ca ngi Do tớnh a dng v triu chng nờn bnh Leptospirosis khú chn oỏn v t l t vong cao Vic iu tr bnh ny rt khú khn nờn ũi hi nhng bin phỏp phũng nga bnh cú hiu qu cao.Vỡ vy, vic sn xut vc xin phũng bnh xon khun Leptospira l mt yờu cu cp thit Trong quỏ trỡnh nghiờn cu ng dng, cỏc nh khoa hc ang trung vo cỏc loi vc xin cú kh nng phũng chng dch bnh mang tớnh dch t vựng, an ton, mc bo h cao v lõu di, giỏ thnh h, m bo sc khe cng ng v ng vt c bit quan tõm vi loi vc xin nhc c c thit k da trờn c s trỡnh t gen v cỏc yu t c lc ca cỏc tỏc nhõn gõy bnh ti u húa mc an ton ca cỏc loi vc xin õy l mt bc t phỏ thc s, ng dng cụng ngh di truyn ch to vc xin núi chung v vc xin Leptospirosis núi riờng Thc t, nhiu protein ngoi mng ca xon khun Leptospira ó c tỡm thy v s dng cụng ngh ch to vc xin tỏi t hp Quỏ trỡnh tỏch chit, tỏi t hp v tinh sch cỏc protein ny n gin, hn na protein tỏi t hp cú giỏ tr tng t nh khỏng nguyờn xột nghim dch phỏt hin xon khun Leptospira Kt qu thc nghim cho thy vc xin tỏi t hp phũng bnh xon khun cú dch cao hn so vi cỏc loi vc xin thụng thng Do ú, nhng nghiờn cu v cỏc gen quyt nh khỏng nguyờn tim nng, cụng thc ti u, tỏ dc, liu lng v liu trỡnh phỏt trin cỏc loi vc xin phũng bnh xon khun t hiu qu cao, an ton cho ngi v ng vt s dng l rt cn thit Vic ci thin cht lng vc xin tỏi t hp DNA v vc xin protein thc s quan trng i vi cỏc ng dng thc t Hn na, vic nghiờn cu cỏc protein mng s úng gúp vo c s d liu di truyn hc, cú ý ngha thit thc i vi cỏc nh khoa hc v sn xut liờn quan n vc xin phũng bnh xon khun Leptospira Xut phỏt t thc tin ú, chỳng tụi tin hnh thc hin ti Xỏc nh mt s gen mó húa yu t quyt nh khỏng nguyờn ca xon khun Leptospira interrogans gõy bnh Leptospirosis ti Vit Nam nhm to c s cho vic nghiờn cu, sn xut vc xin tỏi t hp phũng bnh xon khun Leptospira interrogans ti Vit Nam Mc tiờu nghiờn cu - nh danh c chng xon khun Leptospira interrogans gõy bnh Leptospirosis, ang s dng ch vc xin vụ hot Vit Nam - Xỏc nh c mt s gen quyt nh khỏng nguyờn tim nng, cú giỏ tr ng dng ch vc xin tỏi t hp chng li bnh gõy xon khun Leptospira interrogans ti Vit Nam TI LIU THAM KHO A Ti liu Ting Vit Trn Quang Bớnh (2010), "Nhõn mt s trng hp nhim Leptospira khú chn oỏn", Tp Y Hc TP H Chớ Minh, Ph bn S 2,14: p 603-607 Bỏo Lao ng (2003), "H Ni cú nguy c bựng phỏt dch Leptospirosis", Bỏo Lao ng Trn Thanh Phong ( 1996), Bnh truyn nhim vi trựng trờn heo, T sỏch HNL TP.HCM Hunh Hng Quang (2009), Bnh Leptospirose v nhng du hiu lõm sng cn phõn bit vi st rột ỏc tớnh th gan mt,Vin St Rột Ký Sinh Trựng Cụn Trựng Quy Nhn Nguyn Th Ni, V ỡnh Hng (1980), Bnh Leptospirosis gia sỳc v ngi, Kt qu nghiờn cu KH&KT thỳ y 1968 1978: p 226-232 Lờ Th Thanh Xuõn (2015), "Mt s c im dch t hc bnh xon trựng Leptospira ti Vit Nam giai on 2002-2011", Tp y hc d phũng, 6(15): p 358 B Ti liu Ting Anh A Slack (2010), Leptospirosis, Aust Fam Physician, 7(39): p 495 - 498 Alston JM (1963), The Leptospiroses,The Practitioner, 191: p 594-598 Alston JM and Brown HC (1937), The epidemiology of Weil's disease,Journal of the Royal Society of Medicine, 30(6): p 741-756 10 Artiushin S, Timoney JF, Nally J, Verma A (2004), Host-inducible immunogenic sphingomyelinase-like protein, Lk73 5, of Leptospira interrogans,Infection and immunity, 72(2): p 742-749 11 Bacelo Katia L, Hartwig Daiane D, Seixas Fabiana K, Schuch Rodrigo, Moreira Angelita da S, Amaral Marta, Collares Tiago, Vendrusculo Claire T, McBride Alan JA, Dellagostin Odir A (2014), Xanthan gum as an adjuvant in a subunit vaccine preparation against leptospirosis, BioMed research international 12 Baranton Guy and Postic Daniốle (2006), "Trends in leptospirosis epidemiology in France Sixty-six years of passive serological surveillance from 1920 to 2003", International journal of infectious diseases, 10(2): p 162-170 13 Bourhy Pascale, Collet Louis, Brisse Sylvain, Picardeau Mathieu (2014), "Leptospira mayottensis sp nov., a pathogenic species of the genus Leptospira isolated from humans", International journal of systematic and evolutionary microbiology, 64(12): p 4061-4067 14 Branger C, Sonrier C, Chatrenet B, Klonjkowski B, Ruvoen-Clouet N, Aubert A, Andre-Fontaine G, Eloit M (2001), Identification of the hemolysis-associated protein as a cross-protective immunogen of Leptospira interrogans by adenovirus-mediated vaccination, Infection and immunity, 69(11): p 6831-6838 15 Charon Nyles W and Goldstein Stuart F (2002), Genetics of motility and chemotaxis of a fascinating group of bacteria: the spirochetes, Annual review of genetics, 36(1): p 47-73 16 Coutinho ML, Vasconcellos FA, Fernandes CPH, Seyffert N, Seixa K, Ko AI, Dellagostin OA, Aleixo JAG (2007), "Evaluation of the Anti LipL32 Monoclonal Antibodies Potential for Use in Leptospirosis Immunodiagnostic Tests", Journal of immunoassay & immunochemistry, 28(3): p 279-288 17 Cullen Paul A, Cordwell Stuart J, Bulach Dieter M, Haake David A Adler Ben (2003), LipL21 is a novel surface-exposed lipoprotein of pathogenic Leptospira species, Infection and immunity, 71(5): p 24142421 18 Dai B, Chen Z, Haake DA, You Z, Fang Z (1999), Alignment of DNA sequences of ompL1 genes of insert fragment of recombinant plasmid, pDC38 of L interrogans serovar lai and L kirschneri, Hua xi yi ke da xue xue bao= Journal of West China University of Medical Sciences= Huaxi yike daxue xuebao/[bian ji zhe, Hua xi yi ke da xue xue bao bian wei hui], 30(3): p 236-240 19 Day MJ (2006), Vaccine side effects: fact and fiction, Veterinary microbiology, 117(1): p 51-58 20 Dezhbord Mehrangiz, Esmaelizad Majid, Khaki Pejvak, Fotohi Fariba, Moghaddam Athena Zarehparvar (2014), "Molecular identification of the ompL1 gene within Leptospira interrogans standard serovars", The Journal of Infection in Developing Countries, 8(06): p 688-693 21 Diament Decio, Brunialti Milena Karina Colo, Romero Eliete Calo, Kallas Esper Georges, Salomao Reinaldo (2002), Peripheral blood mononuclear cell activation induced by Leptospira interrogans glycolipoprotein, Infection and immunity, 70(4): p 1677-1683 22 Erridge Clett, Pridmore Alison, Eley Adrian, Stewart John, Poxton Ian R (2004),"Lipopolysaccharides of Bacteroides fragilis, Chlamydia trachomatis and Pseudomonas aeruginosa signal via toll-like receptor 2", Journal of Medical Microbiology, 53(8): p 735-740 23 Forster Karine M, Hartwig Daiane D, Oliveira Thaớs L, Bacelo Kỏtia L, Schuch Rodrigo, Amaral Marta G, Dellagostin Odir A (2015), DNA prime-protein boost based vaccination with a conserved region of leptospiral immunoglobulin-like A and B proteins enhances protection against leptospirosis, Memúrias Instituto Oswaldo Cruz, (AHEAD) 24 Franỗois Guido, Duclos Philippe, Margolis Harold, Lavanchy Daniel, Siegrist Claire-Anne, Meheus Andrộ, Lambert Paul-Henri, Emiroglu Nedret, Badur Selim, Van Damme Pierre (2005), Vaccine safety controversies and the future of vaccination programs, The Pediatric infectious disease journal, 24(11): p 953-961 25 Gebriel AM, G Subramaniam, and SD Sekaran (2006), The detection and characterization of pathogenic Leptospira and the use of OMPs as potential antigens and immunogens, Trop Biomed, 23(2): p 194-207 26 Guerreiro Hygia, Croda Jỳlio, Flannery Brendan, Matsunaga James Reis, Mitermayer Galvaxo (2001), Leptospiral proteins recognized during the humoral immune response to leptospirosis in humans, Infect, Immun 27 Haake DA, Champion CI, Martinich C, Shang ES, Blance DR, Miller JN, Lovett MA (1993), "Molecular cloning and sequence analysis of the gene encoding OmpL1, a transmembrane outer membrane protein of pathogenic Leptospira spp" Journal of bacteriology, 175(13): p 4225- 4234 28 Haake David A, Chao Garlo, Zuerner Richard L, Barnett Jeanne K, Barnett Dean, Mazel Mary, Matsunaga James, Levett Paul N, Bolin Carole A (2000), The leptospiral major outer membrane protein LipL32 is a lipoprotein expressed during mammalian infection, Infection and immunity, 68(4): p 2276-2285 29 Haake David A, Mazel Mary K, McCoy Adam M, Milward Frank, Chao Garlo, Matsunaga James, Wagar Elizabeth A (1999), Leptospiral outer membrane proteins OmpL1 and LipL41 exhibit synergistic immunoprotection, Infection and immunity, 67(12): p 6572-6582 30 Hu Weilin and Yan Jie (2014), Leptospira and leptospirosis in China, Current opinion in infectious diseases, 27(5): p 432-436 31 Hỹbener EA and Reiter Hans (1915), Beitrọge zur Aetiologie der Weilschen Krankheit, Dtsch,Med, Wochenschr., 41: p 1275-1277 32 Inada R and Ido Y (1915), A report of the discovery of the causal organism (a new species of spirocheta) of Weils disease, Tokyo Ijishinshi, 1908: p 351-360 33 Inada Ryokichi, Ido Yutaka, Hoki Rokuro, Ito Hiroshi, Wani Hidetsune (1918), "INTRAVENOUS SEROTHERAPY OF WEIL'S DISEASE (SPIROCHặETOSIS ICTEROHặMORRHAGICA)", The Journal of experimental medicine, 27(2): p 283 34 Inada Ryokichi, Ido Yutaka, Hoki Rokuro, Ito Hiroshi, Wani Hidetsune (2014), B-cell-specific peptides of Leptospira interrogans LigA for diagnosis of patients with acute leptospirosis, Clinical and Vaccine Immunology, 21(3): p 354-359 35 Koizumi N and Watanabe H (2005), "Leptospirosis vaccines: past, present, and future", Journal of postgraduate medicine, 51(3): p 210 36 Nobuo Koizumi and Haruo Watanabe (2003), Molecular cloning and characterization of a novel leptospiral lipoprotein with OmpA domain, FEMS microbiology letters, 226(2): p 215-219 37 Koizumi Nobuo and Watanabe Haruo (2004), Leptospiral immunoglobulin-like proteins elicit protective immunity, Vaccine, 22(11): p 1545-1552 38 Lee Seoung Hoon, Kim Kyung A, Park Yong Gun, Seong In Wha, Kim Min Ja, Lee Yong Ju (2000), Identification and partial characterization of a novel hemolysin from Leptospira interrogans serovar Lai, Gene, 254(1): p 19-28 39 Lee Seoung Hoon, Kim Sangduk, Park Seung Chul, Kim Min Ja (2002), Cytotoxic activities of Leptospira interrogans hemolysin SphH as a pore- forming protein on mammalian cells, Infection and immunity, 70(1): p 315-322 40 Levett Paul N, Branch Songee L, Whittington Carol U, Edwards Charles N, Paxton Helene (2001), Two methods for rapid serological diagnosis of acute leptospirosis, Clinical and diagnostic laboratory immunology, 8(2): p 349-351 41 Li Chunhao, Motaleb A, Sal Melanie, Goldstein Stuart F, Charon Nyles W (2000), "Spirochete periplasmic flagella and motility", Journal of molecular microbiology and biotechnology, 2(4): p 345-354 42 Maneewatch Santi, Adisakwattana Poom, Chaisri Urai, Saengjaruk , Patcharin, Srimanote Potjanee, Thanongsaksrikul Jeeraphong, Sakolvaree Yuwaporn, Poungpan Phakkanan, Chaicumpa Wanpen (2014), Therapeutic epitopes of Leptospira LipL32 protein and their characteristics, Protein Engineering Design and Selection: p gzu006 43 Matsunaga James, Young Tracy A, Barnett Jeanne K, Barnett Dean, Bolin Carole A, Haake David A (2002), Novel 45-kilodalton leptospiral protein that is processed to a 31-kilodalton growth-phase-regulated peripheral membrane protein, Infection and immunity, 70(1): p 323334 44 McBride AJ Athanazio DA, Reis MG, Ko AI (2005), Leptospirosis, Curr Opin Infect Dis 5(18): p 45 Nascimento Ana Lucia Tabet Oller do, Verjovski-Almeida S, Van Sluys MA, Monteiro-Vitorello CB, Camargo LEA, Digiampietri LA, Harstkeerl RA, Ho PL, Marques MV, Oliveira MC (2004), "Genome features of Leptospira interrogans serovar Copenhageni", Brazilian Journal of Medical and Biological Research, 37(4): p 459-477 46 Oliveira Thaớs Larrộ, Grassmann Andrộ Alex, Schuch Rodrigo Andrade, Neto Amilton Clair Pinto Seixas, Mendonỗa Marcelo, Hartwig Daiane Drawanz, McBride Alan John Alexander, Dellagostin Odir Antonio (2015), Evaluation of the Leptospira interrogans Outer Membrane Protein OmpL37 as a Vaccine Candidate, PloS one, 10(11): p e0142821 47 Palaniappan Raghavan UM, Chang Yung-Fu, Chang Chao-Fu, Pan MJ Yang CW, Harpending Peter, McDonough Sean P, Dubovi Edward, Divers Thomas, Qu Jiaxin (2005), Evaluation of lig-based conventional and real time PCR for the detection of pathogenic leptospires, Molecular and cellular probes, 19(2): p 111-117 48 Palaniappan Raghavan UM, Chang Yung-Fu, Jusuf SSD, Artiushin S, Timoney John F, McDonough Sean P, Barr Steve C, Divers Thomas J, Simpson Kenneth W, McDonough Patrick L (2002), Cloning and molecular characterization of an immunogenic LigA protein of Leptospira interrogans, Infection and immunity, 70(11): p 5924-5930 49 Palaniappan Raghavan UM, McDonough Sean P, Divers Thomas J, Chen Chia-Sui, Pan Ming-Jeng, Matsumoto Mitsuharu, Chang Yung-Fu (2006), Immunoprotection of recombinant leptospiral immunoglobulinlike protein A against Leptospira interrogans serovar Pomona infection, Infection and immunity, 74(3): p 1745-1750 50 Palaniappan Raghavan UM, Ramanujam Subbupoongothai, and Chang Yung-Fu (2007), Leptospirosis: pathogenesis, immunity, and diagnosis Current opinion in infectious diseases, 20(3): p 284-292 51 Park Se-Hoon, Ahn Byung-Yoon, and Kim Min-Ja (1999), Expression and immunologic characterization of recombinant heat shock protein 58 of Leptospira species: a major target antigen of the humoral immune response, DNA and cell biology, 18(12): p 903-910 52 Picardeau M (2013), Diagnosis and epidemiology of leptospirosis, Mộdecine et maladies infectieuses, 43(1): p 1-9 53 Picardeau Mathieu, Bauby Hộlốne, and Saint Girons Isabelle (2003), Genetic evidence for the existence of two pathways for the biosynthesis of methionine in the Leptospira spp, FEMS microbiology letters, 225(2): p 257-262 54 Priya C Gowri, Bhavani K, Rathinam SR, Muthukkaruppan VR (2003), "Identification and evaluation of LPS antigen for serodiagnosis of uveitis associated with leptospirosis", Journal of medical microbiology, 52(8): p 667-673 55 Ren Shuang-Xi, Fu Gang, Jiang Xiu-Gao, Zeng Rong, Miao You-Gang, Xu Hai, Zhang Yi-Xuan, Xiong Hui, Lu Gang, Lu Ling-Feng (2003), Unique physiological and pathogenic features of Leptospira interrogans revealed by whole-genome sequencing, Nature, 422(6934): p 888-893 56 Rettinger Anna, Krupka Inke, Grỹnwald Karola, Dyachenko Viktor, Fingerle Volker, Konrad Regina, Raschel Heribert, Busch Ulrich, Sing Andreas, Straubinger Reinhard K (2012), Leptospira spp strain identification by MALDI TOF MS is an equivalent tool to 16S rRNA gene sequencing and multi locus sequence typing (MLST), BMC microbiology, 12(1): p 185 57 Sambrook (2011), Molecular cloning: a laboratory manual 58 Seixas Fabiana Kửmmling, Fernandes Claudia Hartleben, Hartwig Daiane Drawanz, Conceicao Fabricio Rochedo, Aleixo Jose Antonio Guimaraes, Dellagostin Odir Antonio (2007), "Evaluation of different ways of presenting LipL32 to the immune system with the aim of developing a recombinant vaccine against leptospirosis", Canadian journal of microbiology, 53(4): p 472-479 59 Silva ẫverton F, Medeiros Marco A, McBride Alan JA, Matsunaga Jim, Esteves Gabriela S, Ramos Joóo GR, Santos Cleiton S, Croda Jỳlio, Homma Akira, Dellagostin Odir A (2007), The terminal portion of leptospiral immunoglobulin-like protein LigA confers protective immunity against lethal infection in the hamster model of leptospirosis, Vaccine, 25(33): p 6277-6286 60 Smythe Lee D, Smith Ina L, Smith Greg A, Dohnt Michael F, Symonds Meegan L, Barnett Leonie J, McKay David B (2002), A quantitative PCR (TaqMan) assay for pathogenic Leptospira spp, BMC infectious diseases, 2(1): p 13 61 Talwani Rohit, Gilliam Bruce L, and Howell Charles (2011), Infectious diseases and the liver, Clinics in liver disease, 15(1): p 111-130 62 Vanasco Norma Bibiana, Schmeling MF, Lottersberger Javier, Costa Federico, Ko Albert Icksang, Tarabla Hộctor Dante (2008), Clinical characteristics and risk factors of human leptospirosis in Argentina (19992005), Acta Tropica, 107(3): p 255-258 63 Wang Zhijun, Jin Li, and Wgrzyn Alicja (2007), Leptospirosis vaccines, Microbial Cell Factories, 6(1): p 39 64 Wasinski Bernard and Dutkiewicz Jacek (2013), Leptospirosis-current risk factors connected with human activity and the environment, Annals of Agricultural and Environmental Medicine, 20(2) 65 Xiao Di, Zhang Cuicai, Zhang Huifang, Li Xiuwen, Jiang Xiugao, Zhang Jianzhong (2015), "A novel approach for differentiating pathogenic and non-pathogenic Leptospira based on molecular fingerprinting", Journal of proteomics, 119: p 1-9 66 Yanagihara Yasutake, Villanueva Sharon YAM, Yoshida Shin-ichi, Okamoto Yoshihiro, Masuzawa Toshiyuki (2007), Current status of leptospirosis in Japan and Philippines, Comparative immunology, microbiology and infectious diseases, 30(5): p 399-413 67 Yang Hong-Liang, Zhu Yong-Zhang, Qin Jin-Hong, He Ping, Jiang XuCheng, Zhao Guo-Ping, Guo Xiao-Kui (2006), In silico and microarray- based genomic approaches to identifying potential vaccine candidates against Leptospira interrogans, BMC genomics, 7(1): p 293 68 Ye Cuilian, Yan Weiwei, McDonough Patrick L, McDonough Sean P, Mohamed Hussni, Divers Thomas J, Chang Yung-Fu, Yang Zhibang (2014), Serodiagnosis of equine leptospirosis by enzyme-linked immunosorbent assay using four recombinant protein markers, Clinical and Vaccine Immunology, 21(4): p 478-483 69 Zuerner Richard, Haake David, Adler Ben, Segers Ruud (2000), "Technological advances in the molecular biology of Leptospira", Journal of molecular microbiology and biotechnology, 2(4): p 455462 PH LC Trỡnh t gen 16S rDNA ca chng L interrogans serovar Bataviae GACCGGGGGGGGGACCTGAGCAGCGACGCCGCGTGAACGATGAA GGTCTTCGGATTGTAAAGTTCAGTAAGCAGGGAAAAATAAGCAGC AATGTGATGATGGTACCTGCCTAAAGCACCGGCTAACTACGTGCC AGCAGCCGCGGTAATACGTATGGTGCAAGCGTTGTTCGGAATCAT TGGGCGTAAAGGGTGCGTAGGCGGACATGTAAGTCAGGTGTGAAA ACTGCGGGCTCAACTCGCAGCCTGCACTTGAAACTATGTGTCTGGA GTTTGGGAGAGGCAAGTGGAATTCCAGGTGTAGCGGTGAAATGCG TAGATATCTGGAGGAACACCAGTGGCGAAGGCGACTTGCTGGCCT AAAACTGACGCTGAGGCACGAAAGCGTGGGTAGTGAACGGGATTA GATACCCCGGTAATCCACGCCCTAAAGGTTGTCTACCAGTTGTTGG GGGTTTTAACCCTCAGTAACGAACCTAACGGATTAAGTAGACCGC CTGGGGACTATGCTCGCAAGAGTGAAACTCAATGAAATTTGACGG Trỡnh t gen 16S rDNA ca chng L interrogans serovar Mitis GGCCCAAGGGGGGGGACCTGAGCAGCGACGCCGCGTGAACGATGA AGGTCTTCGGATTGTAAAGTTCAGTAAGCMSGGAAAAATAAGCAG CAATGTGATGATGGTACCTGCCTAAAGCACCGGCTAACTACGTGCC AGCAGCCGCGGTAATACGTATGGTGCAAGCGTTGTTCGGAATCATT GGGCGTAAAGGGTGCGTAGGCGGACATGTAAGTCAGGTGTGAAAA CTGCGGGCTCAACTCGCAGCCTGCACTTGAAACTATGTGTCTGGAG TTTGGGAGAGGCAAGTGGAATTCCAGGTGTAGCGGTGAAATGCGT AGATATCTGGAGGAACACCAGTGGCGAAGGCGACTTGCTGGCCTA AAACTGACGCTGAGGCACGAAAGCGTGGGTAGTGAACGGGATTAA ATACCCCGGTAATCCACGCCCTAAACGTTGTCTACCAGTTGTTGGG GGTTTTAACCCTCAGTAACGAACCTAACGGATTAAGTAGACCGCCT GGGGACTATGCTCGCAAGAGTGAAACTCAAATGAATTGACGGA Trỡnh t gen 16S rDNA ca chng L interrogans serovar Pomona GGATGGCCGTCCCAGGGCGGTCTACTTAATCCGTTAGGTTCGTTAC TGAGGGTTAAAACCCCCAACAACTGGTAGACCACGTTTAGGGCGT GGATTACCGGGGTATCTAATCCCGTTCACTACCCACGCTTTCGTGC CTCAGCGTCAGTTTTAGGCCAGCAAGTCGCCTTCGCCACTGGTGTT CCTCCAGATATCTACGCATTTCACCGCTACACCTGGAATTCCACTT GCCTCTCCCAAACTCCAGACACATAGTTTCAAGTGCAGGCTGCGA GTTGAGCCCGCAGTTTTCACACCTGACTTACATGTCCGCCTACGCA CCCTTTACGCCCAATGATTCCGAACAACGCTTGCACCATACGTATT ACCGCGGCTGCTGGCACGTAGTTAGCCGGTGCTTTAGGCAGGTAC CATCATCACATTGCTGCTTATTTTTCCCTGCTTACTGAACTTTACAA TCCGAAGACCTTCATCGTTCACGCGGCGTCGCTGCTTCAGGGTTCC CCCCAATATAGAATAATCCTAATCGGCCGTGCCCCATCAGCCAAG GCATTAATAACCCTGGCCAAGGGGGGGGAAACCCAAAAACCCCCC CCCCCGAGAAAGAAAAAATTTCCCCAATAGTAAAATTTTTCAAAA AGGGGGAAAAAAAAAACCCCCCGGGGAAAAAGGGTCCCCCCCCA AAGCCCCGAAAAAAGGGGGCCCCCCCGGGGAAAAAAATAAGGGG GGAAATGTTTTTAACAAAAAATTGCGGGCAAACAGGGGGGGGAG GGGGGGAAATAGATATTAGGTGGGATAAAAAACGAGACGCGCGG GGTGTTGCAAAAAAAACCTTTGCGCGTAGTGGTGAGAGAGAGAAG AGACCCCCTCTCCCGCGTGGGGCGCGGGGAAATATTATAATATTTT GGAAAGACACATCACGAGCAGACCAGCATTAAGGTATAACACTAG CTAAACTAGACTGAGCATACGA Trỡnh t gen 16S rDNA ca chng L interrogans serovar Canicola GGGCGTGGGGGGCAAATCTGACCACCCATGCCGCGTGAAGGATGA AGGTCCTCTGGATTGTAAACTTCTTTTATAGGGGGCGAAAAAAGG GAAATCTTTCTCACTTGACCGTACCCTATGAATAACACACCGGCTA ACTCCGTGCCAGCAAACCGCGGTACATACGGAGGGTGCAAGCGTT ATCCGGATTCACTGGGTTTAAAGGGTGCGTAGGCGGGCGTATAAG TCAAATGGTGAAATCCTGGAGCTTATCTCCAGAACTGCCATTGATA CTATATGTCTTGAATATGGTGGAGGTAACCGGAATATGTCATGTAG CGGTGAAATGCATAAATATGAACATAGAACACCTATTGCGAAGGC GGCTTACTACGCCTATTTTGACCCTAAGGCACGAAAGCGTGGGGA TCAAACAGGATTAGATACCCTGGTACTCCACGCCCTAAACCATGAT TACTCGACGTGTGCGATAAACGGTACGCGTCTGAGCGAAAGCATT AAGTAATCCACCTGGGAAGTACGACCGCAAGGTTGAAACTCAAAT GAAATTGACGG Trỡnh t gen 16S rDNA ca chng L interrogans serovar Grippotyphosa TTAACCTTGGGGGCACCTGTATCAGCGCAGGCCGCGTGAACGACG AAGGTCTTCGGATTGTAAAGTTCATTAGGCAGGGAAAAATAAGCA ACCTTGTGATGATGGTACCTGCCTAAAGCACCGGATAACTACCTGC CAGCAACCGCGGTAATACCTATGGGGCAAGCGTTGTTCGGAATCA TTGGGCGTAAAGGGTGCGTAAGCGGACATGTAATTCAAGTGTGAA AACTGCGGGCTCACCTCATAGCCTGCACTTGAAACTATGTGTCTGG AGTTTGGGAGAGGCAAGTGGAATTCCAGGTGTACCGGTGAAATGC GTAAATATCTGGAGGAACACCAGTGGCGAAGGCACTTGCTGGCCT AAAACTGACGCTGAGGCACGAAAGCGTGGGTAGTGAACGGGATTA GATACCCCGGTAATCCACGCCCTAAACGTTGTCTACCACTTGTTGG GGGTTTTAACCCTCATTAACGAACCTAACGGATTAACTAGACCGCC TGGGGACTATGCTCGCAAGAGTGAAACTCAAATGAATTGACGG Trỡnh t gen 16S rDNA ca chng L interrogans serovar Icteroheamorrhagiae GCACGGAGGGGGGGCACCTGAGCAGCGACGCCGCGTGAACGATG AAGGTCTTCGGATTGTAAAGTTCAGTAAGCAGGGAAAAATAAGCA GCAATGTGATGATGGTACCTGCCTAAAGCACCGGCTAACTACGTG CCAGCAGCCGCGGTAATACGTATGGKGCAAGCGTTGTTCGGAATC ATTGGGCGTAAAGGGTGCGTAGGCGGACATGTAAGTCAGGTGTGA AAACTGCGGGCTCAACTCGCAGCCTGCACTTGAAACTATGTGTCTG GAGTTTGGGAGAGGCAAGTGGAATTCCRGGTGTAGCGGTGAAATG CGTAGATATCTGGAGGAACACCAGTGGCGAAGGCGACTTGCTGGC CTAAAACTGACGCTGAGGCACGAAAGCGTGGGTAGTGAACGGGAT TAGATACCCCGGTAATCCACGCCCTAAACGTTGTCTACCAGTTGTT GGGGGTTTTAACCCTCAGTAACGAACCTAACGGATTAAGTAGACC GCCTGGGGACTATGCTCGCAAGAGTGAAACTCAAATGAAATTGAC GGATAGCAAACCAAGAGTCTTGCTCACTGGGGGGAACCCTGAAGC ATTCACAACGCATGAGCCATCAACGTCGTCCAATTGTAAAAGTTCC CTAAGCAGGGAAGTATAARCAGCATGCTGAATGATTGTACCTGCC TAAAGGCACGGCTAATTACGTGCCGCRTCGGCCTAATACATTATGG GTGCAACGGGTTGTTTAGGAATCATTAGTAACGTAGAGAGGGCGA TATAGGGCGGAACATCGACAAGTCAGGATGTGAAAACTGGCGTGC TCACTACACTGCAATAGAAAAATAAACGTTATTCGAGGAGTTTCG GGAACAAGCAAATGATAATTCCCAGGATGTCACAAGGTGACAACC GTGGCTACAAAATRTCTCTCAGACAGGGA ... phòng bệnh xoắn khuẩn Leptospira Xuất phát từ thực tiễn đó, tiến hành thực đề tài Xác định số gen mã hóa yếu tố định kháng nguyên xoắn khuẩn Leptospira interrogans gây bệnh Leptospirosis Việt Nam ... loại hình chủng xoắn khuẩn Leptospira gây bệnh Leptospirosis, sử dụng chế vắc xin vô hoạt Việt Nam - Xác định có mặt số gen mã hóa kháng nguyên chủng xoắn khuẩn Leptospira gây bệnh Leptospirosis, ... phòng bệnh xoắn khuẩn Leptospira interrogans Việt Nam Mục tiêu nghiên cứu - Định danh chủng xoắn khuẩn Leptospira interrogans gây bệnh Leptospirosis, sử dụng chế vắc xin vô hoạt Việt Nam - Xác định