Tuyển chọn vi khuẩn có khả năng chuyển hóa nitơ ứng dụng xử lý nước thải trong công nghiệp thực phẩm

69 220 0
  • Loading ...
1/69 trang

Thông tin tài liệu

Ngày đăng: 09/07/2017, 22:25

Luận văn thạc sỹ kỹ thuật Công nghệ Thực phẩm LỜI CAM ĐOAN Tôi xin cam đoan luận văn công trình nghiên cứu thực cá nhân, hướng dẫn khoa học PGS.TS Nguyễn Lan Hương Các số liệu, kết nghiên cứu trình bày luận văn trung thực chưa công bố hình thức Tôi xin chịu trách nhiệm nghiên cứu Hà Nội, ngày 21 tháng 10 năm 2016 Học viên Nguyễn Thị Hà Trang i Nguyễn Thị Hà Trang – CA140138 Luận văn thạc sỹ kỹ thuật Công nghệ Thực phẩm LỜI CẢM ƠN Lời đầu tiên, xin bày tỏ lòng biết ơn sâu sắc tới PGS.TS Nguyễn Lan Hương tận tình hướng dẫn, tạo điều kiện giúp đỡ trình học tập, nghiên cứu hoàn thành luận văn Tôi xin chân thành cảm ơn thầy cô giáo, cán công tác Viện Công nghệ Sinh học Công nghệ Thực phẩm, Viện Đào tạo sau đại học – Trường Đại học Bách khoa Hà Nội dạy dỗ tạo điều kiện thuận lợi cho suốt trình học tập trường Tôi xin gửi lời cảm ơn đến quan nơi công tác: Trường Cao đẳng Công nghiệp Thực phẩm – Việt Trì ủng hộ, giúp đỡ, tạo điều kiện thuận lợi cho trình học tập Cuối cùng, xin chân thành cảm ơn động viên, giúp đỡ gia đình, bạn bè, đồng nghiệp trình học tập, nghiên cứu hoàn thiện luận văn Xin trân trọng cảm ơn! Hà Nội, ngày 21 tháng 10 năm 2016 Học viên Nguyễn Thị Hà Trang ii Nguyễn Thị Hà Trang – CA140138 Luận văn thạc sỹ kỹ thuật Công nghệ Thực phẩm MỤC LỤC LỜI CAM ĐOAN i LỜI CẢM ƠN ii DANH MỤC CHỮ VIẾT TẮT vi DANH MỤC CÁC BẢNG vii DANH MỤC CÁC HÌNH viii MỞ ĐẦU 1 Lý chọn đề tài Mục đích nghiên cứu Ý nghĩa khoa học thực tiễn đề tài Đối tượng phạm vi nghiên cứu 4.1 Đối tượng 4.2 Phạm vi nghiên cứu CHƯƠNG I TỔNG QUAN 1.1 Sơ lược ngành công nghiệp thực phẩm 1.2 Đặc tính chung nước thải ngành công nghiệp thực phẩm 1.3 Hiện trạng nước thải giết mổ Việt Nam 1.3.1 Tình hình giết mổ Việt Nam 1.3.2 Tình hình giết mổ địa bàn thành phố Việt Trì 1.3.3 Công nghệ giết mổ gia súc, gia cầm 1.4 Nguồn gốc đặc tính nước thải lò mổ 1.4.1 Nguồn gốc nước thải lò mổ 1.4.2 Thành phần tính chất nước thải giết mổ gia súc, gia cầm 1.5 Các nghiên cứu xử lý nước thải lò mổ gia súc, gia cầm 10 1.5.1 Trong nước 10 1.5.2 Ngoài nước 11 a Xử lý kỵ khí 11 b Xử lý hiếu khí 12 1.6 Vai trò vi sinh vật chuyển hóa nitơ nước thải 13 1.6.1 Quá trình amon hoá 14 1.6.2 Quá trình nitrat hóa 14 1.6.3 Quá trình phản nitrat 15 iii Nguyễn Thị Hà Trang – CA140138 Luận văn thạc sỹ kỹ thuật Công nghệ Thực phẩm 1.6.4 Quá trình anammox 16 CHƯƠNG II: VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 20 2.1 Vật liệu 20 2.1.1 Đối tượng nghiên cứu 20 2.1.2 Dụng cụ hóa chất 20 2.2 Phương pháp nghiên cứu 22 2.2.1 Sơ đồ nghiên cứu 22 2.2.2 Các phương pháp nuôi cấy 23 2.2.3 Phương pháp nhuộm Gram [8] 23 2.2.4 Các phương pháp phân tích 23 a Phương pháp xác định hàm lượng NH4+ [15] 23 b Phương pháp xác định hàm lượng NO2- [15] 24 c Phương pháp xác định hàm lượng NO3- [33] 24 d Phương pháp xác định khí N2 [21, 27] 24 e Xác định pH [10] 25 f Phương pháp xác định BOD5 25 g Phương pháp xác định COD [33] 25 h Phương pháp xác định hàm lượng tổng chất rắn lơ lửng (TSS) [11] 25 h Phương pháp xác định nitơ tổng [33] 25 2.2.5 Định tên vi sinh vật phương pháp sinh học phân tử 28 a Tách chiết DNA tổng số [4] 28 b Phương pháp điện di gel agarose [4] 29 c Phản ứng PCR nhân đoạn gen 16S rRNA [4] 29 CHƯƠNG III: KẾT QUẢ VÀ THẢO LUẬN 31 3.1 Đặc trưng nước thải giết mổ gia cầm thành phố Việt Trì 31 3.2 Phân lập đánh giá vi khuẩn chuyển hóa nitơ 32 3.2.1 Phân lập vi khuẩn chuyển hóa amon 32 3.2.2 Khả chuyển hóa amon 34 3.2.3 Phân lập vi khuẩn chuyển hóa nitrit thành nitrat hóa 36 3.2.4 Khả chuyển hóa nitrit thành nitrat 37 3.2.5 Phân lập vi khuẩn phản nitrat hóa 38 3.2.6 Khả phản nitrat hóa 39 3.3 Định tên chủng vi khuẩn kỹ thuật sinh học phân tử 41 3.3.1 Tách DNA tổng số 42 3.2.2 PCR phân đoạn gen 16S rRNA 43 iv Nguyễn Thị Hà Trang – CA140138 Luận văn thạc sỹ kỹ thuật Công nghệ Thực phẩm 3.3.3 Giải trình tự DNA 43 3.4 Bước đầu ứng dụng xử lý nước thải giết mổ gia cầm 44 3.4.1 Sự biến động amon, nitrit, nitrat trình xử lý nước thải 44 3.4.2 Sự phản nitrat hóa 47 PHẦN IV KẾT LUẬN VÀ KIẾN NGHỊ 48 4.1 Kết luận 48 4.2 Kiến nghị 48 TÀI LIỆU THAM KHẢO 49 PHỤ LỤC 53 v Nguyễn Thị Hà Trang – CA140138 Luận văn thạc sỹ kỹ thuật Công nghệ Thực phẩm DANH MỤC CHỮ VIẾT TẮT Chữ viết tắt Tên tiếng anh Tên tiếng việt Anaerobic baffled reactor Thiết bị vách ngăn kỵ khí AF Anaerobic filter Lọc kỵ khí AL Anaerobic lagoon Hồ kỵ khí AOB Ammonium oxidizing bacteria Vi khuẩn oxi hóa amon BOD5 Biochecmical oxygen demand Nhu cầu oxy sinh hóa COD Chemical oxygen demand Nhu cầu oxy hóa học HRT Hydraulic rêtntion time Thời gian lưu nước thải Mixed liquor volatile Hàm lượng chất rắn lơ lửng dễ suspended solid bay NOB Nitrite oxidation bacteria Vi khuẩn oxi hóa nitrit OLR organic loading rates Tải trọng hữu PCR Polymerase chain reaction Phản ứng chuỗi trùng hợp ABR MLVSS Quy chuẩn Việt Nam QCVN ROE Return on equity Tỷ số lợi nhận ròng vốn chủ sở hữu ROA Return on assets Tỷ số lợi nhận trước thuế vốn chủ sở hữu TN Total nitrogen Nitơ tổng Tiêu chuẩn Việt Nam TCVN TOC Total organic carbon Tổng số carbon hữu TSS Total suspended solids Tổng chất rắn lơ lửng Upflow Anaerobic Slugde Thiết bị xử lý kỵ khí với dòng Blanket chảy ngược qua lớp bùn hoạt tính UASB vi Nguyễn Thị Hà Trang – CA140138 Luận văn thạc sỹ kỹ thuật Công nghệ Thực phẩm DANH MỤC CÁC BẢNG Bảng 1.1 Hàm lượng nitơ tổng nước thải công nghiệp thực phẩm Bảng 1.2 Số lượng gia cầm giết mổ thành phố Việt Trì Bảng 1.3 Đặc tính chung nước thải lò mổ gia cầm Bảng 3.1 Đặc tính nước thải giết mổ gia cầm thành phốViệt Trì 31 Bảng 3.2 Địa điểm số chủng phân lập có khả chuyển hóa cao 32 Bảng 3.3 Đặc điểm tế bào khuẩn lạc vi khuẩn nitrit hóa 32 Bảng 3.4 Đặc điểm tế bào khuẩn lạc vi khuẩn chuyển hóa nitrit thành 36 nitrat Bảng 3.5 Đặc điểm tế bào khuẩn lạc vi khuẩn phản nitrat 38 Bảng 3.6 Nồng độ DNA dịch chiết 42 Bảng 3.7 Mức độ tương đồng định danh chủng Su, H5 T4 43 vii Nguyễn Thị Hà Trang – CA140138 Luận văn thạc sỹ kỹ thuật Công nghệ Thực phẩm DANH MỤC CÁC HÌNH Hình 1.1 Dây chuyền giết mổ gia cầm Hình 1.2 Chu trình chuyển hóa hợp chất nitơ 13 Hình 2.1 Nước thải giết mổ gia cầm 20 Hình 2.2 Sơ đồ nghiên cứu 22 Hình 3.1 Đặc điểm hình thái khuẩn lạc chủng T1, T2, T4, T5 33 Hình 3.2 Đặc điểm tế bào chủng T1, T2, T4, T5 34 Hình 3.3 Hiệu suất chuyển hóa amon chủng T1, T2, T4, T5 34 Hình 3.4 Hiệu suất nitrit hóa chủng T1, T2, T4, T5 35 Hình 3.5 Tỷ lệ amon chuyển hóa chủng T1, T2, T4 T5 vào ngày thứ 35 Hình 3.6 Đặc điểm hình thái khuẩn lạc chủng H3 H5 37 Hình 3.7 Đặc điểm tế bào chủng H3 H5 37 Hình 3.8 Hiệu suất chuyển hóa nitrit chủng H3 H5 37 Hình 3.9 Hiệu suất nitrat hóa chủng H3 H5 38 Hình 3.10 Đặc điểm hình thái khuẩn lạc chủng Su, Ha U1 39 Hình 3.11 Đặc điểm tế bào chủng Su, Ha U1 39 Hình 3.12 Hiệu suất chuyển hóa nitrat chủng Su, Ha U1 40 Hình 3.13 Hiệu suất sinh khí nitơ chủng Su, Ha U1 40 Hình 3.14 Điện di DNA tổng số chủng T4, Su H5 42 Hình 3.15 Điện di sản phẩm PCR chủng T4, Su H5 43 Hình 3.16 Khả chuyển hóa amon chủng T4, H5 nước thải lò mổ 45 Hình 3.17 Khả chuyển hóa nitrit chủng T4, H5 nước thải lò mổ 46 Hình 3.18 Khả nitrat hóa chủng T4, H5 nước thải lò mổ 46 Hình 3.19 Khả phản nitrat chủng Su nước thải lò mổ 47 viii Nguyễn Thị Hà Trang – CA140138 Luận văn thạc sỹ kỹ thuật Công nghệ Thực phẩm MỞ ĐẦU Lý chọn đề tài Công nghiệp thực phẩm xem ngành công nghiệp quan trọng quốc gia Phát triển công nghệ thực phẩm không cung cấp sản phẩm đảm bảo cho nhu cầu ăn uống người dân nước mà để xuất khẩu, góp phần thúc đẩy phát triển chung kinh tế quốc dân [6] Trong trình chế biến thực phẩm lượng lớn nước thải thải môi trường Nước thải chế biến thực phẩm có đặc điểm hàm lượng chất hữu dễ phân hủy sinh học chất rắn lơ lửng cao Bên cạnh đó, nước thải số trình chế biến thịt, gia cầm, thủy sản chứa lượng lớn hợp chất nitơ vi sinh vật gây bệnh [20] Nước thải lò mổ chứa nhiều thành phần phức tạp như: protein, chất béo chất xơ với hàm lượng ô nhiễm cao không đạt theo tiêu chuẩn xả thải QCVN40:2011/BTNMT Các chất rắn lơ lửng nước thải lò mổ (bao gồm: thịt, máu, mỡ, lông, móng…) cao làm tăng độ đục khiến ánh sáng khó chiếu xuống tầng đáy ảnh hưởng tới trình quang hợp tảo rong rêu Hàm lượng nitơ nước thải lò mổ cao, hợp chất nitơ tồn nhiều dạng khác nhau, chủ yếu là: amon (NH4+), nitrit (NO2-) nitrat (NO3-) Hàm lượng nitơ nước cao gây tượng phú dưỡng tác động tiêu cực môi trường như: cạn kiệt nguồn oxy hòa tan nước gây độc cho động - thực vật thủy sinh, ảnh hưởng xấu đến người [40] Do đó, cần phải loại bỏ nitơ trước thải môi trường Quy trình loại bỏ nitơ bao gồm trình: nitrat hóa phản nitrat hóa Quá trình nitrat hóa xảy theo bước giai đoạn nitrit nitrat hóa Bước giai đoạn nitrit hóa: amon oxi hóa thành nitrit nhờ vi khuẩn oxi hóa amon (AOB) Bước thứ giai đoạn nitrat hóa: nitrit oxi hóa thành nitrat nhờ vi khuẩn oxi hóa nitrit (NOB) Trong trình phản nitrat: hợp chất nitrat nitrit bị khử hoàn toàn đến sản phẩm cuối khí N2 [37] Quy trình loại bỏ nitơ nước thải thực nhiều loài vi khuẩn theo đường Nguyễn Thị Hà Trang – CA140138 Luận văn thạc sỹ kỹ thuật Công nghệ Thực phẩm khác [31] [42] Với mong muốn thúc đẩy nhanh trình xử lý nitơ nước thải thực phẩm nói chung nước thải lò mổ nói riêng, chọn đề tài: “Tuyển chọn vi khuẩn có khả chuyển hóa nitơ ứng dụng xử lý nước thải công nghiệp thực phẩm” Mục đích nghiên cứu Tuyển chọn số chủng vi khuẩn địa có khả chuyển hóa amon, nitrat hóa phản nitrat hóa cao nhằm ứng dụng xử lý nước thải lò mổ Ý nghĩa khoa học thực tiễn đề tài Ý nghĩa khoa học Kết nghiên cứu đề tài góp phần làm sáng tỏ vai trò vi khuẩn chuyển hóa nitơ Việc phân lập tuyển chọn số chủng vi khuẩn chuyển hóa nitơ nước thải lò mổ góp phần vào việc bảo tồn nguồn gen vi sinh vật địa hữu ích Ý nghĩa thực tiễn Thành công đề tài góp phần vào việc sản xuất ứng dụng chế phẩm vi sinh ứng dụng bảo vệ môi trường nhằm nâng cao hiệu suất giảm thời gian xử lý, tiết kiệm chi phí nhân công thiết bị Đối tượng phạm vi nghiên cứu 4.1 Đối tượng Nước thải lò mổ gia cầm thành phố Việt Trì 4.2 Phạm vi nghiên cứu - Nghiên cứu phân lập tuyển chọn chủng vi khuẩn từ nước thải lò mổ gia cầm bước đầu đánh giá khả xử lý nước thải lò mổ - Các thí nghiệm tiến hành trường Đại học Bách khoa Hà Nội Nguyễn Thị Hà Trang – CA140138 Luận văn thạc sỹ kỹ thuật Công nghệ Thực phẩm lượng nitrit mẫu đối chứng tăng dần Hàm lượng nitrit nước thải mẫu có bổ sung chủng vi khuẩn T4 H5 chuyển hóa thành nitrat Hàm lượng nitrat mẫu T4, H5 tăng 3,6 5,2 lần so với đối chứng Hiệu suất nitrat hóa chủng T4 H5 60% 91% Như vậy, hai chủng T4 H5 đưa vào nước thải lò mổ nâng cao hiệu suất nitrat hóa amon mà không tích lũy nitrit (là chất có độ độc cao) Chủng H5 có khả nitrat cao nên sử dụng cho nghiên cứu tiếp 3.5.2 Sự phản nitrat hóa Hình biểu diễn hiệu suất phản nitrat hóa chủng Su mẫu nước thải lò mổ sau nitrat hóa H5 với hàm lượng N-NO3- ban đầu 152 Hiệu suất chuyển hóa nitrat (%) mg/L 100 80 60 40 20 0 Thời gian (ngày) ĐC Su Hình 3.19 Khả phản nitrat chủng Su nước thải lò mổ Kết khả phản nitrat hóa chủng Su tăng nhanh ngày đầu Hiệu suất phản nitrat hóa đạt 2,7% sau ngày, tăng 13,6 lần so với đối chứng 47 Nguyễn Thị Hà Trang – CA140138 Luận văn thạc sỹ kỹ thuật Công nghệ Thực phẩm PHẦN IV KẾT LUẬN VÀ KIẾN NGHỊ 4.1 Kết luận Từ mẫu nước thải lò giết mổ thành phố Việt Trì – Phú Thọ phân lập tuyển chọn chủng nitrit hóa, chủng nitrat hóa chủng phản nitrat hóa, chủng T4, H5 Su có hoạt tính cao Hiệu suất chuyển hóa amon chủng T4 đạt 3,21 , hiệu suất chuyển hóa nitrit thành nitrat chủng H5 đạt 3,3 %, hiệu suất phản nitrat chủng Su đạt 7,34% Đã định tên chủng T4, H5 Su kỹ thuật 16S rDNA Kết hợp với đặc điểm nuôi cấy tế bào, chủng T4, H5 Su Spingobacterium multivorum T4, Rhodococcus rhodochrous H5 Pseudomonas stulzeri Su Đã thử nghiệm xử lý nước thải lò mổ gia cầm với chủng T4, H5 Su Bổ sung chủng nâng cao hiệu xử lý nước thải lò mổ gia cầm Hiệu suất chuyển hóa amon bổ sung chủng T4 H5 đạt 88,36% 93,30% tương ứng tăng 5,5 5,8 lần Hiệu suất nitrat hóa chủng T4 H5 đạt 60% 91% tương ứng tăng 3,6 5,2 lần Hiệu suất phản nitrat hóa chủng Su đạt 2,7% tăng 13,6 lần 4.2 Kiến nghị Tối ưu hóa điều kiện nuôi thu sinh khối chủng T4, H5 Su Nghiên cứu tạo loại chế phẩm vi sinh cho xử lý nước thải có hàm lượng nitơ cao Thử nghiệm chế phẩm quy mô xử lý nước thải lò mổ khác 48 Nguyễn Thị Hà Trang – CA140138 Luận văn thạc sỹ kỹ thuật Công nghệ Thực phẩm TÀI LIỆU THAM KHẢO TÀI LIỆU TIẾNG VIỆT 10 11 12 13 14 15 16 17 Ban phân tích dự báo (2015) Báo cáo ngành hàng Thịt Việt Nam năm 2015 triển vọng 2016 Trung tâm Thông tin PT NNNT p 45 - 46 CTy CP chế tạo thiết bị môi trường xanh Vinh Hoa Available from: http://hatixa.com.vn/day-chuyen-giet-mo-ga.html Cục xúc tiến thương mại (2012) Tiêu thụ thực phẩm đồ uống Việt Nam giai đoạn 2010 - 2016 Khuất Hữu Thanh (2006) Kỹ thuật gen: Nguyên lý ứng dụng NXB Khoa học kỹ thuật Lê Công Nhất Phương, Lê Thị Cẩm Huyền, Nguyễn Huỳnh Tấn Long, (2012) Xử lý ammonium nước thải giết mổ việc sử dụng kết hợp trình nitrit hóa phần/anammox Tạp chí Sinh học 34(3se) p 105 - 110 Lê Văn Việt Mẫn, Lê Quốc Đạt, Nguyễn Thị Hiền, Tôn Nữ Nguyệt Minh, Trần Thị Thu Trà, (2011) Công nghệ chế biến thực phẩm Nhà xuất Đại học Bách Khoa Hồ Chí Minh Ngô Thị Kim Toán, Nguyễn Quang Huy (2012) Nghiên cứu phân lập tuyển chọn chủng vi sinh vật ứng dụng xử lý nước thải giàu nitơ, photpho Ngô Thị Phương Nam, Phạm Khắc Liệu, Trịnh Thị Giao Chi, (200 ) Nghiên cứu xử lý nước thải giết mổ gia súc trình sinh học hiếu khí thể bám vật liệu polymer tổng hợp TẠP CHÍ KHOA HỌC, Đại học Huế, Số Nguyễn Đức Lượng, Phan Thị Huyền, Nguyễn Ánh Tuyết (2003) Thí nghiệm công nghệ sinh học, tập 2, thí nghiệm Vi sinh vật học NXB Đại học Quốc Gia TP Hồ Chí Minh Nguyễn Thi Thanh, Nguyễn Thị Trang, Tô Kim Anh, Nguyễn Lan Hương, (2015) Tuyển chọn chủng vi khuẩn Paracoccus denitrificans E1 nước thải trình sơ chế mủ cao su thiên thiên Tạp chí Công nghệ sinh học, 3(13) p 01 - 906 Nguyễn Văn Cách cộng (2010) Báo cáo khoa học đề tài "Nghiên cứu ứng dụng công nghệ vi sinh hệ thống thiết bị tiết kiệm lượng để xử lý nước thải sinh hoạt đô thị" Mã số KC.04.23/06 -10 Trung tâm Tư liệu Quốc gia Việt Nam TCVN 6492 (2011) CHẤT LƯỢNG NƯỚC – XÁC ĐỊNH pH TCVN 6625 (2000) Chất lượng nước – Xác định chất rắn lơ lửng cách lọc qua lọc sợi thủy tinh Trần Cẩm Vân (2005) Giáo trình vi sinh vật học môi trường Đại học Quốc gia Hà Nội Trần Liên Hà (200 ) Báo cáo khoa học đề tài "Nghiên cứu sử dụng chế phẩm sinh học vi sinh vật để xử lý nước hồ bị ô nhiễm Mã số 01C-09/08-2006-2, Sở Khoa học Công nghệ Hà Nội Trần Thị Thu Lan, Nguyễn Văn Cách, Lê Thị Hương, Trần Thì Hồng Hương, (2016) Khảo sát điều kiện nuôi chủng B Velezensis thử nghiệm lực xử lý nước thải giết mổ gia súc Tạp chí khoa học công nghệ p 213-220 Vấn đề giết mổ gia súc gia cầm tập trung: Cần chế quản lý chặt chẽ 2013; Available from: http://baophutho.vn/kinh-te/201308/van-de-giet-mo-gia-suc-giacam-tap-trung-can-mot-co-che-quan-ly-chat-che-2265078/ 49 Nguyễn Thị Hà Trang – CA140138 Luận văn thạc sỹ kỹ thuật 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 Công nghệ Thực phẩm Viện khoa học kĩ thuật môi trường (2013) Phân tích tiêu hóa học nước thải Trường Đại học Xây dựng Viện Sinh học nhiệt đới Một số chế phẩm sinh học tiêu biểu nhóm nhà khoa học phòng vi sinh Available from: http://www.vast.ac.vn Abdalla S.M Ammar (2014) Food Processing Wastes: Characteristics, Treatments and Utilization: Review Journal of Agricultural and Veterinary Sciences, Vol 7, No p 71-84 Abimbola M Enitan, Josiah Adeyemo, Sheena Kumari, Feroz M Swalaha, Faizal Bux, (2015) Characterization of Brewery Wastewater Composition International Journal of Environmental Chemical, Ecological, Geological and Geophysical Engineering, Vol.9(9) p 1057 – 1060 Al-Mutairi, N.Z (2008) Aerobic selectors in slaughterhouse activated sludge systems: a preliminary investigation Bioresour Technol 100 (1) p 50-58 Ali Nejidat, Limor Kafka, Yoram Tekoah, Zeev Ronen, (2008) Effect of organic and inorganic nitrogenous compounds on RDX degradation and cytochrome P-450 expression in Rhodococcus strain YH1 Biodegradation 19 p 313 Baumann B, Snozzi M, Zehnder AJB, Meer JRVD, (1996) Dynamics of denitrification activity of Paracoccus denitrificans in continuous culture during aerobic-anaerobic changesl J Bacterio p 4367-74 Bernet N, Dang Cong P, Delgenès J, and Moletta R, (2001) Nitrification at low oxygen concentration in biofilm reactor Journal of Environmental Engineering, 127 (3) p 266-271 Bi - Shuang Chen, Linda G Otten, Verena Resch, Gerard Muyzer, Ulf Hanefeld, (2013) Draft genome sequence of Rhodococcus rhodochrous strain ATCC 17895 Stand Genomic Sci Oct 16; p 175–184 Bustillo-Lecompte, C.F, Knight, M, Mehrvar, M, (2015) Assessing the performance of UV/H2O2 as a pretreatment process in TOC removal of an actual petroleum refinery wastewater and its inhibitory effects on activated sludge Can J Chem Eng 93 (5) p 798-807 Bustillo - Lecompte, C.F, Mehrvar, M, Qui~nones-Bola~nos, E, (2014) Costeffectiveness analysis of TOC removal from slaughterhouse wastewater using combined anaerobic-aerobic and UV/H2O2 processes J Environ Manag 134 p 145-152 Cao, W Mehrvar, M, (2011) Slaughterhouse wastewater treatment by combined anaerobic baffled reactor and UV/H2O2 processes Chem Eng Res Des 89 (7) Curtis A.Calson, John L.Ingramham, (1983) Comparison of denitrification by Pseudomonas stutzeri, Pseudomonas aeruginosa, and Paracoccusdenitrificans Applied and Environment microbiology, p 1247-1253, Dallago C.R, Gomes S.D, Mees J.B.R, de Assis T.M, Hasan S.D.M, Kunz A, (2012) Nitrification and denitrification of a poultry slaughterhouse wastewater according to cycle time and ammoniacal nitrogen concentration using surface response methodology Journal of Food, Agriculture & Environment, 10 (2) p 856 - 860 F Barahona and J Slim (2015) Sphingobacterium multivorum: case report and literature review New Microbes New Infect Sep p 33–36 H R Jones) Pollution control in the dairy industry London 50 Nguyễn Thị Hà Trang – CA140138 Luận văn thạc sỹ kỹ thuật 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 Công nghệ Thực phẩm Hach company (2007) DR 2800 Spectrophotometer: Procedures Manual Hach company, Catalog Number DOC022.53.00725, Jorge Lalucat, Antoni Bennasar, Rafael Bosch, Elena García-Valdés, Norberto J Palleroni, (2006) Biology of Pseudomonas stutzeri Microbiol Mol Biol Rev Jun 70(2) p 510–547 Kim J.K, Park K J, Cho K.S, Nam S-W, Park T-J, and Bajpai R, (2005) Aerobic nitrification–denitrification by heterotrophic Bacillus strains Bioresource Technology, 96 (17) p 1897-1906 Kundu P, Pramanik A, Mitra S, Choudhury J.D, Mukherjee J, Mukherjee S, (2012) Heterotrophic nitrification by Achromobacter xylosoxidans S18 isolated from a small-scale slaughterhouse wastewater Bioprocess Biosyst Eng 35 p 721 – 728 Kusçu, O.S., Sponza, D.T., (2005) Performance of anaerobic baffled reactor (ABR) treating synthetic wastewater containing p-nitrophenol Enzyme Microb Technol 36 (7) p 888-895 Lu Yu, Yanjun Liu, Gejiao Wang, ( 2009) Identification of novel denitrifying bacteria Stenotrophomonas sp ZZ15 and Oceanimonas sp YC13 and application for removal of nitrat from industrial wastewater Biodegradation, p 391–400, Mees J.B.R, Gomes S.D, Sampaio S.C, Hasan S.D.M, Santos Cordovil C.S.C.M, (2014) Application of the response surface methodology for optimisation of biological nutrient removal from slaughterhouse effluents Journal of Food, Agriculture & Environment, 12(2) p 786 – 792 Mittal, G.S (2006) Treatment of wastewater from abattoirs before land application a review Bioresour Technol 97 (9) p 1119-1135 Pan M, Henry L.G, Liu R, Huang X, Zhan X, (2014) Nitrogen removal from slaughterhouse wastewater through partial nitrification followed by denitrification in intermittently aerated sequencing batch reactors at 11°C Environmental Technology 35(4) p 470 - 477 San Jose T (2004) Bird slaughterhouse: generation and purification of their water Tecnol Agua 24 (251) p 48 - 51 Van Niftrik L, Jetten, M.S.M, (2012) Anaerobic Ammonium Oxidizing Bacteria: Unique Microorganisms with Exceptional Properties Microbiology and Molecular Biology Reviews World Bank Group - Environmental, H., and Safety Guidelines for Poultry Processing, (2007) General EHS Guidelines: Environmental Wastewater and Ambient Water Quality - Report World Bank Group - Environmental, H.a.S.E.G.f.M.P General EHS Guidelines: Environmental Wastewater and Ambient Water Quality- Report 2007; Available from: http://www.ifc.org/ehsguidelines Wu Z, Huang S., Yang Y, Xu F, Zhang Y, Jiang R, (2013) Isolation of an Aerobic Denitrifying Bacterial Strain from a Biofilter for Removal of Nitrogen Oxide Aerosol and Air Quality Research, 13 p 1126 – 1132 Zhang J, Wu P., Hao B, and Yu Z, (2011) Heterotrophic nitrification and aerobic denitrification by the bacterium Pseudomonas stutzeri YZN-001 Bioresource Technology, 102 (21) p 9866-9869 Zhang Q.-L, Liu Y, Ai G.-M, Miao L.-L, Zheng H.-Y, and Liu Z.-P, (2012) The characteristics of a novel heterotrophic nitrification–aerobic denitrification 51 Nguyễn Thị Hà Trang – CA140138 Luận văn thạc sỹ kỹ thuật Công nghệ Thực phẩm bacterium, Bacillus methylotrophicus strain L7 Bioresource Technology, 108 (0) p 35-44 52 Nguyễn Thị Hà Trang – CA140138 Luận văn thạc sỹ kỹ thuật Công nghệ Thực phẩm PHỤ LỤC P1 Kết giải trình tự DNA chủng T4 TTGGCAATGCGGCTGCTATAATGCAGTCGGACGGGATCCATCGGAG AGCTTGCTCGAAGATGGTGAGAGTGGCGCACGGGTGCGTAACGCGTG AGCAACCTACCTCTATCAGGGGGATAGCCTCTCGAAAGAGAGATTAA CACCGCATAATATCACTGACTGGCATGTTCTATTGATTAAATATTTAT AGGATAGAGATGGGCTCGCGTGACATTAGCTAGTTGGTAGGGTAACG GCTTACCAAGGCGACGATGTCTAGGGGCTCTGAGAGGAGAATCCCCC ACACTGGTACTGAGACACGGACCAGACTCCTACGGGAGGCAGCAGTA AGGAATATTGGTCAATGGGCGGAAGCCTGAACCAGCCATGCCGCGTG CAGGATGACTGCCCTATGGGTTGTAAACTGCTTTTGTCCAGGAATAAA CCTATATACGTGTATCGAGCTGAATGTACTGGAAGAATAAGGATCGG CTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGATCCGAGCGTTA TCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCTATTAAGTCAG GGGTGAAATACGGTGGCTCAACCATCGCAGTGCCTTTGATACTGATG GGCTTGAATCCATTTGAAGTGGGCGGAATAAGACAAGTAGCGGTGAA ATGCATAGATATGTCTTAGAACTCCGATTGCGAAGGCAGCTCACTAA GCTGGTATTGACGCTGATGCACGAAAGCGTGGGGATCGAACAGGATT AGATACCCTGGTAGTCCACGCCCTAAACGATGATAACTCGATGTTGG CGATAGACAGCCAGCGTCCCAGCGAAAGCGTTAAGTTATCCACCTGG GGAGTACGCCCGCAAGGGTGAAACTCAAAGGAATTGACGGGGGCCC GCACAAGCGGAGGAGCATGTGGTTTAATTCGATGATACGCGAGGAAC CTTACCCGGGCTTGAAAGTTATTGAAGAGTGCAAAGACGCACTCGTC CTTCGGGACACGAAACTAGGTGCTGCATGGCTGTCGTCAGCTCGTGCC GTGAGGTGTTGGGTTAAGTCCCGCAACGAGGGCAACCCCTATGTTAA TTTGCCAGCATGTAATGGTGGGGAACTCTAAAACGAACTGCCCTGGC CAAACAAAAAAGGAAGGTGGGGGACGAACGTCAAATTCATCATGGG CCCTTTACATTCCGGGGGTAACAAACGGGGCTACAATTGGAATGGTA ACGGCGGGCCACTTCACTAACCAAATGGAGGGCCAATCCTTAAAAAG 53 Nguyễn Thị Hà Trang – CA140138 Luận văn thạc sỹ kỹ thuật Công nghệ Thực phẩm CCCTTTTCCATTTTCGGAATTGGGGGTTCGGCAACCCAGACCCCTCGG AATTTGGGATTTCCCCAGAAAATCCTCCTAAACCCCAAAGTGCCCCGT TGAAAAACCTTTCCTCG P2 Kết giải trình tự DNA chủng H5 TGCCATTGCGCAGGCTACCATGCAGTCGAGCGATGACACCCGACTT GTTGGTCGGATTATGGCCAAACGGGTGAGTAACACGTGTGTGAGCTG CCCTGCCCTTCGGGAGAAGCCTGCTACTGTGGACCTAATACCAGATA GGACCTCGGGATGCATGTTCCGGGGTGGAAAGGTTTTCCTCATGCCAT ATGGTGCCCCCACCTGTCATTATGTTGGAGGGGTAACGGCGCCTCACC GCGACGACGATCCCCCGGCCTGATGAGGCGATGACCCACACTGGTGC TGATACACGGCCCTCACTCCTACTACAGGCGGCAGTGGGGAATATTG TTGCTGGTGGGCGCCTGATCATGCACGCCGCCGCGTGTTGACGGCCTT CTTCTTGTAAACCTCTTTTTTACCCAAGAAGGAAAGGTGACGGGTAGG TAACCTTAGTGACCGGCCATACTACGTGCAAGAAGCCGCGGTTATAC CTATGGTGCCAGCGTTGTCAATAATTACTGTGCGTACGTAACTCGTAA GTACTGTGTCTAGTCCGCAGTGAAGACGCTTGTCTCATCTGATGTCAT GCACGCGATCTCGACCTGGTTACTGACTGTGAGAGAGACTGGCTTGA CTGGTGTAGAGGGGAATTGAATTCATATCGTGACGGAACACCTGTGG CGAAGGCTGGTCTCTTACCAGTAACTGACGCTGACCCAGCGAAAGCG TGGTGTACCCTACAGGATTAGATACCCTGGTAGACAACGGCGTACAC AGCGGGCGCTACGTGTGGGTAACCTATCACGGCATCCGTTTGTACCTA ACACATTAAGCTCCCGACTGGACGAGTACAGCCGCACGCCTAGAACT CAAAGGACTTGACGGTGGGCCCGCACAAGTATCGAGGCATGTCGACT AATTCGGTGCAACGTGTAGATATCTTACATGGGTTTGGACATAACCCT AACCACCTCATACATTGCGGATTAACTTGTGATCAGTGTTAGTTGGCT TCGTGAATCTCTAAGCAT P3 Kết giải trình tự DNA chủng Su TGGGGTGGGCGGAGCTACCATGCAGTCGAGCGGATGAGTGGAGCT 54 Nguyễn Thị Hà Trang – CA140138 Luận văn thạc sỹ kỹ thuật Công nghệ Thực phẩm TGCTCCATGATTCAGCGGCGGACGGGTGAGTAATGCCTAGGAATCTG CCTGGTAGTGGGGGACAACGTTTCGAAAGGAACGCTAATACCGCATA CGTCCTACGGGAGAAAGTGGGGGATCTTCGGACCTCACGCTATCAGA TGAGCCTAGGTCGGATTAGCTAGTTGGTGAGGTAAAGGCTCACCAAG GCGACGATCCGTAACTGGTCTGAGAGGATGATCAGTCACACTGGAAC TGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTG GACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAG GTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAAGGGCAGTAAGT TAATACCTTGCTGTTTTGACGTTACCAACAGAATAAGCACCGGCTAAC TTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTTAATCGG AATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCGTTAAGTTGGATGT GAAAGCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTGGCGAGCT AGAGTATGGCAGAGGGTGGTGGAATTTCCTGTGTAGCGGTGAAATGC GTAGATATAGGAAGGAACACCAGTGGCGAAGGCGACCACCTGGGCT AATACTGACACTGAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAG ATACCCTGGTAGTCCACGCCGTAAACGATGTCGACTAGCCGTTGGGA TCCTTGAGATCTTAGTGGCGCAGCTAACGCATTAAGTCGACCGCCTGG GGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGGCCCG CACAAGCGGTGGAGCATGTGGTTTTAATTCGAAGCAACGCGAAGAAC CTTACCAGGCCTTGACATGCAGAGAACTTTTCCAGAGATGGATTGGTG GCTTTCGGGAACTCTGAACACAGGTGCTGCATGGCCGGTCGTCAACTC CGTGTCCTGGAAATGTTGGGGTTAAATTCCCGTAAACGAAGGCCAAC CCCTTGTTCTTTAGTTTACCAGCCACGTTTAAGGTGGGGCACTCCTAA GGGAAACTGGCCGGTGAACAAACCCGGAAGGAAGGGTGGGGGGAAG GACGTCCAAGTTCAACAATGGACCCTTAAAGGTCCGGGGGCTAACCA CCTTGTCTATAAAGGGGTTCGGAGAAAAAATGTGTTGTCCAATACCCC CGGTGGGTTGAAACTTTATGCCTTCATAAAACCCTTCACTATAGGCCT CGGAACGCACGTTCTCTTCGAATAGCTCGCTGGGCCTCAAAAGTCCCG GGAATAGCTTGCTATATATTCGTCGATGAAAATCAAAAGTTGCTCGA 55 Nguyễn Thị Hà Trang – CA140138 Luận văn thạc sỹ kỹ thuật Công nghệ Thực phẩm GGGGTGTAACATCCTT Bảng PL1: Hiệu suất chuyển hóa amon chủng T1, T2, T4, T5 Hiệu suất chuyển hóa amon ( ) T1 T2 T4 T5 0,00 0,00 0,00 0,00 2,51 1,16 9,86 0,97 3,29 2,90 23,79 3,87 9,86 6,00 41,59 7,54 19,92 13,73 52,42 17,21 26,89 24,18 69,63 39,65 38,49 40,43 83,68 52,61 44,87 50,68 93,21 62,48 Bảng PL2: Hiệu suất nitrit hóa chủng T1, T2, T4, T5 Hiệu suất chuyển hóa amon thành nitrit ( ) T1 T2 T4 T5 0,00 0,00 0,00 0,00 1,14 1,36 3,03 2,65 1,67 3,41 12,11 3,18 4,24 8,70 18,77 9,69 6,36 17,18 29,14 16,05 7,95 21,04 54,87 20,81 9,46 22,40 66,00 21,50 11,81 28,99 92,87 32,09 56 Nguyễn Thị Hà Trang – CA140138 Luận văn thạc sỹ kỹ thuật Công nghệ Thực phẩm Bảng PL3: Hiệu suất chuyển hóa nitrit chủng H3, H5 Hiệu suất chuyển hóa nitrit ( ) H3 H5 0,00 0,00 8,68 23,90 21,16 30,90 30,59 53,27 39,12 63,32 45,51 71,99 51,90 88,58 56,93 93,39 Bảng PL4: Hiệu suất nitrat hóa chủng H3, H5 Hiệu suất nitrat hóa ( ) H3 H5 0,00 0,00 7,63 12,93 13,52 32,41 19,06 53,94 25,86 64,18 37,10 73,60 40,76 90,20 45,01 92,31 57 Nguyễn Thị Hà Trang – CA140138 Luận văn thạc sỹ kỹ thuật Công nghệ Thực phẩm Bảng PL5: Hiệu suất chuyển hóa NO3- chủng Su, Ha, U1 Hiệu suất chuyển hóa nitrat (%) Su Ha U1 27,79 12,68 17,34 83,14 30,26 35,94 96,45 37,40 37,28 96,76 41,92 40,41 96,94 44,76 41,73 97,34 47,63 43,22 Bảng PL6: Hiệu suất sinh khí nitơ chủng Su, Ha, U1 Hiệu suất sinh khí N -N2 (%) Su Ha U1 0,00 0,00 0,00 28,00 10,39 19,07 86,72 21,92 42,48 92,70 69,24 56,06 92,70 69,24 56,06 58 Nguyễn Thị Hà Trang – CA140138 Luận văn thạc sỹ kỹ thuật Công nghệ Thực phẩm PL7: Hiệu suất chuyển hóa amon nước thải giết mổ gia cầm Hiệu suất chuyển hóa amon (%) ĐC T4 H5 0,00 0,00 0,00 0,61 33,80 27,50 2,63 42,34 48,98 5,49 48,35 57,75 7,55 58,40 74,32 10,23 69,90 84,85 13,08 83,62 90,18 16,21 88,31 93,30 PL8: Sự biến động nồng độ nitrit nước thải giết mổ gia cầm Hàm lượng N-NO2- (mg/L) ĐC T4 H5 15,52 15,52 15,52 18,26 15,22 15,83 18,87 14,61 13,70 19,48 14,00 12,48 20,09 13,39 11,26 20,70 12,78 10,35 21,30 12,17 9,43 21,48 12,00 9,13 59 Nguyễn Thị Hà Trang – CA140138 Luận văn thạc sỹ kỹ thuật Công nghệ Thực phẩm PL9: Sự biến động nồng độ nitrat nước thải giết mổ gia cầm Hàm lượng N-NO3- (mg/L) ĐC T4 H5 23 23 23 23,04 35 40 23,57 40 64 24,1 51 86 24,62 67 110 25 81 130 26 94 140 28 100 152 PL10: Hiệu suất chuyển hóa nitrat mẫu ĐC Su Hiệu suất chuyển hóa nitrat ĐC Su 0,00 0,00 0,00 36,18 1,32 59,87 1,97 74,93 2,63 83,29 2,63 86,84 3,29 88,82 3,95 92,76 60 Nguyễn Thị Hà Trang – CA140138 Luận văn thạc sỹ kỹ thuật Công nghệ Thực phẩm Hình PL1: Đường chuẩn NH4+ 0.6 y = 0.5272x + 0.0075 R² = 0.9987 OD 450 nm 0.5 0.4 0.3 Series1 0.2 Linear (Series1) 0.1 0 0.5 1.5 NH4+ (mg/L) Hình PL2: Đường chuẩn NO20.8 y = 0.7073x + 0.0158 R² = 0.9942 0.7 OD 520nm 0.6 0.5 0.4 Series1 0.3 Linear (Series1) 0.2 0.1 0 0.5 1.5 NO2- (mg/L) 61 Nguyễn Thị Hà Trang – CA140138 ... nhanh trình xử lý nitơ nước thải thực phẩm nói chung nước thải lò mổ nói riêng, chọn đề tài: Tuyển chọn vi khuẩn có khả chuyển hóa nitơ ứng dụng xử lý nước thải công nghiệp thực phẩm Mục đích... có chế phẩm thích hợp cho xử lý nước thải giàu nitơ nước thải lò mổ nên cần thiết chế tạo chế phẩm vi sinh vật có khả chuyển hóa nitơ cao nhằm áp dụng để xử lý nước thải giàu nitơ nói chung nước. .. gian xử lý, người ta thường phân lập tuyển chọn chủng vi khuẩn địa có khả chuyển hóa nitơ cao để bổ sung vào trình xử lý nước thải Hàm lương nitơ tổng (TN) nước thải ngành công nghiệp thực phẩm
- Xem thêm -

Xem thêm: Tuyển chọn vi khuẩn có khả năng chuyển hóa nitơ ứng dụng xử lý nước thải trong công nghiệp thực phẩm , Tuyển chọn vi khuẩn có khả năng chuyển hóa nitơ ứng dụng xử lý nước thải trong công nghiệp thực phẩm , Tuyển chọn vi khuẩn có khả năng chuyển hóa nitơ ứng dụng xử lý nước thải trong công nghiệp thực phẩm , CHƯƠNG II: VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨ, CHƯƠNG III: KẾT QUẢ VÀ THẢO LUẬN, TÀI LIỆU THAM KHẢO

Từ khóa liên quan

Gợi ý tài liệu liên quan cho bạn

Nhận lời giải ngay chưa đến 10 phút Đăng bài tập ngay