Xây dựng phương pháp phát hiện một số chủng human papilloma virus nguy cơ cao gây ung thư cổ tử cung ở việt nam bằng kỹ thuật realtime PCR

89 111 0
  • Loading ...
1/89 trang

Thông tin tài liệu

Ngày đăng: 02/05/2017, 13:29

ĐẠI HỌC QUỐC GIA HÀ NỘI TRƢỜNG ĐẠI HỌC KHOA HỌC TỰ NHIÊN - Nguyễn Thanh Tâm XÂY DỰNG PHƢƠNG PHÁP PHÁT HIỆN MỘT SỐ CHỦNG HUMAN PAPILLOMAVIRUS NGUY CAO GÂY UNG THƢ CỔ TỬ CUNG VIỆT NAM BẰNG KỸ THUẬT REALTIME PCR LUẬN VĂNTHẠC SĨ KHOA HỌC Hà Nội - 2016 ĐẠI HỌC QUỐC GIA HÀ NỘI TRƢỜNG ĐẠI HỌC KHOA HỌC TỰ NHIÊN - Nguyễn Thanh Tâm XÂY DỰNG PHƢƠNG PHÁP PHÁT HIỆN MỘT SỐ CHỦNG HUMAN PAPILLOMAVIRUS NGUY CAO GÂY UNG THƢ CỔ TỬ CUNG VIỆT NAM BẰNG KỸ THUẬT REALTIME PCR Chuyên ngành: Sinh học thực nghiệm Mã số: 60420114 LUẬN VĂNTHẠC SĨ KHOA HỌC NGƯỜI HƯỚNG DẪN KHOA HỌC: PGS.TS NGUYỄN VÂN TRANG TS LÊ HỒNG ĐIỆP Hà Nội - 2016 Luận văn tốt nghiệp Nguyễn Thanh Tâm - K22 LỜI CẢM ƠN Tôi xin bày tỏ lòng biết ơn sâu sắc tới PGS.TS Nguyễn Vân Trang, người thầy tận tình bảo, hướng dẫn suốt thời gian học tập thực luận văn Tôi xin trân trọng cảm ơn TS Lê Hồng Điệp thầy giáo, giáo khoa Sinh học, đặc biệt thầy giáo, giáo môn Sinh lý Thực vật Hóa sinh học tận tình hướng dẫn, giúp đỡ, giảng dạy dìu dắt thời gian thực luận văn suốt thời gian học tập trường Tôi xin gửi lời cảm ơn chân thành tới anh chị, bạn làm việc Phòng Miễn dịch Vắc xin -Viện Vệ sinh Dịch tễ Trung ương tận tình giúp đỡ bảo suốt trình học tập thực luận văn phòng Cuối cùng, vô biết ơn gia đình bạn bè khích lệđộng viên suốt thời gian qua Hà Nội, ngày tháng năm 2016 Học viên Nguyễn Thanh Tâm Luận văn tốt nghiệp Nguyễn Thanh Tâm - K22 BẢNG KÍ HIỆU VÀ CÁC CHỮ VIẾT TẮT hiệu Tiếng Anh Tiếng Việt ADN/ ARN (Deoxi)ribonucleic acid Vật chất di truyền Primer Mồi - HPV Human Papillomavirus Papillomavirus gây bệnh người Hr-HPV High risk HPV Nhóm HPV nguy cao Lr-HPV Low risk HPV Nhóm HPV nguy thấp LRC Long Control Region Vùng kiểm soát dài gen PCR Polymerase Chain Reaction Probe - Đầu dò gắn huỳnh quang Reverse - Primer ngược ORF Open Reading Frame Khung đọc mở gen ORI Origin Vị trí khở đầu tái OD Optical density Mật độ quang mẫu ADN URR Upstream Regulatory Region Vùng điều hòa gen UTCTC - Ung thư cổ tử cung Luận văn tốt nghiệp Nguyễn Thanh Tâm - K22 MỤC LỤC DANH MỤC CÁC BẢNG………………………………………………………………… DANH MỤC CÁC HÌNH…………………………………………………………………… MỞ ĐẦU CHƢƠNG TỔNG QUAN TÀI LIỆU .3 1.1 Giới thiệu Human Papillomavirus 1.1.1 Đặc điểm hình thái HPV 1.1.2 Đặc điểm sinh học phân tử 1.1.3 Phân loại HPV 1.2 HPV ung thƣ cổ tử cung .12 1.2.1 Tình hình nhiễm HPV Việt Nam giới 12 1.2.2 Đường lây truyền HPV .14 1.2.3 Các bệnh lý thường gặp HPV, cách phòng nhiễm điều trị 14 1.2.4 Chu kỳ nhân lên chế gây bệnh HPV 15 1.2.5 Các phương pháp phát HPV 18 CHƢƠNG VẬT LIỆU VÀ PHƢƠNG PHÁP 26 2.1 Vật liệu 26 2.1.1 Đối tượng nghiên cứu 26 2.1.2 Sinh phẩm vật tiêu hao 26 2.1.3 Máy móc thiết bị 27 2.2 Phƣơng pháp nghiên cứu 27 2.2.1 Xây dựng kỹ thuật realtime PCR phát chủng HPV 16, 18 33/52 27 2.2.2 Tạo chứng dương xác định giới hạn phát kỹ thuật realtime PCR phát chủng HPV 16, 18 33/52 29 2.2.3 Thẩm định phương pháp phát chủng HPV16, 18, 33/52 32 2.3 Nội dung thực .34 CHƢƠNG KẾT QUẢ VÀ THẢO LUẬN .35 3.1 Xây dựng kỹ thuật Realtime PCR phát chủng HPV 16, 18 33/52 .35 3.1.1 Kỹ thuật realtime PCR đơn cặp primer probe 35 3.1.2 Kỹ thuật realtime PCR đa cặp primer probe 40 3.2 Tạo chứng dƣơng xác định giới hạn phát kỹ thuật realtime PCR phát chủng HPV 16, 18 33/52 .42 3.2.1 Khuếch đại trình tự đích .42 3.2.2 Nhân dòng gen tạo chứng dương 43 3.2.3 Xác định giới hạn phát kỹ thuật Realtime PCR 48 3.3 Thẩm định phƣơng pháp phát chủng HPV16, 18 33/52 .50 3.3.1 Xác định độ xác kỹ thuật realtime PCR phát chủng HPV16, 18 33/52 51 3.3.2 Xác định độ chụm (hệ số tái lâp hệ số lặp lại) kỹ thuật realtime PCR phát chủng HPV16, 18 33/52 52 3.3.2.1 Xác định hệ số lặp lại phương pháp 52 3.3.2.2 Xác định hệ số tái lập phương pháp 56 3.3.3 Xác định độ đặc hiệucủa kỹ thuật realtime PCR phát chủng HPV16, 18 33/52 60 3.3.4 Xác định độ nhạycủa kỹ thuật realtime PCR phát chủng HPV16, 18 33/52 .61 KẾT LUẬN 67 KIẾN NGHỊ 67 TÀI LIỆU THAM KHẢO 68 Luận văn tốt nghiệp Nguyễn Thanh Tâm - K22 DANH MỤC CÁC BẢNG Bảng 1.1 Các type HPV bệnh liên quan 11 Bảng 1.2 Tỷ lệ nhiễm HPV số tỉnh thành phố Việt Nam .13 Bảng 1.3 Các cặp mồi dùng cho PCR phát HPV………………………………… 22 Bảng 2.1 Thành phần kỹ thuật realtime PCR đơn cặp primer probe 29 Bảng 2.2 Thành phần kỹ thuật realtime PCR đa cặp primer probe………………….29 Bảng 2.3 Thành phần phản ứng khuếch đại trình tự đích .30 Bảng 2.4 Chu kì nhiệt phản ứng khuếch đại trình tự đích 30 Bảng 3.1 Kết kỹ thuật realtime PCR đơn cặp primer probe phát HPV16….34 Bảng 3.2 Kết kỹ thuật realtime PCR đơn cặp primer probe phát HPV18….36 Bảng 3.3 Kết kỹ thuật realtime PCR đơn cặp primer probe phát HPV33/52.37 Bảng 3.4 Kết kỹ thuật realtime PCR đơn cặp primer probe IC………………… 38 Bảng 3.5 Kết kỹ thuật realtime PCR cặp primer probe phát HPV16, HPV18 HPV33/52…………………………………………………………………………… 39 Bảng 3.6 Kết phản ứng Realtime PCR đa cặp primer probe với chứng dương….47 Bảng 3.7.Kết thí nghiệm xác định độ xác phương pháp…………………50 Bảng 3.8.Kết thí nghiệm xác định hệ số lặp lại phương pháp………………… 52 Bảng 3.9 Giá trị trung bình độ lệch chuẩn thí nghiệm đánh giá hệ số lặp lại…….53 Bảng 3.10.Kết thí nghiệm xác định hệ số tái lập phương pháp…………………55 Bảng 3.11 Giá trị trung bình độ lệch chuẩn thí nghiệm đánh giá hệ số tái lập….57 Bảng 3.12 Kết thí nghiệm xác định độ đặc hiệu phương pháp…………………58 Bảng 3.13.Kết thí nghiệm xác định độ nhạy phươngpháp…………………… 61 Luận văn tốt nghiệp Nguyễn Thanh Tâm - K22 DANH MỤC CÁC HÌNH Hình 1.1 Hạt vi rút HPV …………………………………………………………… Hình 1.2 Cấu trúc bộgen Papillomavirus HPV 16 ……………………………….4 Hình 1.3 Cây phả hệ 118 genotype Papilomavirus dựa trình tự gen vùng L1 ORF Hình 1.4 Tỷ lệ nhiễm HPV nữ giới giới .12 Hình 1.5 Chu kỳ nhân lên HPV …………………………………………………….16 Hình 1.6 Phương pháp lai phân tử phát HPV 21 Hình 3.1 Đường biểu diễn tín hiệu huỳnh quang phản ứng Realtime PCR đơn cặp primer probe phát HPV16 ……………………………………………………….35 Hình 3.2 Đường biểu diễn tín hiệu huỳnh quang kỹ thuật realtime PCR đơn cặp primer probe phát HPV18 ………………………………………………………………36 Hình 3.3 Đường biểu diễn tín hiệu huỳnh quang kỹ thuật realtime PCR đơn cặp primer probe phát HPV33/52 ………………………………………………………… 37 Hình 3.4 Đường biểu diễn tín hiệu huỳnh quang kỹ thuật realtime PCR đơn cặp primer probe IC ………………………………………………………………………………39 Hình 3.5 Đường biểu diễn tín hiệu huỳnh quang kỹ thuật realtime PCR cặp primer probe phát HPV16, 18 33/52 …………………………………………………40 Hình 3.6 Ảnh điện di sản phẩm khuếch đại trình tự HPV16E6-E7, HPV18L1 …………41 Hình 3.7 Ảnh điện di sản phẩm khuếch đại trình tự HPV52L1 ……………………… 42 Hình 3.8 Kiểm tra kết nhân dòng trình HPV16E6-E7 43 Hình 3.9 Kết tinh Plasmid mang đoạn chèn HPV16E6-E7 44 Hình 3.10 Kiểm tra kết nhân dòng trình tự HPV18L1 44 Hình 3.11 Kết tinh Plasmid mang đoạn chèn HPV18L1 45 Hình 3.12 Kiểm tra kết nhân dòng trình tự HPV52L1 46 Hình 3.13 Kết tinh Plasmid mang đoạn chèn HPV52L1 46 Hình 3.14 Kết kỹ thuật realtime đa cặp primer probe với chúng dương ……… 48 Hình 3.15 Đường biểu diễn tín hiệu huỳnh quang thí nghiệm xác định độ xác …………………………………………………………………………………………….51 Hình 3.16 Đường biểu diễn tín hiệu huỳnh quang thí nghiệm xác định hệ số lặp lại …………………………………………………………………………………………….52 Hình 3.17 Biến động giá trị Ct thí nghiệm đánh giá hệ số lặp lại ………………… 53 Hình 3.18.Đường tín hiệu huỳnh quang thí nghiệm xác định hệ số tái lập kỹ thuật viên …………………………………………………………………………………… 56 Hình 3.19.Đường tín hiệu huỳnh quang thí nghiệm xác định hệ số tái lập kỹ thuật viên …………………………………………………………………………………… 56 Hình 3.20.Đường tín hiệu huỳnh quang thí nghiệm xác định hệ số tái lập kỹ thuật viên …………………………………………………………………………………… 56 Hình 3.21 Biến động giá trị Ct thí nghiệm đánh giá hệ số tái lập ………………… 57 Hình 3.22.Đường biểu diễn tín hiệu huỳnh quang thí nghiệm đánh giá độ đặc hiệu …………………………………………………………………………………………….59 Hình 3.23 Đường biểu diễn tín hiệu huỳnh quang thí nghiệm đánh giá độ nhạy … 62 Luận văn tốt nghiệp Nguyễn Thanh Tâm - K22 MỞ ĐẦU Human papillomavirus (HPV) tác nhân thường gặp nhiễm trùng lây truyền qua đường tình dục nguyên nhân quan trọng dẫn tới ung thư cổ tử cung (UTCTC), loại ung thư xếp thứ loại ung thư mà nữ giới thường mắc phải xếp thứ hai với nữ giới độ tuổi 15-44[41] HPV mối liên quan mật thiết với UTCTC mà vai trò quan trọng nguyên nhân dẫn đến ung thư hậu môn, âm đạo, dương vật, ung thư phổi số ung thư vùng hầu họng Đồng thời, HPV nguyên nhân nhiều bệnh lý lâm sàng da niêm mạc hạt cơm, sùi mào gà sinh dục-hậu môn, u nhú quản trẻ sinhv.v…[32] Hàng năm giới ước tính khoảng 529.000 ca mắc UTCTC, tử vong khoảng 275.000 trường hợp, 85% tổng số trường hợp bệnh gặp nước phát triển[21] Mỗi năm, Châu Á thêm khoảng 312.000 bệnh nhân UTCTC, chiếm 59% trường hợp mắc toàn giới - đặc biệt khu vực Nam Á Đông Nam Á, nơi tỷ lệ nhiễm HPV cao châu lục[21, 34].Cùng với lây nhiễm HPV cộng đồng, UTCTC thực trở thành gánh nặng bệnh tật toàn cầu, gây ảnh hưởng nặng nề đến sức khỏe tâm lý nữ giới Tại Việt Nam, theo thống kê Tổ chức Y tế giới năm 2012, UTCTC loại ung thư chiếm tỷ lệ cao nữ giới, xếp thứ số loại ung thư mà nữ giới độ tuổi 15-44 hay mắc phải, với 5000 ca nhiễm (tỷ lệ: 8.1/100.000 phụ nữ) tử vong 2000 trường hợp năm[40] Điều đặc biệt quan tâm phần lớn trường hợp UTCTC thường phát giai đoạn muộn, trình diễn biến từ nhiễm virus đến ung thư thường trải qua thời gian dài Quá trình tiến triển từ mức dộ loạn sản nhẹ, loạn sản vừa, loạn sản nặng đến ung thư chỗ (giai đoạn tổn thương phục hồi) đến giai đoạn ung thư xâm nhập kéo dài từ 10 25 năm[22].Đây hội cho việc phát nhiễm HPV, sàng lọc người nguy mắc ung thư cổ tử cung nhằm giúp trình điều trị hiệu tổn thương tiền ung thư ung thư giai đoạn sớm.Hiện Việt Nam, xét nghiệm tế bào mô bệnh học (Pap smear) đưa vào thành thường quy chương trình sàng lọc UTCTC, xét nghiệm HPV phổ biến nhiên chi phí cao kit chẩn đoán thương mại hóavà yêu cầu đảm bảo chất lượng xét nghiệm với xét nghiệm nước[8] Với tầm quan trọng ý nghĩa việc xác định genotype HPV, Luận văn tốt nghiệp Nguyễn Thanh Tâm - K22 xuất phát từ thực tiễn nêu trên, đề tài "Xây dựng phƣơng pháp phát số chủng Human Papillomavirus nguy cao gây ung thƣ cổ tử cung Việt Nam kỹ thuật Realtime PCR" thực với mục tiêu sau: Xây dựng phương pháp phát chủng HPV 16, 18 33/52 kỹ thuật multiplex Realtime PCR Thẩm định phương pháp phát chủng HPV 16, 18, 33/52 kỹ thuật multiplex realtime PCR mẫu dịch quét cổ tử cung Đề tài nàyđược thực phòng Miễn dịch Vắc xin,ViệnVệ sinh Dịch tễ Trung ương Luận văn tốt nghiệp Nguyễn Thanh Tâm - K22 CHƢƠNG1 TỔNG QUAN TÀI LIỆU 1.1 Giới thiệu Human Papillomavirus Papillomaviruslàcác thành viên họ Papillomaviridae, tìm thấy nhiều loài động vật người Các loài vật chủ khác nhiễm loại Papillomavirus đặc thù cho loài đó.CácPapillomavirusgây bệnh cho người gọi Human papillomavirus(HPV) 1.1.1Đặc điểm hình thái HPV HPV nhóm virus kích thước nhỏ, không vỏ.Hạt virus đường kính 5255nm, vỏ gồm 72 đơn vị capsomer.Mỗi đơn vị capsid gồm pentamer protein cấu trúc L1 kết hợp với protein L2 (protein thành phần kháng nguyên sử dụng phản ứng miễn dịch đặc hiệu) Hình 1.1.Hạt vi rút HPV[14] Cả hai protein cấu trúc virus tự mã hóa: Protein capsid (L1) kích thước khoảng 55 kDa chiếm khoảng 80% tổng số protein virus Protein capsid phụ (L2) kích thước khoảng 70 kDa[14] 1.1.2Đặc điểm sinh học phân tử 1.1.2.1 Cấu trúc hệ gen HPV virus vật liệu di truyền ADN, mạch đôi không hoàn chỉnh, tồn dạng siêu xoắn hình vòng (circular ds-ADN).ADN virus liên kết với histone tạo thành cấu trúc phức hợp giống Chromatin (Chromatin-like conplex) nằm lớp vỏ capsid protein Luận văn tốt nghiệp Nguyễn Thanh Tâm - K22 quang điển hình tương ứng với tất mẫu thí nghiệm Kết chứng tỏ trình thao tác thí nghiệm người thực bổ sung đầy đủ mẫu vào tất phản ứng Chứng âm cho kết âm tính kênh đọc chứng tỏ nhiễm chéo thao tác thí nghiệm.Từ đó, rút kết luận tỷ lệ kết âm tính xác định kỹ thuật realtime PCR so với kết âm tính mẫu chuẩn 100% 3.3.4 Xác định độ nhạycủa kỹ thuật realtime PCR phát chủng HPV16, 18 33/52 Tiến hành kỹ thuật realtime PCR đa cặp primer probe với 20 mẫu dương tính với chủng cần phát mẫu mẫu thuộc mẫu chuẩn nghiên cứu Gồm mẫu dương tính với HPV16, mẫu dương tính với HPV18 mẫu dương tính với HPV52 mẫu dương tính với HPV33 Kết thu trình bày Bảng 3.13 Hình 3.23 Quan sát Hình 3.23A, B, C đường biểu diễn tín hiệu huỳnh quang sau chu kì mẫu dương tính điển hình, kết tổng kết lại Bảng 3.11 sau: 20 mẫu dương tính mẫu chuẩn mẫu HPV16 cho kết dương tính kênh HEX, mẫu HPV18 cho kết dương tính kênh Cy5 mẫu HPV33/52 cho kết dương tính kênh FAM Tỷ lệ mẫu dương tính xác định phản ứng Realtime PCR 20 mẫu dương tính với chủng HPV16, 18, 33/52 mẫu chuẩn 100% Tỷ lệ mẫu dương tính với chủng HPV16, 18, 33/52 xác định kỹ thuật realtime PCR mẫu dương tính tương ứng 100% (8/8 mẫu HPV16, 7/7 mẫu HPV18, 7/7 mẫu HPV33/52).Kênh Cy5.5 cho giá trị Ct tương đương mẫu, chứng tỏ thao tác thí nghiệm tra mẫu thực đầy đủ tất phản ứng không xuất yếu tố ức chế phản ứng PCR.Chứng âm cho kết âm tính kênh đọc chứng tỏ nhiễm chéo trình thao tác thí nghiệm Kết luận: tỷ lệ kết dương tính xác định kỹ thuật Realtime PCR tổng số kết dương tính mẫu chuẩn 100% 62 Luận văn tốt nghiệp Nguyễn Thanh Tâm - K22 Bảng 3.13.Kết thí nghiệm xác định độ nhạy phương pháp STT Tên mẫu Genotype HEX HPV16 Dương tính /24,9 Dương tính /23,1 Dương tính /27,2 Dương tính /27,9 Dương tính /25,0 Dương tính /26,3 Dương tính /20,2 Dương tính /34,1 A305 HPV16 A435 HPV16 A410 HPV16 A445 HPV16 B344 HPV16 TEB064 HPV16 TEB101 HPV16 TEB094 HPV16, 18 A147 HPV18 10 A268 HPV18 Âm tính 11 A264 HPV18 Âm tính 12 B542 HPV18 Âm tính 13 TEB068 HPV18 Âm tính 14 B252 HPV18, 52 Âm tính 15 B557 HPV52 Âm tính 16 A103 HPV52 Âm tính 17 A424 HPV33, 52 Âm tính 18 A458 HPV52 Âm tính 19 B578 HPV52 Âm tính 20 B206 HPV33 Âm tính - Âm tính 21 Chứng âm Âm tính Kết quả/giá trị Ct Cy5 FAM HPV18 HPV33/52 Âm tính Âm tính Âm tính Âm tính Âm tính Âm tính Âm tính Âm tính Âm tính Âm tính Âm tính Âm tính Âm tính Âm tính Dương tính /25,5 Dương tính /32,0 Dương tính /29,1 Dương tính /28,06 Dương tính /28,41 Dương tính /33,08 Dương tính /36,40 Âm tính Âm tính Âm tính Âm tính Âm tính Âm tính Âm tính 63 Âm tính Âm tính Âm tính Âm tính Âm tính Âm tính Dương tính /23,38 Dương tính /23,46 Dương tính /22,30 Dương tính /18,74 Dương tính /21,34 Dương tính /24,10 Dương tính /21,75 Âm tính Cy5.5 IC Dương tính /26,8 Dương tính /25,2 Dương tính /26,9 Dương tính /23,9 Dương tính /25,7 Dương tính /26,4 Dương tính /20,9 Dương tính /23,2 Dương tính /23,1 Dương tính /23,5 Dương tính /24,27 Dương tính /24,45 Dương tính /24,09 Dương tính /24,51 Dương tính /23,37 Dương tính /23,49 Dương tính /24,36 Dương tính /23,77 Dương tính /23,47 Dương tính /25,92 Âm tính Luận văn tốt nghiệp Nguyễn Thanh Tâm - K22 Hình 3.23A HEX Hình 3.23B Cy5 Hình 3.23C FAM Hình 3.23D Cy5.5 A305; A147; B557; A435; A268; A103; A410; A264; A424; A445; B542; A458; B344; TEB064; TEB068; TEB094; B578; B206 TEB101 B252 Hình 3.23.Đường biểu diễn tín hiệu huỳnh quang thí nghiệm đánh giá độ nhạy (Hình 3.23A, B, C, D tương ứng vớikênh HEX, Cy5, FAM vàCy5.5) Chú thích: Màu tương ứng với mẫu A305, A435, A410, A445, B344, TEB064, TEB101, TEB094 thuộc genotype HPV16 Màu tương ứng với mẫu A147, A268, A264, B542, TEB068, TEB094, B252 thuộc genotype HPV18 Màu tương ứng với mẫu B252, B557, A103, A424, A458, B578, B206 thuộc genotype HPV52 64 Luận văn tốt nghiệp Nguyễn Thanh Tâm - K22 Trong nhiều yếu tố nguy ung thư cổ tử cung HPV coi tác nhân liên quan mật thiết Do biến động di truyền HPV khu vực khác nên nhiều nghiên cứu phát HPV nói chung phát HPV kỹ thuật multiplex Realtime PCR nói riêng[34][28][25][39];v.v… Tuy nhiên nghiên cứu nói xây dựng phương pháp phát mặt chủng HPV đưa tỷ lệ nhiễm HPV khu vực.Trong số nghiên cứu phát HPV kỹ thuật multiplex Realtime PCR khác đưa đánh giá giới hạn phát phương pháp thông qua việc tính số copy thấp mà kỹ thuật realtime PCR phát đượcnhư nghiên cứu Daojun Yu (2012) [17] William T Seaman (2010)[38] đưa phương pháp phát mặt chủng HPV 6, 11, 16, 18 mẫu bệnh phẩm kỹ thuật Realtime PCR với độ nhạy tương ứng 101 102 copy/ phản ứng 2x101 - 2x106 copy/ phản ứng Từ thấy so với phương pháp phát HPV dựa kỹ thuật Realtime PCR phương pháp xây dựng độ nhạy cao - 30 copy/phản ứng Phương pháp độ nhạy cao nguyên nhân sau: primer probe thiết kế hoàn toàn đặc hiệu, nhận biết trình tự tính phân biệt cao chủng HPV ko cấu trúc hairpin; Thành phần kỹ thuật realtime PCR hợp lý Kit Cobas 4800HPV, Roche (FDA) - kit xét nghiệm HPV nguy cao gây ung thư cổ tử cung dựa kỹ thuật realtime PCR đưa đánh giá giới hạn phát kit chủng HPV16, 18, 33/52 tương ứng 300, 300, 2400 copy/ml mẫu dịch quét cổ tử cung.Trong nghiên cứu này, 200ul dịch quét cổ tử cung tách chiết kit tách chiết ADN Roche thu 50ul ADN, tương ứng với nồng độ copy/ul ADN 250 copy/mldịch tách chiết, giới hạn phát HPV16, 18, 33/52 1, 1, 10/10 copy/ul dịch tách chiết 250, 250, 2500/2500 copy/ml dịch tách chiết, kết thu tương tự với kết kit Phương pháp phát HPV xây dựng việc độ nhạy cao nghiên cứu phát HPV với kỹ thuật realtime PCR độ nhạy tương đương với kit thương mại Roche ưu điểm: + Phương pháp phát HPV 16, 18, 33/52 sử dụng cặp mồi chứng nội kiểm (IC) chứng dương kiểm soát chất lượng xét nghiệm: sử dụng cặp mồiIC để xác định hiệu thao tác tách chiết ADN mặt chất 65 Luận văn tốt nghiệp Nguyễn Thanh Tâm - K22 ức chế kỹ thuật realtime PCR; đồng thời sử dụng chứng dương để kiểm soát thao tác thí nghiệm bước thực kỹ thuật realtimePCR +Tiếp tục phát triển phương pháp cho mục đích nghiên cứu khác: khác với kít thương mại phát HPV kỹ thuật realtime PCR thường phụ thuộc vào thiết bị, thành phần sinh phẩm kit cobas 4800 Roche sử dụng hệ thiết bị kín sinh phẩm hãng, phương pháp hệ mở bổ sung thêm cặp mồi probe phát chủng Lr-HPV Hr-HPV khác vào phản ứng realtime PCR phản ứng realtime PCR riêng biệt khác với thành phần tương tự kỹ thuật realtime PCR phát HPV16, 18, 33/52 Do tiếp tục phát triển phương pháp để phát chủng HPV tùy thuộc vào mục đích nghiên cứu, xét nghiệm thực tiễn, ví dụ phát chủng nguy cao thành phần vắc xin giá, phát chủng HPV nguy thấp, gây mụn cóc sinh dục HPV6, 11, v.v…Phương pháp không sử dụng để xác định nguy ung thư cổ cung cho phụ nữ mà tiếp tục phát triển để xác định nguy số bệnh khác HPV gây như: mụn cóc sinh dục, sùi mào gà, ung thư dương vật + Ngoài ra, phương pháp ưu điểm kỹ thuật multiplex realtime PCR nói chung nhanh, độ xác cao, phát lúc nhiều tác nhân, giá thành rẻ Kít thương mại sử dụng để sàng lọc HPV thị trường, chi phí cho xét nghiệm sàng lọc chủng HPV16, 18, 33/52 theo phương pháp xây dựng 160.000 VND tiết kiệm nhiều so với chi phí cho xét nghiệm sàng lọc HPV với Kit Cobas 4800 HPV, Roche (FDA) 750.000 VND 66 Luận văn tốt nghiệp Nguyễn Thanh Tâm - K22 KẾT LUẬN Thiết kế thành công phương pháp phát chủngHPV16, 18 33/52 kỹ thuật Realtime PCR sử dụngchứng nội kiểm (IC)và chứng dương với giới hạn phát tác nhân tương ứng 3, 30/30 copy/phản ứng Xác định tiêu thẩm định kỹ thuật Realtime PCR phát chủng HPV16, 18 33/52:  Độ xác: phản ứng multiplexRealtime PCR nhóm thiết kế cho kết thống với kết mẫu chuẩn xác định trước  Độ chụm: phản ứng multiplex Realtime PCR cho kết thống xét nghiệm riêng lẻ kỹ thuật viên khác  Độ đặc hiệu phản ứng multiplex Realtime PCR 100%  Độ nhạycủa phản ứng multiplex Realtime PCR 100% KIẾN NGHỊ Từ thực tế trình nghiên cứu đưa số kiến nghị sau: Tiếp tục phát triển phương pháp để phát chủng HPV nguy cao khác chủng HPV nguy thấp Đánh giá phương pháp với tác nhân khác HPV mặttrên đường sinh dục: lậu, giang mai, v.v tác nhân HPV thu khu vực khác thể: da, tay chân, niêm mạc miệng, hậu môn; nước tiểu v.v… Đánh giá phương pháp quần thể mẫu rộng nhiều số lượng 67 Luận văn tốt nghiệp Nguyễn Thanh Tâm - K22 TÀI LIỆU THAM KHẢO Tài liệu tiếng Việt Dung N T N D (2004), "Khảo sát liên quan mẹ nhiễm HPV bệnh u nhú quản," Thời Y Dược học, 4, Hiếu N T H (2004), "Tần xuất nhiễm HPV phụ nữ thành phố Hồ Chí Minh," Thời Y Dược học, 4, Trung N T H (2007), "HPV tổn thương cổ tử cung," Y Học TP Hồ Chí Minh, 3, Vân P H V (2009), "PCR real-time PCR: Các vấn đề áp dụng thường gặp Sinh học phân tử," Nhà xuất Y học, 27 Văn T T V (2010), "PCR số kỹ thuật Y sinh học phân tử Sinh học phân tử," Nhà xuất Y học, 68 Tài liệu tiếng Anh 10 11 12 13 14 15 A B.-P (2009), "Molecular Signature of HPV-Induced Carcinogenesis: pRb, p53 and Gene Expression Profiling," Current genomics, 10, Anco M B K., Wim Q., Leen-J.D (2005), "Molecular diagnosis of human papillomavirus (HPV) infections," Journal of Clinical Virology, 32, Bao Y.P S J S., Qiao Y.L., ACCPAB members (2008), "Human papillomavirus type distribution in women from Asia: a meta-analysis," International Journal of Gynecologycal cancer, 18, 10 Bernard H.U B R D., de Villiers E.M, et al (2010), "Classification of papillomaviruses (PVs) based on 189 PV types and prodương tínhal of taxonomic amendments," Virology, 401, 10 Boccardo E L A V L (2010), "The role of inflammation in HPV carcinogenesis," Carcinogenesis, 31, Bodaghi S W L V., Roby G., Ryder C., et al (2010), "Could human papillomaviruses be spread through blood?," Journal of Clinical Microbiology, 43, Bontkes H J., T.D deGruijl, J.M.Walboomers, J.T.Schiller, J Dillner, T.J Helmerhorst, R.H.Verheijen, R.J.Scheter, and C.J.Meijer (1999), "Immune responses again human papillomavirus (HPV) type 16 virus-like particles in a cohort study of women with cervical intraepithelial neoplasia II Systemic but not local IgA responses correlate with clearance of HPV-16," J.Gen Virol, 80, Burchell AN W R., de Sanjose S, FrancoEL (2006), "Chapter epiderniology and transmission dynamics of genital HPV infection vaccine 2006," Vaccine, 24, 10 Burd E M (2003), "Human papillomavirus and cervical cancer," Clin Microbiol Rev, 16, 1-17 Chan P K., M.Y Chan, W.W.Li, D.P.Chan, J.L.Cheung, and A.F.Cheung (2001), "Association of human beta-herpesvirus with the development of cervical cancer; by standers or cofactor?," J.Clin Pathol, 54, 68 Luận văn tốt nghiệp 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 Nguyễn Thanh Tâm - K22 Clifford G F S., Diaz M., Munoz N., Villa L.L (2006), "Chapter 3: HPV typedistribution in women with and without cervical neoplastic diseases," Vaccine, 24, Daojun Yu Y C., Shenghai Wu, Baohong Wang, Yi-Wei Tang, Lanjuan Li (2012), "Simultaneous Detection and Differentiation of Human Papillomavirus Genotypes 6, 11, 16 and 18 by AllGlo Quadruplex Quantitative PCR," PLoS One, 11, De Villiers E.M F C., Broker T.R., Bernard H.U., zur Hausen H (2004), "Classification of papillomaviruses," Virology, 324, 11 Doorbar J (2006), "Molecular biology of human papillomavirus infection and cervical cancer," Clin Sci (Lond), 110, 525-541 EM B (2003), "Human papillomavirus and cervical cancer," Clinical Microbiology Review, 16, 17 Ferlay J., Shin H R., Bray F., Forman D., Mathers C and Parkin D M (2010), "Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008," Int J Cancer, 127, 2893-2917 H Z H (2011), "Vaccines: what remains to be done?," Vaccine, 10, Hebner C M and Laimins L A (2006), "Human papillomaviruses: basic mechanisms of pathogenesis and oncogenicity," Rev Med Virol, 16, 83-97 Ishizaki A., Matsushita K., Hoang H T., Agdamag D M., Nguyen C H., Tran V T., et al (2013), "E6 and E7 variants of human papillomavirus-16 and -52 in Japan, the Philippines, and Vietnam," J Med Virol, 85, 1069-1076 Jenkins A., Allum A G., Strand L and Aakre R K (2013), "Simultaneous detection, typing and quantitation of oncogenic human papillomavirus by multiplex consensus real-time PCR," J Virol Methods, 187, 345-351 Lehoux M., D'Abramo C M and Archambault J (2009), "Molecular mechanisms of human papillomavirus-induced carcinogenesis," Public Health Genomics, 12, 268-280 Ly Thi-Hai Tran L T T., Thanh Cong Bui, Dung Thi-Kieu Le, Alan G Nyitray, Christine M Markham, Michael D Swartz, Chau Bao Vu-Tran and Lu-Yu Hwang (2015), "Risk factors for high-risk and multi-type Human Papillomavirus infections among women in Ho Chi Minh City, Vietnam: A crosssectional study," BMC Women's Health, Martin Moberg I G., and Ulf Gyllensten (2003), "Real-Time PCR- Based system for Simultaneous Quantification of Human Papillomavirus Types Associated with High Risk of Cervival Cancer," Journal of clinical microbiology, 41, Munoz N., Bosch F X., de Sanjose S., Herrero R., Castellsague X., Shah K V., et al (2003), "Epidemiologic classification of human papillomavirus types associated with cervical cancer," N Engl J Med, 348, 518-527 Munoz N., Castellsague X., de Gonzalez A B and Gissmann L (2006), "Chapter 1: HPV in the etiology of human cancer," Vaccine, 24 Suppl 3, S3/1-10 Nicol A.F N G J., Dillner J (2010), "A summary of the 25th International Papillomavirus Conference 2009: Vaccines, screening, epidermiology and therapeutics," Journal of Clinical Virology, 47, 69 Luận văn tốt nghiệp 32 33 34 35 36 37 38 39 Nguyễn Thanh Tâm - K22 Parkin D M., Bray F., Ferlay J and Pisani P (2005), "Global cancer statistics, 2002," CA Cancer J Clin, 55, 74-108 Rachel L Winer T G H., Long Fu Xi, Kathrin U Jansen, James P Hughes, Qinghua Feng, Carolee Welebob, Jesse Ho, Shu-Kuang Lee, Joseph J Carter, Denise A Galloway, Nancy B Kiviat, and Laura A Koutsky (2009), "Quantitative human papilloma virus 16 and 18 levels in incident infections and cervical lesion development," Journal of Medical Virology, 81, Sahiner F K A., Yapar M, Şener K, Dede M, Gumral R (2014), "Detection of major HPVs by a new multiplex real-time PCR assay using type-specific primers," Journal of Microbiological Method, 97, Sydney (2011), "Verification and Validation Symposium Event - National Institude of Hygiene and Epidemiology," T C Dung F R., N Becker, P T Huong, N V Trang, L M Tan, P V Hung, and N T Hien "Prevalence of human papillomavirus (HPV) infection and genotype distribution among women in Vietnam: a meta-analysis," submitted 2015, Tham Chi Dung N V T., Frank Roesl, Pham Ngoc Hung, Vu Ba Quyet, Le Quang Thanh, Huynh Xuan Nghiem, Tran Thi Mai Hung, Luong Minh Tan, Nguyen Phuong Anh and Nguyen Tran Hien "Prevalence of high-risk Human Papillomavirus infection among women aged 18-45 in two major cities in Vietnam," submitted 2015, William T Seaman E A., Marion Couch, Erna M Kojic, Susan Cu-Uvin, Joel Palefsky, Allison M Deal and Jennifer Webster-Cyriaque (2010), "Detection and quantitation of HPV in genital and oral tissues and fluids by real time PCR," Virology Journal, 194, Yiqun Liao Y Z., Qiwei Guo, Xiaoting Xie, Ena Luo, Jian Li,and Qingge Li (2013), "Simultaneous Detection, Genotyping, and Quantification of Human Papillomaviruses by Multicolor Real-Time PCR and Melting Curve Analysis," Journal of Clinical Microbiology 2013 Feb; 51(2): 429-435., 2, Tài liệu Internet 40 41 42 43 44 HPV Information Centre (2015), VietNam: Human papilomavirus and Related Diseases, Sumamary Report 2015 http://www.hpvcentre.net/statistics/reports/VNM.pdf (20/12/2015), HPV Information Centre (2015), World: Human papilomavirus and Related Diseases, Sumamary Report 2014 http://www.hpvcentre.net/statistics/reports/XWX.pdf (20/12/2015), http://en.wikipedia.org/wiki/HPV_vaccines, (20/12/2015)," WHO, Human papillomavirus laboratory manual, first edition 2009 http://www.who.int/immunization/hpv/learn/hpv_laboratory_manual who_ivb_20 09_2010.pdf (20/12/1015) https://www.google.com/webhp?sourceid=chrome-instant&ion=1&espv=2&ie=UT F -8#q=calculate%20copy%20number 70 Luận văn tốt nghiệp Nguyễn Thanh Tâm - K22 PHỤ LỤC Phụ lục 1: Danh sách mẫu ADN HPVdùng cho nghiên cứu Tên mẫu Type/Ct * A248 HPV16/27,3 B344 HPV16; 44; 70 B203 HPV16 B144 HPV16 B151 HPV16; 52 TEB094 HPV16;18 TEB101 HPV16 TEB064 HPV16 HPV56/26,7;HPV62 TEB020 HPV16 10 A445 HPV16/34,0;HPV39/26,3 11 A435 HPV16/26,8 12 A410 HPV16/31,9; HPV62; 70 HPV56/22,4 13 A412 HPV16/25,5 14 A301 HPV16/37,2 15 A305 HPV16/29,4 16 B464 HPV16/40.3;HPV59/37,4 17 B522 HPV16/37,9 HPV35;HPV68/29,4 18 A147 HPV18/35,1 19 A149 HPV18/27,8 20 B347 HPV18 21 B252 HPV18;52 22 A549 HPV18/30,0 23 B149 HPV18 24 B143 HPV18 25 TEB067 HPV18 26 TEB068 HPV18 27 TEB052 HPV18 28 TEB055 HPV18 29 A432 HPV18/36,2 30 A264 HPV18/29,5 31 A268 HPV18/30,2 32 B604 HPV18/36,9 33 B641 HPV18/38,7;HPV82/39,1 34 B542 HPV18/33,3 35 A103 HPV52/33,9;HPV58 36 A424 HPV33/23,4;HPV52 37 A438 HPV52/37,6 38 B557 HPV52/38,5 39 B578 HPV52/31,3;HPV70 40 A458 HPV31;HPV52/27,1 41 A468 HPV52/36,5 42 A534 HPV43;66;HPV52/40,0 43 B113 HPV52 44 A557 HPV52/37,0; HPV62 STT *kết STT Tên mẫu 45 B420 46 B422 47 B206 48 A319 49 A336 50 A352 51 A243 52 A259 Type/Ct* HPV51; HPV52/30,8 HPV 52/30,0;HPV58 HPV33 HPV68/26,1 HPV39/30,8 HPV31/29,1 HPV66/22,6 53 54 55 56 A127 A218 A448 A456 HPV51/36,2 HPV39/38,7 HPV62/39,0 HPV39; 57 58 59 60 61 A504 A514 A531 A539 A556 HPV51/23,9 HPV11 HPV56/31,7 HPV43/38,8 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 B455 B129 B473 B305 B511 A615 A646 B367 A108 A232 A318 A363 A407 A520 A540 A668 B438 B501 B658 A1 A2 A3 A4 A5 A6 A7 A8 HPV45/28,5 HPV51, 58 HPV66/22,4; 81 HPV39 HPV68/28,9 HPV51/39,9 HPV81/28,0 HPV51 Hr-HPV/38.8 Hr-HPV/37.9 Hr-HPV/33.8 Hr-HPV/38.2 Hr-HPV/31.7 Hr-HPV/39.2 Hr-HPV/35.4 Hr-HPV/34.9 Hr-HPV/36.4 Hr-HPV/38.2 Hr-HPV/36.7 Âm tính Âm tính Âm tính Âm tính Âm tính Âm tính Âm tính Âm tính xác định Kit Cobas 4800 Roche (FDA)-PTN MDVX Hr-HPV: HPV31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68; Âm tính: âm tính với chủng HPV i Luận văn tốt nghiệp Nguyễn Thanh Tâm - K22 Phụ lục 2: Kết giải trình tự trình đích Kết giải trình tự HPV16E6-E7 (A248E6-E7) GGCGGGAGTTTTATGCACCAAAAGAGAACTGCAATGTTTCAGGACCCACAGGAGCG ACCCAGAAAGTTACCACAGTTATGCACAGAGCTGCAAACAACTATACATGATATAA TATTAGAATGTGTGTACTGCAAGCAACAGTTACTGCGACGTGAGGTATATGACTTT GCTTTTCGGGATTTATGCATAGTATATAGAGATGGGAGTCCATATGCTGTATGTGA TAAATGTTTAAAGTTTTATTCTAAAATTAGTGAGTATAGACTTTATTGTTATAGTT TGTATGGAACAACATTAGAACAGCAATACGACAAACCGTTGTGTGATTTGTTAATT AGGTGTATTAACTGTTGCAAGCCACTGTGTCCTGAAGAAAAGCAAAGACATCTGGA CAAAAAGCAAAGATTCCATAATATAAGGGGTCGGGGGACTGCTGTATGTCTGGATT GTTTGCAATTCTCTAGAGCAGCTAAAGAAGTCCGCTTGTATTCATGCCTGTATAGA CTCGACCGTTTTTCAGAATATATGTTAGATTTGCAACCAGAGACAACTGATCTCTA CTGTTATGAGCAATTAAATGACAGCTCAGAGGAGGAAGATGAAATAGATGGTCCAG CTGGACAAGCAGAACCGGACAGAGCCCATTACAATATTGTAACCTTTTGTTGCAAG TGTGACTCTACGCTTCGGTTGTGCGTACAAAGCACACACGTAGACATTCGTACTTT GGAAGACCTGTTAATGGGCACACTAGGAATTGTGTGCCCCATCTGTTCTCAGAAAC CATAATCTACCATGGCTGATCCTGCAGGTACCAATGGGGAAGAGGTCGGAATTAGG GTCCA Kết giải trình tự HPV18L1 (A149L1) TATCACCCACAGCCCCTGCCTCTACACAGTATATTGGTATACATGGTACACATTAT TATTTGTGGCCATTATATTATTTTATTCCTAAGAAACGTAAACGTGTTCCCTATTT TTTTGCAGATGGCTTTGTGGCGGCCTAGTGACAATACCGTATATCTTCCACCTCCT TCTGTGGCAAGAGTTGTAAATACCGATGATTATGTGACTCGCACAAGCATATTTTA TCATGCTGGCAGCTCTAGATTATTAACTGTTGGTAATCCATATTTTAGGGTTCCTG CAGGTGGTGGCAATAAGCAGGATATTCCTAAGGTTTCTGCATACCAATATAGAGTA TTTAGGGTGCAGTTACCTGACCCAAATAAATTTGGTTTACCTGATACTAGTATTTA TAATCCTGAAATATCCTGATTATTTACAAATGTCTGCAGATCCTTATGGGGATTCC ATGTTTTTTTGCTTACGGCGTGAGCAGCTTTTTGCTAGGCATTTTTGGAATAGAGC AGGTACTATGGGTGACACTGTGCCTCAATCCTTATATATTAAAGGCACAGGTATGC GTGCTTCACCTGGCAGCTGTGTGTATTCTCCCTCTCCAAGTGGCTCTATTGTTACC TCTGACTCCCAGTTGTTTAATAAACCATATTGGTTACATAAGGCACAGGGTCATAA CAATGGTGTTTGCTGGCATAATCAATTATTTGTTACTGTGGTAGATACCACTCGCA GTACCAATTTAACAATATGTGCTTCTACACAGTCTCCTGTACCTGGGCAATATGAT GCTACCAAATTTAAGCAGTATAGCAGACATGTTGAGGAATATGATTTGCAGTTTAT TTTTCAGTTGTGTACTATTACTTTAACTGCAGATGTTATGTCCTATATTCATAGTA TGAATAGCAGTATTTTAGAGGATTGGAACTTTGGTGTTCCCCCCCCGCCAACTACT AGTTTGGTGGATACATATCGTTTTGTACAATCTGTTGCTATTACCTGTCAAAAGGA TGCTGCACCGGCTGAAAATAAGGATCCCTATGATAAGTTAAAGTTTTGGAATGTGG ATTTAAAGGAAAAGTTTTCTTTAGACTTAGATCAATATCCCCTTGGACGTAAATTT TTGGTTCAGGCTGGATTGCGTCGCAAGCCC ii Luận văn tốt nghiệp Nguyễn Thanh Tâm - K22 Kết giải trình tự HPV52L1 (B578L1) TAGTGAGGCCACTGTGTACCTGCCTCCTGTACCTGTCTCTAAGGTTGTAAGCACTGAT GAGTATGTGTCTCGCACAAGCATCTATTATTATGCAGGCAGTTCTCGATTACTAACAG TAGGACATCCCTATTTTTCTATTAAAAACACCAGTAGTGGTAATGGTAAAAAAGTTTT AGTTCCCAAGGTGTCTGGCCTGCAATACAGGGTATTTAGAATTAAATTGCCGGACCCT AATAAATTTGGTTTTCCGGATACATCTTTTTATAACCCAGAAACCCAAAGGTTGGTGT GGGCCTGTACAGGCTTGGAAATTGGTAGGGGACAGCCTTTAGGTGTGGGTATTAGTGG GCATCCTTTATTAAACAAGTTTGATGATACTGAAACCAGTAACAAATATGCTGGTAAA CCTGGTATAGATAATAGAGAATGTTTATCTATGGATTATAAGCAGACTCAGTTATGCA TTTTAGGATGCAAACCTCCTATAGGTGAACATTGGGGTAAGGGAACCCCTTGTAATAA TAATTCAGGAAATCCTGGGGATTGTCCTCCCCTACAACTCATTAACAGTGTAATACAG GATGGGGACATGGTAGATACAGGATTTGGTTGCATGGATTTTAATACCTTGCAAGCTA GTAAAAGTGATGTGCCCATTGATATATGTAGCAGTGTATGTAAGTATCCAGATTATTT GCAAATGGCTAGCGAGCCATATGGTGACAGTTTGTTCTTTTTTCTTAGACGTGAGCAA ATGTTTGTTAGACACTTTTTTAATAGGGCTGGTACCTTAGGTGACCCTGTGCCAGGTG ATTTATATATACAAGGGTCTAACTCTGGCAATACTGCCACTGTACAAAGCAGTGCTTT TTTTCCTACTCCTAGTGGTTCTATGGTAACCTCAGAATCCCAATTATTTAATAAACCG TACTGGTTACAACGTGCGCAGGGCCACAATAATGGCATATGTTGGGGCAATCAGTTGT TTGTCACAGTTGTGGATACCACTCGTAGCACTAACATGACTTTATGTGCTGAAGTTAA AAAGGAAAGCACATATAAAAATGAAAATTTTAAGGAATACCTTCGTCATGGCGAGGAA TTTGATTTACAATTTATTTTTCAATTGTGCAAAATTACATTAACAGCTGATGTTATGA CATACATTCATAAGATGGATGCCACTATTTTAGAGGACTGGCAATTTGGCCTTACCCC ACCACCGTCTGCATCTTTGGAGGACACATACAGATTTGTAACTTCTACTGCTATAACT TGTCAAAAAAACACACCACCTAAAGGAAAGGAAGATCCTTTAAAGGACTATATGTTTT GGGAGGTGGATTTAAAAGAAAAGTTTTCTGCAGATTTAGATCAGTTTCCTTTAGGTAG GAAGTTTTTGTTAC iii Luận văn tốt nghiệp Nguyễn Thanh Tâm - K22 Phụ lục 3: Kết giải trình tự plasmid Kết giải trình tự plasmid mang đoạn chèn HPV16 E6-E7 với cặp mồi T7SP6GCAGGCGGCCGCGAATTCACTAGTGATTCATTACATCCCGTACCCTCTTCCCCATTGG TACCTGCAGGATCAGCCATGGTAGATTATGGTTTCTGAGAACAGATGGGGCACACAATTCC TAGTGTGCCCATTAACAGGTCTTCCAAAGTACGAATGTCTACGTGTGTGCTTTGTACGCAC AACCGAAGCGTAGAGTCACACTTGCAACAAAAGGTTACAATATTGTAATGGGCTCTGTCCG GTTCTGCTTGTCCAGCTGGACCATCTATTTCATCTTCCTCCTCTGAGCTGTCATTTAATTG CTCATAACAGTAGAGATCAGTTGTCTCTGGTTGCAAATCTAACATATATTCATGCAATGTA GGTGTATCTCCATGCATGATTACAGCTGGGTTTCTCTACGTGTTCTTGATGATCTGCAACA AGACATACATCGACCGGTCCACCGACCCCTTATATTATGGAATCTTTGCTTTTTGTCCAGA TGTCTTTGCTTTTCTTCAGGACACAGTGGCTTTTGACAGTTAATACACCTAATTAACAAAT CACACAACGGTTTGTTGTATTGCTGTTCTAATGTTGTTCCATACAAACTATAACAATAATG TCTATACTCACTAATTTTAGAATAAAACTTTAAACATTTATCACATACAGCATATGGACTC CCATCTCTATATACTATGCATAAATCCCGAAAAGCAAAGTCATATACCTCACGTCGCAGTA ACTGTTGCTTGCAGTACACACATTCTAATATTATATCATGTATAGTTGTTTGCAGCTCTGT GCATAACTGTGGTAACTTTCTGGGTCGCTCCTGTGGGTCCTGAAACATTGCAGTTCTCTTT TGGTGCATAAAATGTCTGCTTTTATACTAACCGGTTTCGGTTCAACCGATTTCAATCGAAT TCCCGCGGCCGCCATGGCGGCCGGGAGCATGCGACGTCGGGCCCAATTCGCCCTATAGTGA GTCGTATTACAATTCACTGGGCCGTC Kết giải trình tự plasmid mang đoạn chèn HPV18L1 với cặp mồi M13 GAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCGCGGCCCCCACCC TTCACCATGTGCCTGTATACACGGGTCCTGATATTACATTACCATCTACTACCTCTGTATG GCCCATTGTATCACCCACAGCCCCTGCCTCTACACAGTATATTGGTATACATGGTACACAT TATTATTTGTGGCCATTATATTATTTTATTCCTAAGAAACGTAAACGTGTTCCCTATTTTT TTGCAGATGGCTTTGTGGCGGCCTAGTGACAATACCGTATATCTTCCACCTCCTTCTGTGG CAAGAGTTGTAAATACCGATGATTATGTGACTCGCACAAGCATATTTTATCATGCTGGCAG CTCTAGATTATTAACTGTTGGTAATCCATATTTTAGGGTTCCTGCAGGTGGTGGCAATAAG CAGGATATTCCTAAGGTTTCTGCATACCAATATAGAGTATTTAGGGTGCAGTTACCTGACC CAAATAAATTTGGTTTACCTGATACTAGTATTTATAATCCTGAAACACAACGTTTAGTGTG GGCCTGTGCTGGAGTGGAAATTGGCCGTGGTCAGCCTTTAGGTGTTGGCCTTAGTGGGCAT CCATTTTATAATAAATTAGATGACACTGAAAGTTCCCATGCCGCCACGTCTAATGTTTCTG AGGACGTTAGGGACAATGTGTCTGTAGATTATAAGCAGACACAGTTATGTATTTTGGGCTG TGCCCCTGCTATTGGGGAACACTGGGCTAAAGGCACTGCTTGTAAATCGCGTCCTTTATCA CAGGGCGATTGCCCCCCTTTAGAACTTAAAAACACAGTTTTGGAAGATGGTGATATGGTAG ATACTGGATATGGTGCCATGGACTTTAGTACATTGCAAGATACTAAATGTGAGGTACCATT GGATATTTGTCAGTCTATTTGTAAATATCCTGATTATTTACAAATGTCTGCAGATCCTTAT GGGGATTCCATGTTTTTTTGCTTACGGCGTGAGGTCCAAGGGGATATTGATCTAAGTCTAA AGAAAACTTTTCCTTTAAATCCACATTCCAAAACTTTAACTTATCATAGGGATCCTTATTT TCAGCCGGTGCAGCATCCTTTTGACAGGTAATAGCAACAGATTGTACAAAACGATATGTAT CCACCAAACTAGTAGTTGGCGGGGGGGGAACACCAAAGTTCCAATCCTCTAAAATACTGCT iv Luận văn tốt nghiệp Nguyễn Thanh Tâm - K22 ATTCATACTATGAATATAGGACATAACATCTGCAGTTAAAGTAATAGTACACAACTGAAAA ATAAACTGCAAATCATATTCCTCAACATGTCTGCTATACTGCTTAAATTTGGTAGCATCAT ATTGCCCAGGTACAGGAGACTGTGTAGAAGCACATATTGTTAAATTGGTACTGCGAGTGGT ATCTACCACAGTAACAAATAATTGATTATGCCAGCAAACACCATTGTTATGACCCTGTGCC TTATGTAACCAATATGGTTTATTAAACAACTGGGAGTCAGAGGTAACAATAGAGCCACTTG GAGAGGGAGAATACACACAGCTGCCAGGTGAAGCACGCATACCTGTGCCTTTAATATATAA GGATTGAGGCACAGTGTCACCCATAGTACCTGCTCTATTCCAAAAATGCCTAGCAAAAAGC TGCTCACGCCGTAAGCAAAAAAACATGGAATCCCCATAAGGATCTGCAGACATTTGTAAAT AATCAGGATATT Kết giải trình tự plasmid mang đoạn chèn HPV52L1 với cặp mồi M13 AACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCGC GGCCGCCCCCTTCACCATGGTACAGATTTTATTTTACATCCTAGTTATTTTTTACTACGTC GCAGGCGTAAACGTTTTCCATATTTTTTTACAGATGTCCGTGTGGCGGCCTAGTGAGGCCA CTGTGTACCTGCCTCCTGTACCTGTCTCTAAGGTTGTAAGCACTGATGAGTATGTGTCTCG CACAAGCATCTATTATTATGCAGGCAGTTCTCGATTACTAACAGTAGGACATCCCTATTTT TCTATTAAAAACACCAGTAGTGGTAATGGTAAAAAAGTTTTAGTTCCCAAGGTGTCTGGCC TGCAATACAGGGTATTTAGAATTAAATTGCCGGACCCTAATAAATTTGGTTTTCCGGATAC ATCTTTTTATAACCCAGAAACCCAAAGGTTGGTGTGGGCCTGTACAGGCTTGGAAATTGGT AGGGGACAGCCTTTAGGTGTGGGTATTAGTGGGCATCCTTTATTAAACAAGTTTGATGATA CTGAAACCAGTAACAAATATGCTGGTAAACCTGGTATAGATAATAGAGAATGTTTATCTAT GGATTATAAGCAGACTCAGTTATGCATTTTAGGATGCAAACCTCCTATAGGTGAACATTGG GGTAAGGGAACCCCTTGTAATAATAATTCAGGAAATCCTGGGGATTGTCCTCCCCTACAAC TCATTAACAGTGTAATACAGGATGGGGACATGGTAGATACAGGATTTGGTTGCATGGATTT TAATACCTTGCAAGCTAGTAAAAGTGATGTGCCCATTGATATATGTAGCAGTGTATGTAAG TATCCAGATTATTTGCAAATGGCTAGCGAGCCATATGGTGACAGTTTGTTCTTTTTTCTTA GACGTGAGCAAATGTTTGTTAGACACTTTTTTAATAGGGCTGGTACCTTAGGTGACCCTGT GCCAGGTGATTTATATATACAAGGGTCTAACTCTGGCAATACTGCCACTGTACATGTATGT CATAACATCAGCTGTTAATGTAATTTTGCACAATTGAAAAATAAATTGTAAATCAAATTCC TCGCCATGACGAAGGTATTCCTTAAAATTTTCATTTTTATATGTGCTTTCCTTTTTAACTT CAGCACATAAAGTCATGTTAGTGCTACGAGTGGTATCCACAACTGTGACAAACAACTGATT GCCCCAACATATGCCATTATTGTGGCCCTGCGCACGTTGTAACCAGTACGGTTTATTAAAT AATTGGGATTCTGAGGTTACCATAGAACCACTAGGAGTAGGAAAAAAAGCACTGCTTTGTA CAGTGGCAGTATTGCCAGAGTTAGACCCTTGTATATATAAATCACCTGGCACAGGGTCACC TAAGGTACCAGCCCTATTAAAAAAGTGTCTAACAAACATTTGCTCACGTCTAAGAAAAAAG AACAAACTGTCACCATATGGCTCGCTAGCCATTTGCAAATAATCTGGATACTTACATACAC TGCTACATATATCAATGGGCACATCACTTTTACTAGCTTGCAAGGTATTAAAATCCATGCA ACCAAATCCT v ... NHIÊN - Nguy n Thanh Tâm XÂY DỰNG PHƢƠNG PHÁP PHÁT HIỆN MỘT SỐ CHỦNG HUMAN PAPILLOMAVIRUS NGUY CƠ CAO GÂY UNG THƢ CỔ TỬ CUNG Ở VIỆT NAM BẰNG KỸ THUẬT REALTIME PCR Chuyên ngành: Sinh... xuất phát từ thực tiễn nêu trên, đề tài "Xây dựng phƣơng pháp phát số chủng Human Papillomavirus có nguy cao gây ung thƣ cổ tử cung Việt Nam kỹ thuật Realtime PCR" thực với mục tiêu sau: Xây dựng. .. minh mối liên quan nhiễm HPV ung thư cổ tử cung[ 19] Ung thư cổ tử cung chiếm 25% tổng số ca ung thư phụ nữ quốc gia phát triển, nguy n nhân đứng sau ung thư vú gây tử vong cho phụ nữ giới[20]
- Xem thêm -

Xem thêm: Xây dựng phương pháp phát hiện một số chủng human papilloma virus nguy cơ cao gây ung thư cổ tử cung ở việt nam bằng kỹ thuật realtime PCR , Xây dựng phương pháp phát hiện một số chủng human papilloma virus nguy cơ cao gây ung thư cổ tử cung ở việt nam bằng kỹ thuật realtime PCR , Xây dựng phương pháp phát hiện một số chủng human papilloma virus nguy cơ cao gây ung thư cổ tử cung ở việt nam bằng kỹ thuật realtime PCR

Từ khóa liên quan

Gợi ý tài liệu liên quan cho bạn

Nhận lời giải ngay chưa đến 10 phút Đăng bài tập ngay