PHÂN LẬP VÀ KHẢO SÁT KHẢ NĂNG KHÁNG MỘT SỐ VI KHUẨN VÀ NẤM BỆNH CỦA VI TẢO SCENEDESMUS QUADRICAUDA

55 382 0
  • Loading ...
1/55 trang

Thông tin tài liệu

Ngày đăng: 10/09/2016, 14:59

Ket-noi.com Ket-noi.com Kho Kho tai tai lieu lieu mien mien phi phi BỘ GIÁO DỤC VÀ ðÀO TẠO TRƯỜNG ðẠI HỌC NÔNG NGHIỆP HÀ NỘI - ðỖ VĂN TUÂN PHÂN LẬP VÀ KHẢO SÁT KHẢ NĂNG KHÁNG MỘT SỐ VI KHUẨN VÀ NẤM BỆNH CỦA VI TẢO SCENEDESMUS QUADRICAUDA LUẬN VĂN THẠC SĨ HÀ NỘI - 2014 Ket-noi.com Ket-noi.com Kho Kho tai tai lieu lieu mien mien phi phi BỘ GIÁO DỤC VÀ ðÀO TẠO TRƯỜNG ðẠI HỌC NÔNG NGHIỆP HÀ NỘI - ðỖ VĂN TUÂN PHÂN LẬP VÀ KHẢO SÁT KHẢ NĂNG KHÁNG MỘT SỐ VI KHUẨN VÀ NẤM BỆNH CỦA VI TẢO SCENEDESMUS QUADRICAUDA CHUYÊN NGÀNH : CÔNG NGHỆ SINH HỌC Mà SỐ: 60.42.02.01 NGƯỜI HƯỚNG DẪN KHOA HỌC: TS NGUYỄN ðỨC BÁCH HÀ NỘI - 2014 Ket-noi.com Ket-noi.com Kho Kho tai tai lieu lieu mien mien phi phi LỜI CAM ðOAN - Tôi xin cam ñoan số liệu kết nghiên cứu luận văn trung thực chưa ñược sử dụng ñể bảo vệ học vị - Tôi xin cam ñoan giúp ñỡ cho việc thực luận văn ñã ñược cảm ơn thông tin trích dẫn luận văn ñều ñược rõ nguồn gốc Hà Nội, ngày 01 tháng năm 2014 TÁC GIẢ LUẬN VĂN ðỗ Văn Tuân Học viện Nông nghiệp Việt Nam – Luận văn thạc sỹ Khoa học Nông nghiệp i Ket-noi.com Ket-noi.com Kho Kho tai tai lieu lieu mien mien phi phi LỜI CẢM ƠN ðể hoàn thành luận văn này, ñã nhận ñược quan tâm, giúp ñỡ thầy cô giáo, tập thể, cá nhân, gia ñình bạn bè ñồng nghiệp Tôi xin bày tỏ lòng biết ơn sâu sắc ñến TS Nguyễn ðức Bách ñã tận tình hướng dẫn, giúp ñỡ suốt trình thực ñề tài hoàn chỉnh luận văn Nhân dịp này, xin chân thành cảm ơn thầy cô thuộc Bộ môn Sinh học phân tử Công nghệ Sinh học ứng dụng, ñã giúp ñỡ, ñóng góp nhiều ý kiến quý báu tạo ñiều kiện thuận lợi ñể hoàn thành luận văn ðể hoàn thành khoá học này, nhận ñược ñộng viên hỗ trợ lớn gia ñình, bạn bè ñã tạo ñiều kiện vật chất tinh thần ñể học tập nghiên cứu Tôi xin chân thành cảm ơn./ TÁC GIẢ ðỗ Văn Tuân Học viện Nông nghiệp Việt Nam – Luận văn thạc sỹ Khoa học Nông nghiệp ii Ket-noi.com Ket-noi.com Kho Kho tai tai lieu lieu mien mien phi phi MỤC LỤC Lời cam ñoan i Lời cảm ơn ii Mục lục iii Danh mục chữ viết tắt kí hiệu v Danh mục bảng vi Danh mục hình vii PHẦN I MỞ ðẦU 1.1 ðặt vấn ñề 1.2 Mục ñích yêu cầu 1.2.1 Mục ñích 1.2.2 Yêu cầu PHẦN II TỔNG QUAN TÀI LIỆU 2.1 Giới thiệu chung vi tảo 2.1.1 Hình thái thể, cấu trúc sinh sản 2.1.2 Vai trò vi tảo 2.2 Khả kháng vi khuẩn nấm bệnh vi tảo 2.2.1 Khả kháng vi khuẩn vi tảo 2.2.2 Khả kháng vi nấm vi tảo 10 2.3 Tổng quan vi tảo Scenedesmus quadricauda 12 2.3.1 Vị trí phân loại 12 2.3.2 ðặc ñiểm hình thái, cấu trúc sinh sản vi tảo Scenedesmus quadricauda 12 2.3.3 Sự phân bố vi tảo Scenedesmus quadricauda 13 2.4 Khả kháng vi khuẩn nấm bệnh vi tảo Scenedesmus quadricaida Học viện Nông nghiệp Việt Nam – Luận văn thạc sỹ Khoa học Nông nghiệp 14 iii Ket-noi.com Ket-noi.com Kho Kho tai tai lieu lieu mien mien phi phi PHẦN III VẬT LIỆU VÀ PHƯƠNG PHÁP 16 3.1 Vật liệu, thời gian ñịa ñiểm nghiên cứu 16 3.1.1 Vật liệu nghiên cứu 16 3.1.2 ðịa ñiểm thời gian nghiên cứu 16 3.2 Nội dung nghiên cứu 16 3.3 Phương pháp nghiên cứu 16 3.3.1 Phân lập ñịnh danh vi tảo Scenedesmus quadricauda 17 3.3.2 Chiết dịch tảo dung môi khác 22 3.3.3 Phân tách thành phần dịch chiết sắc ký lớp mỏng 24 3.3.4 Thử hoạt tính kháng khuẩn kháng nấm dịch chiết 25 PHẦN IV KẾT QUẢ VÀ THẢO LUẬN 28 4.1 Kết phân lập tảo Scenedesmus 28 4.2 ðặc ñiểm sinh học tảo Scenedesmus sp 29 4.3 Nhân vùng gene ITS-1 xác ñịnh trình tự 30 4.4 ðịnh danh so sánh trình tự 32 4.5 Chiết rút thành phần hợp chất tách phân ñoạn 33 4.6 Khả kháng vi khuẩn nấm dịch chiết 34 PHẦN V KẾT LUẬN VÀ ðỀ NGHỊ 39 5.1 Kết luận 39 5.2 ðề nghị 39 DANH MỤC CÁC CÔNG TRÌNH CÔNG BỐ 40 TÀI LIỆU THAM KHẢO 41 Học viện Nông nghiệp Việt Nam – Luận văn thạc sỹ Khoa học Nông nghiệp iv Ket-noi.com Ket-noi.com Kho Kho tai tai lieu lieu mien mien phi phi DANH MỤC CÁC CHỮ VIẾT TẮT VÀ KÍ HIỆU S quadricauda Scenedesmus quadricauda X oryzae pv oryzae Xanthomonas oryzae pv oryzae R solanacearum Ralstonia solanacearum H maydis Helminthosporium maydis S aureus Staphylococcus aureus S epidermidis Staphylococcus epidermidis E coli Escherichia coli S platensis Spirulina platensis C vulgaris Chlorella vulgaris E viridis Euglena viridis C reinhardtii Chlamydomonas reinhardtii O sancta Oscillatoria sancta S grantiana Spirogyra grantiana D olivaceous Desmococcus olivaceous C humicola Chlorococcum humicola T erythraeum Trichodesmium erythraeum C disperses Chroococcus disperses C ellipsoidea Chlorella ellipsoidea C grovesii Chara grovesii C callicoma Cladophora callicoma H reticulatum Hydrodictyon reticulatum S leibleinii Schizomeris leibleinii P corium Phormidium corium S bijugatus Scenedesmus bijugatus S obliquus Scenedesmus obliquus Học viện Nông nghiệp Việt Nam – Luận văn thạc sỹ Khoa học Nông nghiệp v Ket-noi.com Ket-noi.com Kho Kho tai tai lieu lieu mien mien phi phi DANH MỤC CÁC BẢNG STT Tên bảng Bảng 2.1: Khả kháng vi khuẩn dịch chiết số loài vi tảo Trang Bảng 2.2: Khả kháng vi nấm vi tảo 11 Bảng 2.3 Khả kháng vi khuẩn nấm bệnh vi tảo Scenedesmus 14 Học viện Nông nghiệp Việt Nam – Luận văn thạc sỹ Khoa học Nông nghiệp vi Ket-noi.com Ket-noi.com Kho Kho tai tai lieu lieu mien mien phi phi DANH MỤC HÌNH STT Tên hình Trang 3.1 Vị trí ñoạn ITS1 21 3.2 Cấu tạo máy chiết Soxhlet 22 3.3 Chiết rút phân ñoạn n- hexan ethyl ether 23 4.1 Phân lập tảo Scenedesmus 28 4.2 Hình thái chủng tảo Scenedesmus sp 29 4.3 ðồ thị sinh trưởng tảo Scenedesmus sp 30 4.4 Kết nhân ñoạn ITS1 tảo Scenedesmus sp 30 4.5 Kết ñọc trình tự vùng ITS1 32 4.6 Kết BLAST ñoạn ITS1 tảo Scenedesmus sp với sở liệu NCBI 33 4.7 Thành phần nhóm chất dịch chiết 34 4.8 Biểu ñồ khả kháng vi khuẩn R solanacearum dịch chiết tảo S quadricauda dung môi 4.9 Khả kháng vi khuẩn R solanacearum dịch chiết tảo S quadricauda 4.10 35 Biểu ñồ khả kháng vi khuẩn X oryzae pv oryzae dịch chiết tảo S quadricauda 4.11 35 36 Khả kháng vi khuẩn X oryzae pv oryzae dịch chiết tảo S quadricauda 36 4.12 Biểu ñồ khả kháng nấm H maydis dịch chiết tảo S quadricauda 37 4.13 Khả kháng nấm H maydis dịch chiết tảo S quadricauda 37 Học viện Nông nghiệp Việt Nam – Luận văn thạc sỹ Khoa học Nông nghiệp vii Ket-noi.com Ket-noi.com Kho Kho tai tai lieu lieu mien mien phi phi PHẦN I MỞ ðẦU 1.1 ðặt vấn ñề Trong số loài tảo ñược biết nay, vi tảo (microalgae) chiếm tỉ lệ lớn, ña dạng thành phần loài phân bố rộng ñó có khoảng 1400 loài tảo nước 530 loài tảo nước mặn [Dương ðức Tiến, Võ Hành, 1997; Phạm Bình Quyền et al., 2002] Nhiều nghiên cứu gần ñây cho thấy số loài vi tảo nước chứa hoạt chất sinh học có tác dụng kháng virus, vi khuẩn nấm, ñó bao gồm số loài thuộc chi Scenedesmus [Beena et al., 2011, Vinay Kumar et al., 2013], Spirulina [Justella et al., 2011; Sayda et al., 2012, Hemtanon et al., 2005], Chlorella [Fabian et al., 2013] Với phong phú ña dạng thành phần loài, việc khai thác hợp chất tự nhiên từ vi tảo mở hướng nghiên cứu sử dụng hợp chất chống lại vi khuẩn nấm gây bệnh, ñặc biệt nông nghiệp Trong sản xuất nông nghiệp, ñối với trồng có ý nghĩa kinh tế lạc, cà chua, khoai tây vi khuẩn R solanacearum gây bệnh héo xanh nghiêm trọng ðây bệnh phổ biến gây tổn thất nghiêm trọng làm giảm ñáng kể ñến suất chất lượng nông sản phẩm [Nguyễn Tất Thắng et al., 2011] Ngoại trừ việc sử dụng số chế phẩm kháng sinh biện pháp canh tác, cho ñến chưa có biện pháp phòng trừ bệnh héo xanh hiệu Một số tác nhân gây bệnh hại trồng nghiêm trọng khác phải kể ñến ñó vi khuẩn X oryzae pv oryzae gây bệnh bạc lúa Bệnh bạc lúa vi khuẩn X oryzae pv oryzae ñã trở thành bệnh tàn phá nghiêm trọng giống lúa nay, lúa bị nhiễm bệnh giai ñoạn ñẻ nhánh mạnh bị giảm suất từ 20 ñến 40%, nhiễm giai ñoạn ñầu gây suy giảm suất lên ñến 50% [Jeung Ju, 2006] Nấm H maydis gây bệnh ñốm nhỏ ngô làm tổn thương lá, gây ảnh hưởng ñến khả quang hợp làm giảm suất [Abdel, 2012; Farhan et al., 2012] Cho ñến biện pháp phòng trị bệnh hiệu sử dụng thuốc hóa học Tuy nhiên việc sử dụng thuốc hóa học Học viện Nông nghiệp Việt Nam – Luận văn thạc sỹ Khoa học Nông nghiệp Ket-noi.com Ket-noi.com Kho Kho tai tai lieu lieu mien mien phi phi GAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCC CCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAAC CCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCG TGGCGTCTCCTGTTCCGACCTTGCCCTTAACNGGAAACTTGTCCGCCTTT TCCCCTTCGGGAGACGTGGGCCTTTCCCAAAACTCACGCTGTAGGATAC CAATTCCGGGGGAGGGCGTTCGCTCCAACCTTGGGTTGTGTGCCAAAAC CCCCCTTTATACCCGACCGGTGGGCCTTTACCTGGAAATAATTCTTTGGT TCAACCCGGGAAAAACAAATTATCTCCCTTGCGGCGCCCCCCTGGAAAG GGTTTAAAAAACAAGGATGTAAGGGGGTGCCCCAATTCTTTTTATGTGT GGGCTTACCCGCACCCCAAAAAAAAAAAATAATTATTTGN Hình 4.5 Kết ñọc trình tự vùng ITS1 Vùng trình tự gạch chân ñoạn ITS1, vùng trình tự bôi ñậm in nghiêng mồi ITS-1 ITS-2 4.4 ðịnh danh so sánh trình tự Sau giải trình tự ñoạn ITS1, ñoạn trình tự ñược so sánh với ngân hành sở liệu NCBI Sử dụng công cụ Nucleotide BLAST với ñoạn trình tự truy vấn (Query sequence) trình tự ñoạn ITS1 tảo cần xác ñịnh tên loài, sở liệu (Database) lựa chọn Nucleotide collection (nr/nt), lựa chọn chương trình (Program selection) Highly similar sequences (megablast) ñể ưu tiên so sánh với trình tự có giống với trình tự truy vấn Kết so sánh trình tự ITS1 với ngân hàng sở liệu NCBI công cụ BLAST cho thấy trình tự giống hoàn toàn với vùng trình tự ITS1 vùng gene mã hóa rRNA S quadricauda (AJ49521.1) giống ñến 99% so với S obliquus (AJ496388.1) Kết phân tích BLAST ñược trình bày hình 4.6 Trong môi trường tự nhiên BBM, tảo chủ yếu tồn dạng tế bào ñính với nhau, có hình dạng oval kéo dài tròn ñầu Các tế bào xếp thành hàng thẳng, ñầu tận tế bào ñược kết thúc roi Trong ñó S obliquus (Turpin), tế bào dạng elip, sau phân chia chúng ñược xếp thành hàng riêng biệt Ngoài ra, ñối với S obliquus, tế bào nằm Học viện Nông nghiệp Việt Nam – Luận văn thạc sỹ Khoa học Nông nghiệp 32 Ket-noi.com Ket-noi.com Kho Kho tai tai lieu lieu mien mien phi phi thường mối kết nối với tế bào nằm hàng khác Dựa khác biệt này, kết hợp với phân tích trình tự ITS-1, chủng tảo phân lập thuộc loài S quadricauda (Turp.) Kết phù hợp với phân bố phổ rộng loài S quadricauda thủy vực Việt Nam [Dương ðức Tiến, Võ Hành, 1997] Hình 4.6 Kết BLAST ñoạn ITS1 tảo Scenedesmus sp với sở liệu NCBI 4.5 Chiết rút thành phần hợp chất tách phân ñoạn Từ dịch chiết rút kiệt methanol, thành phần hợp chất tiếp ñược tách riêng cách chiết dung môi n-hexane ethyl ether Thành phần phân ñoạn ñược phân tách sắc ký lớp mỏng với hệ dung môi n-hexan: ethylacetate: methanol theo tỉ lệ 6:3:1 (v/v) Các vệt băng ñược quan sát cách chiếu tia UV vùng 180-280 nm nhuộm với KI 24 Kết cho thấy, dịch chiết rút kiệt methanol gồm vạch băng với giá trị Rf tương ứng từ 0.178 ñến Phân ñoạn chiết rút hexane gồm vạch băng (từ ñến 6) không chứa vạch băng với Rf = 0,178 so với dịch chiết rút kiệt methanol Thành phần dịch chiết phân ñoạn Ethyl ether có vạch băng (số 6) tương ứng với Rf = 0,456 1,0 (hình 4.7) Học viện Nông nghiệp Việt Nam – Luận văn thạc sỹ Khoa học Nông nghiệp 33 Ket-noi.com Ket-noi.com Kho Kho tai tai lieu lieu mien mien phi phi Hình 4.7 Thành phần nhóm chất dịch chiết I: Dịch chiết rút kiệt methanol, II: Phân ñoạn n-hexan, III: Phân ñoạn ethyl ether Vạch băng Giá trị Rf 0,178 0,456 0,589 0,722 0,822 4.6 Khả kháng vi khuẩn nấm dịch chiết Sau chiết rút methanol tách phân ñoạn dung môi nhexan ethyl ether, dịch chiết ñược chuẩn bị nồng ñộ 0.1, 0.2 0.3 mg/ml, sau ñó tiến hành thử nghiệm khả kháng khuẩn Kết cho thấy dịch chiết tảo S quadricauda thể hoạt tính kháng với ñối tượng thử nghiệm vi khuẩn R solanacearum, X oryzae pv ozyrae nấm H maydis Kết hình 4.8 4.9 cho thấy dịch chiết methanol dịch chiết Học viện Nông nghiệp Việt Nam – Luận văn thạc sỹ Khoa học Nông nghiệp 34 Ket-noi.com Ket-noi.com Kho Kho tai tai lieu lieu mien mien phi phi dung môi n- hexane ñều có hoạt tính kháng vi khuẩn R solanacearum, ñó phân ñoạn n-hexane cho hoạt tính kháng mạnh với ñường kính vòng kháng khuẩn trung bình 3,4 mm Phân ñoạn ethyl ether không biểu hoạt tính kháng ba nồng ñộ thử nghiệm Trong thử nghiệm ñối chứng dung môi không phát khả kháng khuẩn dung môi ñã sử dụng Hình 4.8 Biểu ñồ khả kháng vi khuẩn R solanacearum dịch chiết tảo S quadricauda dung môi Hình 4.9 Khả kháng vi khuẩn R solanacearum dịch chiết tảo S quadricauda A Dịch chiết rút kiệt methanol B Dịch chiết phân ñoạn n-hexane (1: 100 µl dung môi ñối chứng; 2, 3, tương ứng 0,1; 0,2 ; 0,3 mg/ml) Học viện Nông nghiệp Việt Nam – Luận văn thạc sỹ Khoa học Nông nghiệp 35 Ket-noi.com Ket-noi.com Kho Kho tai tai lieu lieu mien mien phi phi Khả kháng vi khuẩn X oryzae pv oryzae dịch chiết tảo S quadricauda ñược thể hình 4.10 4.11 Dịch chiết phân ñoạn nhexan cho khả kháng vi khuẩn X oryzae pv oryzae mạnh nồng ñộ dịch chiết 0.3 mg/ml, với ñường kính kháng khuẩn 3,1 mm Dịch chiết kiệt methanol cho hoạt tính kháng yếu hơn, dịch chiết phân ñoạn Ethyl ether hoạt tính kháng vi khuẩn X oryzae pv oryzae ba nồng ñộ dịch chiết Hình 4.10 Biểu ñồ khả kháng vi khuẩn X oryzae pv oryzae dịch chiết tảo S quadricauda Hình 4.11 Khả kháng vi khuẩn X oryzae pv oryzae dịch chiết tảo S quadricauda A Dịch chiết rút kiệt methanol B Dịch chiết phân ñoạn n-hexane (1: 100 µl dung môi ñối chứng; 2, 3, tương ứng 0,1; 0,2 ; 0,3 mg/ml) Học viện Nông nghiệp Việt Nam – Luận văn thạc sỹ Khoa học Nông nghiệp 36 Ket-noi.com Ket-noi.com Kho Kho tai tai lieu lieu mien mien phi phi Sau ngày nuôi cấy, bào tử nấm ñược lọc ñếm có mật ñộ 1,2.106 bào tử/ml 20 µl dịch bào tử nấm ñược cấy trải ñều môi trường thạch nuôi nhiệt ñộ 30oC ngày ñược xử lý dịch chiết Trong ba ñối tượng thử hoạt tính kháng dịch chiết tảo S quadricauda nấm H maydis cho kết thấp Kết hình 4.12 4.13 cho thấy dịch chiết rút kiệt methanol thể hoạt tính kháng nấm H maydis nồng ñộ với ñường kính vòng kháng khuẩn 1,3, 1,6 2,5 mm Phân ñoạn hexane cho hoạt tính kháng nấm nồng ñộ 0,2 0,3 mg/ml, phân ñoạn chiết rút ethyl ether hoạt tính kháng Hình 4.12 Biểu ñồ khả kháng nấm H maydis dịch chiết tảo S quadricauda Hình 4.13 Khả kháng nấm H maydis dịch chiết tảo S quadricauda A.Dịch chiết rút kiệt methanol B.Dịch chiết phân ñoạn n-hexane Học viện Nông nghiệp Việt Nam – Luận văn thạc sỹ Khoa học Nông nghiệp 37 Ket-noi.com Ket-noi.com Kho Kho tai tai lieu lieu mien mien phi phi (1: 100 µl dung môi ñối chứng; 2, 3, tương ứng 0,1; 0,2 ; 0,3 mg/ml) Kết thử nghiệm hoạt tính kháng vi khuẩn R solanacearum, X oryzae pv oryzae nấm H maydis ñã chứng minh phân ñoạn ethyl ether không chứa nhóm chất có hoạt tính kháng khuẩn nấm Trong dung môi sử dụng ñể tiến hành chiết kiệt tách phân ñoạn methanol có ñộ phân cực mạnh, dung môi ethyl ether có ñộ phân cực yếu n-hexan không phân cực Các kết thử nghiệm dịch chiết phân ñoạn n-hexan ñều cho kết dương tính với khả kháng vi khuẩn nấm bệnh, ñiều chứng tỏ hợp chất có hoạt tính kháng khuẩn có xu hướng hòa tan vào dung môi không phân cực Từ kết chạy sắc ký lớp mỏng (hình 4.7) kết thử nghiệm hoạt tính kháng khuẩn, cho thấy khả kháng khuẩn nấm liên quan ñến vết băng 1, 2,4 với trị số Rf tương ứng 0,178; 0,456; 0,722 0,822 Trong phạm vi nghiên cứu này, nhóm hợp chất tương ứng với vệt băng chưa ñược xác ñịnh Học viện Nông nghiệp Việt Nam – Luận văn thạc sỹ Khoa học Nông nghiệp 38 Ket-noi.com Ket-noi.com Kho Kho tai tai lieu lieu mien mien phi phi PHẦN V KẾT LUẬN VÀ ðỀ NGHỊ 5.1 Kết luận Dựa sở so sánh trình tự ITS-1 ñặc ñiểm hình thái, loài tảo lục phân lập xã Cổ Bi, Gia Lâm, Hà Nội ñã ñược ñịnh danh thuộc loài S quadricauda ðây loài tảo lục nước phân bố phổ biến Loài S quadricauda phân lập ñược sinh trưởng nhanh với tốc ñộ 21,6 giờ/thế hệ môi trường BBM nhiệt ñộ 22oC, cường ñộ chiếu sáng liên tục 3000 lux Dịch chiết tảo S quadricauda dung môi methanol n-hexan thể hoạt tính kháng vi khuẩn R solanacearum, X oryzae pv oryzae kháng yếu với nấm H maydis Các hợp chất có khả kháng khuẩn nấm có xu hướng hòa tan vào dung môi phân cực Hoạt tính kháng có liên quan tới nhóm chất phân bố vệt có hệ số Rf tương ứng 0,178; 0,45; 0,722 0,822 hệ dung môi n-hexan: ethylacetate: methanol theo tỉ lệ 6:3:1 (v/v) 5.2 ðề nghị Cần thiết thực nghiên cứu ñể xác ñịnh nhóm chất có hoạt tính kháng khuẩn, sở ñó giải thích ñược chế kháng vi khuẩn R solanacearum, X oryzae pv oryzae nấm H maydis nhóm chất Học viện Nông nghiệp Việt Nam – Luận văn thạc sỹ Khoa học Nông nghiệp 39 Ket-noi.com Ket-noi.com Kho Kho tai tai lieu lieu mien mien phi phi DANH MỤC CÁC CÔNG TRÌNH CÔNG BỐ ðỗ Văn Tuân, Lê Thị Thiên Nga, Trịnh Thị Trang, Nguyễn Văn Tâm, Nguyễn Hoài Nam, Nguyễn Thị Bích Ngọc, Nguyễn ðức Bách Phân lập khảo sát khả kháng vi khuẩn Ralstonia solanacearum nấm Helminthosporium maydis vi tảo Scenedesmus quadricauda Hội thảo quốc gia Bệnh hại thực vật Việt Nam, 6-7/5/2014, tr 55-65 Học viện Nông nghiệp Việt Nam – Luận văn thạc sỹ Khoa học Nông nghiệp 40 Ket-noi.com Ket-noi.com Kho Kho tai tai lieu lieu mien mien phi phi TÀI LIỆU THAM KHẢO Abdel Ghany T M (2012) Fungal leaf spot of maize: pathogen isolation, identification and host biochemical characterization Mycopath, 10(2): 41-49 Abedin R.M.A., Taha H.M (2008) Antibacterial and antifungal activity of cyanobacteria and green microalgae Evaluation of medium components by Plackett-Burman design for antimicrobial activity of Spirulina platensis Global Journal of Biotechnology and Biochemistry, 3:22-31 Aboal M., Llimona X (1984) Aportaciones al conocimiento de la flora del río Mula, Murcia, SE de España Limnética, 1: 141-147 Advardsen B and Medlin L (1998) Genetic analyses of authentic and alternate forms of Chrysochromulina polylepsis (Haptophyta) Phycologia, 37: 275-283 Ali D.M., Praveenkumar R., Shenbagavalli T., Nivetha T.M., Ahamed A.P., Aldabi N.A and Thajiuddin N (2012) New reports on antibacterial and anti candida activities of fatty acid methyl esters (Fame) abtained from Scenedesmus bijugatus var bicellularis biomass RSC Advances, 2:11552-11556 Anju Dhiman, Arun Nanda, Sayeed Ahmad and B Narasimhan (2011) In vitro antimicrobial activity of methanolic leaf extract of Psidium guajava L J Pharm Bioallied Sci, 3(2): 226–229 Babadzhanov A.S et al (2004) Chemical Composition of Spirulina Platensis Cultivated in Uzbekistan Chemistry of Natural Compounds, 40(3) Backer F.T., Olsen J.L., Stam W.T and Van Den Hoek C (1992) Nuclear ribosomal DNA internal transcribed spacer regions (ITS1 and ITS2) define discrete biogeography groups in Cladophora albida (Chlorophyta) Journal of Phycology, 28:839-845 Becker E.W (2004) Microalgae in human and animal nutrition In: Richmond A., editor Handbook of Microalgae Culture Biotechnology and Applied Phycology Oxford: Blackwell Science 10 Beena B Nair and A Krishnika (2011) Antibacterial activity of freshwater Microalga (Scenedesmus sp.) against three bacterial strains Journal of Bioscience Research, 2(4):160-165 11 Buchan A., Newell S.Y., Moreta J.I.L., Moran M.A (2002) Analysis of Internal transcribed spacer (ITS) region of rRNA genes in fungal communities in a Southeastern U.S Salt Marsh Journal of Microbial Ecology, 43: 329-340 12 Brown M.R., Jeffrey S.W., Wolkman J.K and Dunstan G.A (1997) Mutritional properties of microalgae for mariculture Aquaculture, 151:315-331 13 Brown M.R (2002) Nutritional value of microalgae for aquculture In: CruzSuárez, L E., Ricque-Marie, D., Tapia-Salazar, M., Gaxiola-Cortés, M G., Simoes, N (Eds.) Avances en Nutrición Acuícola VI Memorias del VI Học viện Nông nghiệp Việt Nam – Luận văn thạc sỹ Khoa học Nông nghiệp 41 Ket-noi.com Ket-noi.com Kho Kho tai tai lieu lieu mien mien phi phi Simposium Internacional de Nutrición Acuícola al de Septiembre del 2002 Cancún, Quintana Roo, México 14 ðặng Thị Thanh Hòa, Trần Thị Mỹ Xuyên (2007) Phân lập tìm hiểu sinh trưởng Scenedesmus (Chlorococcales) số môi trường Tạp chí Khoa học Kỹ thuật Nông Lâm nghiệp, 1: 146-149 15 Das B.K., Pradhan J., Pattnaik P., Samantaray B.R., Samal S.K (2005) Production of antibacterials from the freshwater alga Euglena viridis (Ehren) World Journal of Microbiology and Biotechnology, 21:45-50 16 Desbois A.P., Lebl T., Yan L.A., Smith V.J (2008) Isolation and structural characterization of two antibacterial free fatty acids from the marine diatom, Phaeodactylum tricornutum Appl Microbial Biotechnol, 81:755–764 17 Desbois A.P., Mearns-Spragg A., Smith V.J (2009) A fatty acid from the diatom Phaeodactylum tricornutum is antibacterial against diverse bacteria including multi-resistant Staphylococcus aureus (MRSA) Mar Biotechnol, 11:45–52 18 Dhingra OD, Sinclair JB Basic plant pathology methods Boca Rato´n, FL: CRC Press; 1985 p 261 19 Dương ðức Tiến, Trần Thị Tình (2001) Tảo nước ðà Lạt Tạp chí khoa học ñại học ðà Lạt, 18:68-72 20 Dương ðức Tiến, Võ Hành (1997) Tảo nước Việt Nam- Phân loại Tảo lục (Chlorococcales) Nhà xuất Nông Nghiệp 21 Dragos N., Bercea V., Adriana Bica, Druga B., Ana Nicoara and C Coman (2010) Astaxanthin production from a new strain of Haematococcus pluvialis grown in bath culture Annals of RSCB, 15(2):353-361 22 Edvardsen B and Medlin L (1998) Genetic analyses of authentic and alternate forms of Chrysochromulina polylepis (Haptophyta) Phycologia, 37: 275–283 23 Enright, C T., Newkirk, G F., Craigie, J S., Castell, J D (1986) Growth of juvenile Ostrea edulis L fed Chaetoceros calcitrans Schütt of varied chemical composition Journal of Experimental Marine Biology and Ecology, 96: 15–26 24 Fabian Grammes, Felipe Eduardo Reveco, Odd Helge Romarheim, Thor Landsverk, Liv Torunn Mydland, Margareth Øverland 2013 PLOS ONE Volume 8, Issue 12, e83213 25 Farhan Ali, Mareeya Muneer, Jie Xu, Durrishahwar, Hidayat ur Rahman, Yanli Lu, Waseem Hassan, Hidayat Ullah, Muhammad Noor, Iltaf Ullah, Jianbing Yan 2012 Accumulation of desirable alleles for southern leaf blight (SLB) in maize (Zea mays L.) under the epiphytotic of Helminthosporium maydis AJCS 6(8):1283-1289 26 Ghasemi Y., Moradian A., Mohagheghzadeh A., Shokravi S., Morowvat M.H (2007) Antifungal and antibacterial activity of the microalgae collected from Học viện Nông nghiệp Việt Nam – Luận văn thạc sỹ Khoa học Nông nghiệp 42 Ket-noi.com Ket-noi.com Kho Kho tai tai lieu lieu mien mien phi phi paddy fields of Iran: characterization of antimicrobial activity of Chlorococcus dispersus Journal of Biological Sciences,7:904-910 27 Guzine I El Diwani, ShadiaA El Rafei, Salwa I Hawash, Sanaa A El Enin (2011) Optimized flocculation of microalgae for fuel oil and antioxidant production Der Chemica Sinica, (4):12-25 28 Granada G.A., and Sequeira L (1983) A new selective medium for Ralstonia solanacearum Plant Desease, 67:1084-1088 29 Hemtanon, P., Direkbusarakom, S., Bunyawiwat, V and Tantitakoon, O (2005) Antiviral and Antibacterial Substances from Spirulina platensis to combat White Spot Syndrome Virus and Vibrio harveyi Diseases in Asian Aquaculture V: 525-534 Fish Health Section, Asian Fisheries Society, Manila 30 Iffat Naz, Shama sehar, Irum Perveen, Abdul Rehman, Yasmin Ahmad and Safia Ahmad (2013) Optimization of Cultural Conditions for Helminthosporium maydis Isolates from Infected Maize Plants from Different Agricultural Zones of Pakistan British Microbiology Research Journal, 2(4): 233-242 31 Justella Wilfred Prakash, Johnson Marimuthu Antonisamy, Solomon Jeeva (2011) Antimicrobial activity of certain fresh water microalgae from Thamirabarani River, Tamil Nadu, South India Asian Pacific Journal of Tropical Biomedicine S170-S173 32 Kamble S.M., Rokde A.U and Chavan M.A (2012) Antifungal activity of alga extracts against plant phthogenic fungi International Multidisciplinary Research Journal, 2(3):23-24 33 Kaushik P and Chauhan A (2008) In vitro antibacterial activity of laboratory grown culture of Spirulina platensis Indian J Microbiol, 48:348-352 34 Kasinathan Thillairajasekar, Veeramuthu Duraipandiyan, Pachiappan Perumal, Savarimuthu Ignacimuthu (2009) Antibacterial activity of Trichodesmium erythraeum (Her) (microalga) from South East coast of Tamil Nadu, India International Journal of Intergrative Biology, 5: 167:170 35 Kentzer Teresa and Tukaj Zbigniew (1984) Growth responses of Scenedesmus quadricauda to oil pollution at different temperatures and light intensities Ocenalogia, 22:41-49 36 King E.O., Ward M.K., Raney D.E (1954) Two simple media for demonstration of pyocyanin and fluorescein J Lab Clin Med, 44: 301-330 37 Mayer M.S.A, Rodríguez D.A, Berlinck G.S.R, Hamann T.M (2009) Marine pharmacology in 2005-6: Marine compounds with anthelmintic, antibacterial, anticoagulant, antifungal, anti- inflammatory, antimalarial, antiprotozoal, antituberculosis, and antiviral activities; affecting the cardiovascular, immune and nervous systems, and other miscellaneous mechanisms of action Biochimica et Biophysia Acta, 1790:283-308 38 Meizoso R.I et al (2008), Pressurized fluid extraction of bioactive compounds Học viện Nông nghiệp Việt Nam – Luận văn thạc sỹ Khoa học Nông nghiệp 43 Ket-noi.com Ket-noi.com Kho Kho tai tai lieu lieu mien mien phi phi from Phormidium species J Agric Food chem,56(10):3517-3523 39 Metting F.B (1996) Biodiversity and application of microalgae J Ind Microbiol,17:477–89 40 Mohd Syahril M.Z., Roshani O., Nur hasyimah R., Mohamad Hafiz M.S., Sharida M.D and Ahmed H.Y (2011) Screening of anticancer activities of crude extracts of unicellular green algae (Chlorella vulgaris) and filamentous blue algae (Spirulina platensis) on selected cancer cell lines International Conference on Applied Sciences, Mathermatic and Humantities, p82-87 41 Nguyễn ðức Bách, ðặng Diễm Hồng (2003) Mối quan hệ di truyền số chủng Scenedesmus phân lập từ hồ Hoàn Kiếm dựa trình tự ñoạn Nucleotid ñoạn ITS1- Ribosom Tạp chí Sinh học, 25(3): 105-109 42 Nguyễn Lân Dũng (2000) Vi sinh vật học Nhà xuất Giáo dục 43 Nguyễn Tất Thắng, ðỗ Tấn Dũng, Nguyễn Văn Tuất (2011) Nghiên cứu bệnh héo xanh vi khuẩn (Raltonia solanacearum Smith) hại khoai tây vùng Hà Nội -phụ cận biện pháp phòng trừ Tạp chí Khoa học Phát triển, tập 9, số 5: 725 – 734 44 Nichols H.W., and H.C Bold (1965) Trichosarcina polymorpha J Phycology, 1:34-36 45 Ohta S., Chang T., Kawashima A., Nagate T., Murase M., Nakanishi H., Miyata H., Kondo M (1994) Anti methicillin-resistant Staphylococcus aureus (MRSA) activity by linolenic acid isolated from the marine microalga Chlorococcum HS101 Bull Environ Contam Toxicol, 52:673–680 46 Ördög V., Stirk W.A., Lenobel R., Bancírová M., Strand M., van Standen J (2004) Screening microalgae for some potentially useful agricultural and pharmaceutical secondary metabolites Journal of Applied Phycology, 16:309314 47 Pandian Prabakaran and A David Ravindran 2012 Scenedesmus as a potential source of biodiesel among selected microalgae Current Science, Vol 102 (4): 616-620 48 Phạm Bình Quyền, Nguyễn Nghĩa Thìn ða dạng sinh học (2002) Nhà xuất ðại học Quốc Gia 49 Pratt R., Daniels T.C., Eiler J.B., Gunnison J.B., Kumler W.D (1944) Chlorellin, an antibacterial substance from Chlorella Science, 99:351-352 50 Ratiphan Laungsuwon and Warawut Chulalaksananukul (2013) Antioxidant and anticancer activities of freshwater green algae, Cladophora glomerata and Microspora floccosa, from Nan River in northern Thailand Maejo International Journal of Science and Technology, 7(2): 181-188 47 51 Renaud S M., Thinh L.V., Parry D L (1999) The gross composition and fatty acid composition of 18 species of tropical Australian microalgae for possible use Học viện Nông nghiệp Việt Nam – Luận văn thạc sỹ Khoa học Nông nghiệp 44 Ket-noi.com Ket-noi.com Kho Kho tai tai lieu lieu mien mien phi phi in mariculture Aquaculture, 170: 147-159 52 Sahlan Ozturk, Belma Aslim and Yavuz Beyath (2006) Biological screening of microalgae isolated from different freshwaters of Turkey: Antimicrobial activity, viability and brine shrimp lethality Fresenius Enviroinmental Bulletin vol 15: 1232-1237 53 Samarakoon K.W., Ko J.Y., Rahman Shah, Lee J.H., Kang M.C., Kwon ONam, Joon-Baek Lee and You-Jin Joen (2013) In vitro studies of antiinflammatory and anticancer activities of organic solvent extracts from cultured marine microalgae Algae, 28(1):111-119 54 Santoyo S, Rodríguez-Meizoso I, Cifuentes A, Jaime L, García-Blairsy Reina G, Señorans FJ, Ibáñez E.(2009), Green processes based on the extraction with pressurized fluids to obtain potent antimicrobials from Haematococcus pluvialis microalgae LWT – Food Science and Technology, 42:1213-1218 55 Sayda M Abdo, Mona H Hetta, Waleed M El-Senousy, Rawheya A Salah El Din, Gamila H Ali (2012) Antiviral Activity of Freshwater Algae Journal of Applied Pharmaceutical Science 02 (02): 21-25 56 Spolaore P., Joannis-Cassan C., Duran E., Isambert A (2006) Commercial applications of microalgae J Biosci Bioeng, 101:87–96 57 Suresh S.R., Yenjerappa S.T., Naik M.K., Mallesh S.B., and C.M Kalibavi (2013) Studies on cultural and physiological characters of Xanthomonas oryzae pv.oryzae causing bacterial blight of rice Karnataka Journal of Agricultural Science, 26(2): 214-216 58 Trần Hữu Quang (1999) Nghiên cứu trình tách chiết nhanh làm axit nucleic từ loài tảo biển Kỷ yếu Viện Công nghệ sinh học 1999: 107-113 59 Uma R., Sivasubramanian V and Niranjali Devaraj S (2011) Preliminary phycochemical analysis and in vitro antibacterial screening of green microalgae, Desmococcus olivaceous, Chlorococcum humicola and Chlorella vulgaris Journal of Algal Biomass Utilization, 2(3): 74-81 60 Valérie S, Takeo H, Tadao Y, Annette W.C, Masuda M (2000) Phylogenetic relationships of Sargassum (Sargassaceae, Phaeophyceae) with reference to a taxonomic revision of the section Phyllocystae based on ITS-2 nrDNA sequences Phycological Research, 48(4):251-260 61 Vinay Kumar, Prem SaranTirumalai, Abha Singh, Bhatnagar A.K., Shrivastava J.N (2013) Natural Compounds from Algae and Spirulina platensis and its Antimicrobial Activity Indo Global Journal of Pharmaceutical Sciences, 3(3): 212-223 62 Wakimoto S (1960) Classification of strain of Xanthomonas aryzae on the basic of their susceptibility against bacteriophages Ann Phytopath Soc Japan, 25: 193-198 63 Washida K, Koyama T, Yamada K, Kitab M, Uemura D Karatungiols A and B, Học viện Nông nghiệp Việt Nam – Luận văn thạc sỹ Khoa học Nông nghiệp 45 Ket-noi.com Ket-noi.com Kho Kho tai tai lieu lieu mien mien phi phi two novel antimicrobial polyol compounds, from the symbiotic marine dinoflagellate Amphidinium sp Tetrahedron Letters 2006;47:2521-2525 64 White, T.J., Bruns, T., Lee, S., Taylor, J.(1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics In: PCR Protocols: a guide to methods and applications Innis M.A, Gelfand DH, Sninsky J.J, White T.J, eds Academic Press, New York, USA: 315–322 65 Yotsukura N., Kawai T., Motomura T and Ichimura T (2001) Random amplified polymorphic DNA markers for three Japanese laminarian species Fisheries Science, 67:857-862 66 Yusuf Chisti (2007) Biodiesel from microalgae Biotechnology advances, 23:294-306 Học viện Nông nghiệp Việt Nam – Luận văn thạc sỹ Khoa học Nông nghiệp 46
- Xem thêm -

Xem thêm: PHÂN LẬP VÀ KHẢO SÁT KHẢ NĂNG KHÁNG MỘT SỐ VI KHUẨN VÀ NẤM BỆNH CỦA VI TẢO SCENEDESMUS QUADRICAUDA, PHÂN LẬP VÀ KHẢO SÁT KHẢ NĂNG KHÁNG MỘT SỐ VI KHUẨN VÀ NẤM BỆNH CỦA VI TẢO SCENEDESMUS QUADRICAUDA, PHÂN LẬP VÀ KHẢO SÁT KHẢ NĂNG KHÁNG MỘT SỐ VI KHUẨN VÀ NẤM BỆNH CỦA VI TẢO SCENEDESMUS QUADRICAUDA, Phần II.Tổng quan tài liệu, Phần III. Vật liệu và phương pháp, Phần IV. Kết quả và thảo luận, Tài liệu tham khảo

Từ khóa liên quan

Gợi ý tài liệu liên quan cho bạn