thiết kế và ứng dụng các chỉ thị adn xác định các gen ứng viên liên quan đến tính chịu mặn ở một số giống lúa bản địa của việt nam đã giải mã hệ gen

69 667 0
  • Loading ...
1/69 trang

Thông tin tài liệu

Ngày đăng: 29/05/2016, 13:23

HỌC VIỆN NÔNG NGHIỆP VIỆT NAM NGUYỄN THỊ THÙY LIÊN THIẾT KẾ VÀ ỨNG DỤNG CÁC CHỈ THỊ ADN XÁC ĐỊNH CÁC GEN ỨNG VIÊN LIÊN QUAN ĐẾN TÍNH CHỊU MẶN Ở MỘT SỐ GIỐNG LÚA BẢN ĐỊA CỦA VIỆT NAM ĐÃ GIẢI MÃ HỆ GEN LUẬN VĂN THẠC SĨ HÀ NỘI, NĂM 2015 HỌC VIỆN NÔNG NGHIỆP VIỆT NAM NGUYỄN THỊ THÙY LIÊN THIẾT KẾ VÀ ỨNG DỤNG CÁC CHỈ THỊ ADN XÁC ĐỊNH CÁC GEN ỨNG VIÊN LIÊN QUAN ĐẾN TÍNH CHỊU MẶN Ở MỘT SỐ GIỐNG LÚA BẢN ĐỊA CỦA VIỆT NAM ĐÃ GIẢI MÃ HỆ GEN Chuyên ngành : Công nghệ sinh học Mã số : 60.42.02.01 Người hướng dẫn khoa học: TS Khuất Hữu Trung PGS TS Nguyễn Thị Phương Thảo HÀ NỘI, NĂM 2015 LỜI CAM ĐOAN Tôi xin cam đoan công trình nghiên cứu riêng hướng dẫn TS Khuất Hữu Trung PGS TS Nguyễn Thị Phương Thảo Các kết nghiên cứu trình bày luận văn trung thực, khách quan chưa dùng để bảo vệ lấy học vị Tôi xin cam đoan giúp đỡ cho việc thực luận văn cám ơn, thông tin trích dẫn luận văn rõ nguồn gốc Hà Nội, ngày tháng năm 2015 Tác giả Nguyễn Thị Thùy Liên Học viện Nông nghiệp Việt Nam – Luận văn Thạc sỹ Khoa học Nông nghiệp Page i LỜI CẢM ƠN Trong suốt thời gian học tập, nghiên cứu hoàn thành luận văn, nhận hướng dẫn, bảo tận tình thầy cô giáo, giúp đỡ, động viên bạn bè, đồng nghiệp gia đình Nhân dịp hoàn thành luận văn, cho phép bày tỏ lòng kính trọng biết ơn sâu sắc tới TS Khuất Hữu Trung, PGS TS Nguyễn Thị Phương Thảo tận tình hướng dẫn, dành nhiều công sức, thời gian tạo điều kiện cho suốt trình học tập thực đề tài Tôi xin bày tỏ lòng biết ơn chân thành tới Ban Giám đốc, Ban Quản lý đào tạo, Bộ môn Công nghệ sinh học thực vật, Khoa Công nghệ sinh học - Học viện Nông nghiệp Việt Nam tận tình giúp đỡ trình học tập, thực đề tài hoàn thành luận văn Tôi xin chân thành cảm ơn tập thể lãnh đạo, cán viên chức môn Kỹ thuật di truyền, Viện Di truyền Nông nghiệp giúp đỡ tạo điều kiện cho suốt trình thực đề tài Tôi xin chân thành cảm ơn gia đình, người thân, bạn bè, đồng nghiệp tạo điều kiện thuận lợi giúp đỡ mặt, động viên khuyến khích hoàn thành luận văn./ Hà Nội, ngày tháng năm 2015 Học viên Nguyễn Thị Thùy Liên Học viện Nông nghiệp Việt Nam – Luận văn Thạc sỹ Khoa học Nông nghiệp Page ii MỤC LỤC Lời cam đoan i Lời cảm ơn ii Mục lục iii Danh mục chữ viết tắt v Danh mục bảng vi Danh mục hình vii Trích yếu luận văn viii Thesis abstract ix Phần Mở đầu 1.1 Tính cấp thiết đề tài 1.2 Mục tiêu nghiên cứu 1.3 Yêu cầu đề tài 1.4 Phạm vi nghiên cứu 1.5 Ý nghĩa khoa học ý nghĩa thực tiễn đề tài Phần Tổng quan tài liệu 2.1 Tính chống chịu mặn lúa 2.2 Nghiên cứu di truyền giống lúa chống chịu mặn 2.2.1 Nghiên cứu di truyền số lượng tính chống chịu mặn lúa 2.2.2 Nghiên cứu di truyền phân tử tính chống chịu mặn lúa 2.3 Gen ứng viên 2.3.1 Các bước xác định gen ứng viên 2.3.2 Phương pháp tin sinh học xác định gen ứng viên chịu mặn 2.4 Chỉ thị adn xác định gen ứng viên liên quan đến tính chịu mặn 12 2.4.1 Chỉ thị ADN 12 2.4.2 Phương pháp thiết kế thị phân tử 13 2.5 Ứng dụng thị phân tử chọn tạo giống lúa chịu mặn 14 2.5.1 Các giả thuyết mô hình MAS 15 2.5.2 Điều kiện để ứng dụng MAS 16 2.5.3 Ứng dụng thị phân tử chọn tạo giống lúa chịu mặn giới 17 2.5.4 Ứng dụng thị phân tử chọn tạo giống lúa chịu mặn Việt Nam 19 Học viện Nông nghiệp Việt Nam – Luận văn Thạc sỹ Khoa học Nông nghiệp Page iii Phần Vật liệu, nội dung phương pháp nghiên cứu 22 3.1 Địa điểm nghiên cứu 22 3.2 Thời gian nghiên cứu 22 3.3 Vật liệu nghiên cứu 22 3.3.1 Nguồn vật liệu 22 3.3.2 Hóa chất dụng cụ thí nghiệm 23 3.4 Nội dung nghiên cứu 24 3.5 Phương pháp nghiên cứu 24 3.5.1 Phương pháp thiết kế thị ADN xác định gen ứng viên dựa trình tự genome 24 3.5.2 Phương pháp bố trí thí nghiệm đồng ruộng 28 3.5.3 Phương pháp lai hữu tính – lai trở lại giống cho nhận gen 28 3.5.4 Phương pháp nghiên cứu phòng thí nghiệm 30 3.5.5 Phương pháp xử lí số liệu 32 Phần Kết thảo luận 33 4.1 Kết xác định gen ứng viên chịu mặn 4.1.1 Kết phân tích thành phần nucleotide vùng CDS (Coding DNA 33 Sequence) thành phần amino acid gen ứng viên SRWD5 (SALT RESPONSIVE WD40 PROTEIN ) 33 4.1.2 Kết tầm soát thiết kế mồi nhận dạng gen ứng viên SRWD5 chịu mặn 34 4.1.3 Kết phân tích thành phần nucleotide vùng CDS (Coding DNA Sequence) thành phần amino acid gen ứng viên RSS1 38 4.1.4 Kết tầm soát thiết kế mồi nhận dạng gen ứng viên RSS1 chịu mặn 42 4.2 Ứng dụng thị phân tử xác đinh, chọn lọc cá thể lai mang gen ứng viên chịu mặn 4.2.1 46 Kết xác định cá thể mang gen ứng viên chịu mặn tập đoàn 36 giống lúa địa 4.2.2 46 Kết lai tạo chọn lọc cá thể mang gen ứng viên chịu mặn hệ lai 48 Phần Kết luận kiến nghị 54 5.1 54 Kết luận 5.2 Kiến nghị 54 Tài liệu tham khảo 55 Học viện Nông nghiệp Việt Nam – Luận văn Thạc sỹ Khoa học Nông nghiệp Page iv DANH MỤC CHỮ VIẾT TẮT ADN : Axit Deoxyribonucleic AFLP : Amplified Fragment Length Polymorphism - Đa hình chiều dài đoạn nhân chọn lọc RAPD : Random Amplification of Polymorphic DNA - Đa hình ADN nhân ngẫu nhiên RFLP : Restriction Fragment Length Polymorphism – Đa hình chiều dài mảnh phân cắt giới hạn STS : Sequence Tagged Site – Xác định vị trí trình tự đánh dấu NCBI : National Center for Biotechnology Information – Trung tâm quốc gia công nghệ thông tin sinh học SNP : Single Nucleotide Polymorphisms – Đa hình nucleotide đơn SSR : Simple Sequence Repeat - Sự lặp lại trình tự đơn giản Bp : Base pair – Cặp bazơ nitơ cDNA : Complementary DNA – Thư viện ADN bổ trợ cs : Cộng ctv : Cộng tác viên IRGSP : International Rice Genome Sequencing Project dNTP : Deoxynucleotide triphosphate MABC : Marker Assisted Backcrossing – Chọn lọc nhờ thị phân tử kết hợp lai trở lại MAS : Marker Assisted Selection – Chọn lọc nhờ thị phân tử NST : Nhiễm sắc thể PCR : Polymerase Chain Reaction - Phản ứng chuỗi trùng hợp QTL/ QTLs : Quantitative Trait Loci - Locus kiểm soát tính trạng số lượng TBE : Tris-Boric Acid-EDTA Học viện Nông nghiệp Việt Nam – Luận văn Thạc sỹ Khoa học Nông nghiệp Page v DANH MỤC BẢNG Bảng 3.1 Danh sách 36 giống lúa địa giải mã 22 Bảng 3.2 Thành phần phản ứng PCR 31 Bảng 3.3 Các bước phản ứng PCR 31 Bảng 3.4 Thành phần gel polyacrylamide 31 Bảng 4.1 Thống kê nucleotide vùng CDS (Coding DNA Sequence) gen/gen ứng viên SRWD5 33 Bảng 4.2 Thống kê tỉ lệ (%) amino acid gen/gen ứng viên SRWD5 34 Bảng 4.3 Thống kê số lượng tỉ lệ nucleotit gen ứng viên SRWD5 giống lúa giải mã Bảng 4.4 35 Thống kê nucleotide vùng CDS (Coding DNA Sequence) gen/gen ứng viên RSS1 38 Bảng 4.5 Thống kê tỉ lệ (%) amino acid gen/gen ứng viên RSS1 40 Bảng 4.6 Bảng thống kê số lượng tỉ lệ nucleotide gen ứng viên RSS1 Bảng 4.7 giống lúa giải mã 43 Kết lai tạo lai hệ F1, BC1F1 BC2F1 48 Học viện Nông nghiệp Việt Nam – Luận văn Thạc sỹ Khoa học Nông nghiệp Page vi DANH MỤC HÌNH Hình 1.1 Tóm tắt bước xác định gen ứng viên Hình 4.1 Ảnh dóng hàng, dóng cột so sánh trình tự đoạn gen SRWD5 số giống lúa địa (đoạn khoảng 200Nucleotide so với số giống địa) Hình 4.2 35 Ảnh dóng hàng, dóng cột so sánh trình tự đoạn gen chịu mặn RSS1 số giống lúa địa (đoạn thêm 15 Nu) Hình 4.3 44 Kết điện di sản phẩm PCR 36 giống lúa địa với thị SRWD5del200 Hình 4.4 46 Kết điện di sản phẩm PCR 36 giống lúa địa với cặp mồi RSS1del15 Hình 4.5 47 Kết điện di sản phẩm PCR lai BC1F1 với cặp mồi 49 SRWD5del200 Hình 4.6 Kết điện di sản phẩm PCR lai BC2F1 với cặp mồi 50 SRWD5del200 Hình 4.7 Kết điện di sản phẩm PCR lai BC1F1 với cặp mồi RSS1del15 Hình 4.8 50 Kết điện di sản phẩm PCR lai BC2F1 với cặp mồi RSS1del15 Hình 4.8 51 Kết điện di sản phẩm PCR lai BC2F1 với cặp mồi RSS1del15 Hình 4.9 51 Ruộng gieo mạ ruộng cấy nguồn vật liệu bố mẹ phục vụ lai tạo F1 52 Hình 4.10 Ghép cặp cho tổ hợp lai 52 Hình 4.11 Bao cách ly sau khử nhị 52 Hình 4.12 Hạt lai BC2F1 (Bắc thơm x Coi ba đất ) sau thu hoạch 53 Học viện Nông nghiệp Việt Nam – Luận văn Thạc sỹ Khoa học Nông nghiệp Page vii TRÍCH YẾU LUẬN VĂN Nhiễm mặn nhân tố phi sinh học làm giảm suất nhiều vùng trồng lúa giới Cải tiến tính chịu mặn lúa vùng nhiễm mặn mục tiêu quan trọng chương trình chọn tạo giống lúa Dựa vào trình tự 36 giống lúa địa Việt Nam giải mã hệ gen xác định gen ứng viên liên quan đến tính chịu mặn số giống lúa địa Việt Nam giải mã: SRWD5 (SRWD5 TOLERANCE) RSS1(RICE SALT SENSITIVE 1) Dựa vào kết phân tích thành phần nucleotide vùng CDS (Coding DNA Sequence) thành phần amino acid gen ứng viên; kết tầm soát trình tự tương đồng 36 giống lúa giải mã so sánh với locus gen có khả chịu mặn thiết kế thị ADN SRWD5del200 RSS1del15 đặc trưng cho gen ứng viên chịu mặn Thực phép lai trở lại (MABC) tổ hợp lai: Bắc thơm x Coi ba đất TSL1x OM6377 lai tạo tổng số 16 hạt lai BC1F1 54 hạt lai BC2F1 Sử dụng thị ADN thiết kế để sàng lọc cá thể từ hệ BC1F1 đến hệ BC2F1 xác định cá thể BC1F1 27 cá thể BC2F1 mang gen ứng viên chịu mặn Kết nghiên cứu sở cho việc áp dụng thị phân tử chương trình chọn tạo giống lúa chịu mặn Học viện Nông nghiệp Việt Nam – Luận văn Thạc sỹ Khoa học Nông nghiệp Page viii Kết tầm soát so sánh trình tự gen RSS1 36 giống lúa địa phần mềm chuyên dụng cho thấy: xuất đoạn thêm, bớt (InDels) giống với khoảng cách 15 nucleotide tìm thấy 06 giống địa Việt Nam Xương gà, Nếp ông táo, OM3536, Tốc lùn, Tám xoan Hải Hậu OM6377 (Hình 4.2) Hình 4.2 Ảnh dóng hàng, dóng cột so sánh trình tự đoạn gen chịu mặn RSS1 số giống lúa địa (đoạn thêm 15 Nu) Dựa vào sai khác trình tự đoạn gen có khả kháng mặn RSS1 giống lúa, sử dụng phần mềm thiết kế mồi Primer 3.0 thiết kế cặp mồi: Cặp mồi số 1: Học viện Nông nghiệp Việt Nam – Luận văn Thạc sỹ Khoa học Nông nghiệp Page 44 Cặp mồi số 2: Cặp mồi số 3: Cặp mồi số 4: Cặp mồi số 5: Sau kiểm tra chất lượng cặp mồi qua thông số kỹ thuật chọn cặp mồi số đặt tên đặt tên RSS1del15 trình tự: RSS1del15F: TATCATCATTATCCTCTTTGCA/ Học viện Nông nghiệp Việt Nam – Luận văn Thạc sỹ Khoa học Nông nghiệp Page 45 RSS1del15R: AGTGTGAATGATTATCACACCAA khuếch đại đoạn gen với kích thước tính toán giống khác với kích thước khác 123bp 138bp, từ phát đoạn gen ứng viên khác biệt giống lúa địa Việt Nam gen tham chiếu Theo thiết kế mồi so sánh với gen tham chiếu giới công bố thực phản ứng PCR với cặp mồi RSS1 del15R có khả sau xảy ra: có xuất băng kích thước 123bp, nghĩa giống mang gen ứng viên RSS1 có vùng CDS số lượng tỉ lệ Nucleotide giống hệt gen RSS1 công bố; có xuất băng kích thước khác 138bp nghĩa giống có vùng CDS giống hệt gen ứng viên RSS1 chịu mặn công bố có số lượng trình tự Nucleotit khác biệt với gen tham chiếu RSS1 4.2 ỨNG DỤNG CHỈ THỊ PHÂN TỬ TRONG XÁC ĐINH, CHỌN LỌC CÁ THỂ VÀ CON LAI MANG GEN ỨNG VIÊN CHỊU MẶN 4.2.1 Kết xác định cá thể mang gen ứng viên chịu mặn tập đoàn 36 giống lúa địa 4.2.1.1 Xác định cá thể mang gen ứng viên chịu mặn tập đoàn 36 giống lúa địa thị SRWD5del200 Sử dụng thị SRWD5del200 để kiểm tra đa hình locus gen chịu mặn với giống tập đoàn 36 giống lúa địa, kết điện di sản phẩm PCR Hình 4.3 Hình 4.3 Kết điện di sản phẩm PCR 36 giống lúa địa với thị SRWD5del200 (1-36: giống lúa địa Việt Nam theo danh sách bảng 3.1; 37-50: giống lúa ưu tú; 44: giống Bắc Thơm 7; M: Marker GeneRuler 100 bp DNA Ladder) Học viện Nông nghiệp Việt Nam – Luận văn Thạc sỹ Khoa học Nông nghiệp Page 46 Theo tính toán thiết kế so sánh với gen tham chiếu giới công bố, thị SRWD5del200 nhân lên băng kích thước 225bp 425bp giống mang gen ứng viên SRWD5 khác nhau) Khi tiến hành phản ứng PCR với cặp mồi SRWD5del200, kết điện di cho thấy có 13 giống lúa tập đoàn nghiên cứu mang alen kích thước 225bp (gen ứng viên chịu mặn) Trong đó, có 11 giống bao gồm: Tám xoan Bắc Ninh, Tám xoan Hải Hậu, Tám xoan Bac Ninh, Tám xoan Hải Hậu, Chấn thơm, Coi ba đất, Nếp bồ hóng Hải Dương, Tan ngần, Ba choK’te, Kháu điển lư Khau liến trạng thái đồng hợp tử giống Ble te lo nàng Quớt biển trạng thái dị hợp tử (mang hai alen kích thước 225bp 425bp) Các giống thương mại mang alen kích thước 425bp trạng thái đồng hợp Điều có nghĩa cặp mồi cho đa hình locus SRWD5 chịu mặn Cặp mồi sử dụng để xác định có mặt cac gen ứng viên SRWD5 hệ bố, mẹ lai phục vụ công tác nghiên cứu đánh giá khả chống chịu mặn gen ứng viên SRWD5 có giống lúa địa Việt Nam phục vụ cho công tác chọn tạo giống chống chịu mặn 4.2.1.2 Xác định cá thể mang gen ứng viên chịu mặn tập đoàn 36 giống lúa địa thị RSS1del15 Sử dụng thị RSS1del15 để kiểm tra đa hình locus gen chịu mặn với giống tập đoàn 36 giống lúa địa giống TSL1 (giống nhận gen), kết điện di sản phẩm PCR hình 3.5 Hình 4.4 Kết điện di sản phẩm PCR 36 giống lúa địa với cặp mồi RSS1del15 (1-36: giống lúa địa Việt Nam theo danh sách bảng 3.1; M7: giống lúa ưu tú TSL1; M: Marker GeneRuler 20bp DNA Ladder) Học viện Nông nghiệp Việt Nam – Luận văn Thạc sỹ Khoa học Nông nghiệp Page 47 Khi tiến hành phản ứng PCR với cặp mồi RSS1del15, kết điện di cho thấy có giống lúa tập đoàn nghiên cứu mang alen kích thước 138bp (gen ứng viên chịu mặn) Trong đó, có giống: Tám xoan Hải Hậu, OM6377, Xương gà Tốc lùn trạng thái đồng hợp tử; có giống Nếp ông táo OM3536 trạng thái dị hợp tử (mang hai alen kích thước 138bp 123bp) Giống lúa TSL1 (giống nhận gen) mang băng có kích thước 123bp Điều có nghĩa cặp mồi cho đa hình locus RSS1 chịu mặn Cặp mồi sử dụng để xác định có mặt cac gen ứng viên RSS1 hệ bố, mẹ lai phục vụ công tác nghiên cứu đánh giá khả chống chịu mặn gen ứng viên RSS1 có giống lúa địa Việt Nam phục vụ cho công tác chọn tạo giống chống chịu mặn 4.2.2 Kết lai tạo chọn lọc cá thể mang gen ứng viên chịu mặn hệ lai Nhằm mục đích quy tụ gen ứng viên chịu mặn vào giống lúa ưu tú, thiết kế tổ hợp lai Bắc thơm số x Coi ba đất TSL1 x OM6377 (2 giống lúa chịu mặn tốt Coi ba đất OM6377 làm giống cho gen hai giống nhận gen Bắc thơm số TSL1) Ở vụ Xuân 2014 tiến hành lại tạo F1 Các lai hệ F1 lai trở lại (backcross) với giống nhận gen để tạo lai hệ BC1F1 (Mùa 2014) Hạt lai BC1F1 cặp lai trồng vào vụ Xuân 2015 Sau cấy 20 ngày, non lai thu tách chiết ADN để xác định cá thể mang gen ứng viên chịu mặn cách sử dụng thị ADN thiết kế để tạo lai BC2F1 Hạt BC2F1 cặp lai tiếp tục trồng vào vụ Thu 2015 chọn lọc kiểu gen trước lai để tạo BC3F1 Kết lai tạo lai F1, BC1F1, BC2F1 bảng 4.7 Bảng 4.7 Kết lai tạo lai hệ F1, BC1F1 BC2F1 Chỉ thị ADN kiểm tra Giống nhận gen Giống địa cho gen Số hạt lai F1 Số hạt lai Số hạt lai BC1F1 BC2F1 (VX2014) (VM2014) (VX2015) SRWD5del200 Bắc thơm Coi ba đất Nhiều 30 RSS1del15 TSL1 OM6377 Nhiều 10 24 Học viện Nông nghiệp Việt Nam – Luận văn Thạc sỹ Khoa học Nông nghiệp Page 48 4.2.2.1 Kết lai tạo kiểm tra gen ứng viên chịu mặn SRWD5 hệ lai Sử dụng cặp mồi thiết kế SRWD5del200 để kiểm tra có mặt gen ứng viên chịu mặn SRWD5 cá thể lai hệ BC1F1 cặp lai Bắc thơm số x Coi ba đất, kết hình 4.5 Hình 4.5 Kết điện di sản phẩm PCR lai BC1F1 với cặp mồi SRWD5del200 (1524-1529: thứ tự lai; U19-đ/c dương-giống Coi ba đất; M16: giống lúa ưu tú Bắc thơm 7; M: Marker GeneRuler 100 bp DNA Ladder) hạt lai hệ BC1F1 cặp lai Bắc thơm x Coi ba đất trồng ruộng, đánh số đeo thẻ theo thứ tự Kết kiểm tra lai với cặp mồi SRWD5del200 cho thấy có lai trạng thái dị hợp tử có băng ADN kích thước tương đương với kích thước băng candidate gen chịu mặn SRWD5 bố (Coi ba đất) có số thứ tự là: 1525, 1527 1528 Chọn 1525 để tiếp tục tiến hành tạo lai hệ BC2F1 30 hạt lai hệ BC2F1 cặp lai Bắc thơm x Coi ba đất trồng ruộng, đánh số đeo thẻ theo thứ tự Kết kiểm tra 30 lai với cặp mồi SRWD5del200 cho thấy có 10 lai trạng thái dị hợp tử có băng ADN kích thước tương đương với kích thước băng candidate gen chịu mặn SRWD5 bố (Coi ba đất) có số thứ tự là: 448, 450,451, 454,457,461,465 ,468,471 474 Các tiếp tục tiến hành tạo lai hệ BC3F1 Học viện Nông nghiệp Việt Nam – Luận văn Thạc sỹ Khoa học Nông nghiệp Page 49 Hình 4.6 Kết điện di sản phẩm PCR lai BC2F1 với cặp mồi SRWD5del200 (445-474: thứ tự lai; U19-đ/c dương-giống Coi ba đất; M16: giống lúa ưu tú Bắc thơm 7; M: Marker GeneRuler 20 bp DNA Ladder) 4.2.2.2 Kết lai tạo kiểm tra gen ứng viên chịu mặn RSS1 hệ lai Sử dụng cặp mồi thiết kế RSS1del15 để kiểm tra có mặt gen ứng viên chịu mặn RSS1 cá thể lai hệ BC1F1 cặp lai TSL1 x OM6377, kết hình 4.7 Hình 4.7 Kết điện di sản phẩm PCR lai BC1F1 với cặp mồi RSS1del15 (2735-2744: thứ tự lai; U15-đ/c dương-OM6377; M7: giống lúa ưu tú TSL1 7; M: Marker GeneRuler 20bp DNA Ladder) 10 hạt lai hệ BC1F1 cặp lai TSL1 x OM6377 trồng ruộng, đánh số đeo thẻ theo thứ tự Kết kiểm tra lai với cặp mồi RSS1del15 cho thấy có lai trạng thái dị hợp tử có băng ADN kích thước tương đương với kích thước băng gen ứng viên chịu mặn RSS1 bố (OM6377) Học viện Nông nghiệp Việt Nam – Luận văn Thạc sỹ Khoa học Nông nghiệp Page 50 có số thứ tự là: 2735, 2736, 2738 2739 Chọn 2736 để tiếp tục tiến hành tạo lai hệ BC2F1 24 hạt lai hệ BC2F1 cặp lai TSL1 x OM6377 trồng ruộng, đánh số đeo thẻ theo thứ tự Kết kiểm tra 24 lai với cặp mồi RSS1del15 cho thấy có 14 lai trạng thái dị hợp tử có băng ADN kích thước tương đương với kích thước băng gen ứng viên chịu mặn RSS1 bố (OM6377) có số thứ tự là: 523, 524, 525, 527, 530, 531, 532, 533, 534, 537, 538, 539, 540, 544 Các tiếp tục tiến hành tạo lai hệ BC3F1 Hình 4.8 Kết điện di sản phẩm PCR lai BC2F1 với cặp mồi RSS1del15 (521-544: thứ tự lai; U15-đ/c dương-OM6377; M7: giống lúa ưu tú TSL1 7; M: Marker GeneRuler 20 bp DNA Ladder) Hình 4.8 Kết điện di sản phẩm PCR lai BC2F1 với cặp mồi RSS1del15 (521-544: thứ tự lai; U15-đ/c dương-OM6377; M7: giống lúa ưu tú TSL1 7; M: Marker GeneRuler 20bp DNA Ladder) Học viện Nông nghiệp Việt Nam – Luận văn Thạc sỹ Khoa học Nông nghiệp Page 51 Hình 4.9 Ruộng gieo mạ ruộng cấy nguồn vật liệu bố mẹ phục vụ lai tạo F1 (vụ xuân 2014 Thượng Cát, Nam từ Liêm, Hà Nội) Hình 4.10 Ghép cặp cho tổ hợp lai Hình 4.11 Bao cách ly sau khử nhị Học viện Nông nghiệp Việt Nam – Luận văn Thạc sỹ Khoa học Nông nghiệp Page 52 Hình 4.12 Hạt lai BC2F1 (Bắc thơm x Coi ba đất ) sau thu hoạch Học viện Nông nghiệp Việt Nam – Luận văn Thạc sỹ Khoa học Nông nghiệp Page 53 PHẦN KẾT LUẬN VÀ KIẾN NGHỊ 5.1 KẾT LUẬN Dựa vào kết phân tích thành phần nucleotide vùng CDS (Coding DNA Sequence) thành phần amino acid gen ứng viên, kết tầm soát trình tự tương đồng 36 giống lúa giải mã so sánh với locus gen chịu mặn thiết kế thị ADN (SSLP - Simple Sequence Length Polymorphism) cho đa hình locus SRWD5 RSS1 là: SRWD5del200F: TACGTCGGTGAGCCCTGACGG SRWD5del200R: TGCCACGCCGACGAGAACGA Và RSS1del15F: TATCATCATTATCCTCTTTGCA RSS1del15R: AGTGTGAATGATTATCACACCAA Đã thiết kế tổ hợp lai Bắc thơm số x Coi ba đất TSL1 x OM6377 Sau vụ lai tạo cá thể lai hệ F1, BC1F1 BC2F1 Sử dụng thị ADN thiết kế để sàng lọc cá thể từ hệ BC1F1 đến hệ BC2F1 xác định cá thể BC1F1 10 cá thể BC2F1 tổ hợp lai Bắc thơm số x Coi ba đất; cá thể BC1F1 14 cá thể BC2F1 tổ hợp lai TSL1 x OM6377 mang gen ứng viên chịu mặn Các lai sử dụng làm nguồn vật liệu để lai tạo BC3F1 phục vụ công tác nghiên cứu chọn tạo giống chịu mặn 5.2 KIẾN NGHỊ Các cá thể BC2F1 mang gen ứng viện chịu mặn tiếp tục trồng, lai tạo BC3F1 vụ Mùa 2015, kết hợp với chọn giống truyền thống để tạo dòng suất, chống chịu mặn tốt Tiếp tục nghiên cứu, xác định gen ứng viên chịu mặn khác để phục vụ nghiên cứu gen lúa chịu mặn mức phân tử lai tạo giống Học viện Nông nghiệp Việt Nam – Luận văn Thạc sỹ Khoa học Nông nghiệp Page 54 TÀI LIỆU THAM KHẢO Tiếng Việt: Cục Trồng trọt - In - Phát hành (2015) Báo cáo tổng kết tình hình xâm nhập mặn đồng sông Cửu Long tháng đầu năm 10 tháng năm 2015 Đỗ Hữu Ất (2004) Ứng dụng kỹ thuật hạt nhân để cải tạo giống lúa chịu mặn cho vùng đồng ven biển Bắc Thông tin Khoa học Công nghệ Hạt nhân, số tr 28-30 Ngô Đình Thức (2006) Nghiên cứu phát triển giống lúa chống chịu mặn cho vùng đồng sông Cửu Long Luận án tiến sĩ nông nghiệp Trường Đại học Nông lâm TP.HCM Nguyễn Thị Lan, Phạm Tiến Dũng (2005) Giáo trình phương pháp thí nghiệm, Nhà xuất Nông nghiệp Nguyễn Thị Lang (2002) Những phương pháp công nghệ sinh học, NXB Nông Nghiệp, TP Hồ Chí Minh Trần Long, Lưu Minh Cúc, Lưu Thị Ngọc Huyền, Lê Huy Hàm (2015) Ứng dụng thị phân tử lai hồi giao (MABC) chọn tạo giống chịu mặn Chuyên đề giống trồng vật nuôi Tập Tiếng Anh: Aslam M., Qureshi R.H., and Ahmad (1993) Mechanisms of salinity tolerance in rice (Oryza sativva L.) Department of soil science and physiology, University of Agriculture, Pakistan A.R.F Zahra1 , D.M De Costa1 and W.A.J.M De Costa (2013) Identification of differentially-expressed genes in response to salt stress in the salt-tolerant Sri Lankan rice variety At354 J.Natn.Sci.Foundation Sri Lanka 41(2):93-112 Bert Collard & David Mackill (2006) MARKER-ASSISTED BREEDING FOR RICE IMPROVEMENT, Plant Breeding, Genetics and Biotechnology (PBGB) Division, IRRI 10 Chang-Kug Kim , Hyeon-So Ji , Hak-Bum Kim , Doh-Won Yun , Gang-Seob Lee, Ung-Han Yoon , Tae-Ho Kim , Dong-Suk Park , Young-Joo Seol and Yong-Jae Won (2013) Identification of Salt-responsive Biosynthesis Genes in Rice via Microarray Analysis Rice Research: Open Access Học viện Nông nghiệp Việt Nam – Luận văn Thạc sỹ Khoa học Nông nghiệp Page 55 11 Dang Minh Tam and Nguyen Thi Lang (2003) In vitro selecsion for sail tolerance in rice Omorice: 68-75 12 E Francia, G Tacconi, C Crosatti, D Barabaschi, D Bulgarelli, E Dall’Aglio, G Valè (2005) Marker assisted selection in crop plants, Plant Cell, Tissue and Organ Culture, Volume 82 Issue pp 317-342 13 Els J.M Van Damme, Nausicaa Lannoo, Willy J Peumans (2008) Plant Lectins, Advances in Botanical Research, Vol 48 Pp 107–209 14 Gregorio G.B, (1997) Tagging salinity tolerance gene in rice (Oryza sativa) using amplified fragment length polymorphism (AFLP) PhD dissertation University of the Philippines Los Banos, Philippines 15 Gregorio G.B., Senadhira D., Mendoza R D., Manigbas N L., Rosxas J.P and Guerta C.Q (2002) Progress in breeding for salinity tolerance and associated abiotic stresses in rice, Field Crio Research, 76 pp 91-101 16 Greenway, and Munns (1980) Mechanisms of salt tolerance in nonhalophytes, Department of Agronomy, University of Western Australia 17 IRGSP (2005) The map-based sequence of the rice genome Nature Vol 436 pp 793-800 18 Islam M.M (2004) Mapping salinity tolerance gene in rice (Oryza sativa) at reproduction stage PhD dissertation University of the Philippines Los Banos, Philippines 19 Jang I.C., Oh S.J., Seo J.S., Choi W.B., Song S.I., Kim C.H., Kim Y.S., Seo H.S., Choi Y.D., Nahm B.H., Kim J.K (2003) Expression of a bifunctional fusion of the Escherichia coli genes for trehalose 6-phosphate synthase and trehalose 6phosphate phosphatase in transgenic rice plants increase trehalose accumulation and abiotic stress tolerance without stuning growth Plant Physiol Vol 131 pp 516-524 20 Juexin Wang, Fan Zhang, Yan Wang, Yuan Fu, Dong Xu, Yanchun Liang College of Computer Science and Technology, Jilin University, Changchun 130012, China Identification of salt tolerance genes in rice from microarray data using SVM-RFE 21 Ji Huang, Mei-Mei Wang, Yong-Mei Bao, Shu-Jin Sun, Li-Juan Pan, Hong-Sheng Học viện Nông nghiệp Việt Nam – Luận văn Thạc sỹ Khoa học Nông nghiệp Page 56 Zhang SRWD: A novel WD40 protein subfamily regulated by salt stress in rice(Oryza sativa L.) 22 Liu S.P., Li X., Wang C.Y., Li X.H and He Y.Q (2003) Improvement of resistance to rice blast in Zhenshan 97 by molecular marker-aided selection Acta Bot Sin 45, p.1346-1350 23 Letícia C Benitez, Luciano C da Maia, Márcia V Ribeiro, Camila Pegoraro, José A Peters, Antonio C de Oliveira, Ariano M de M J.& Eugenia J B Braga (2013) Salt Induced Change of Gene Expression in Salt Sensitive and Tolerant Rice Species Journal of Agricultural Science; Vol 5, No 10 pp 67-70 24 Miah G., Rafii M.Y., Ismail M R., Puteh A.B., Rahim H.A., Asfaliza R and Latif M.A (2013) Blast resistance in rice: a review of conventional breeding to molecular approaches Mol Biol Rep (2013) 40, pp 2369-2388 25 Mueen A.K (2015) Molecular breeding of rice for improved disease, resistance a review DOI 10.1007/s13313-015-0354-7 26 Mishra B., Akbar M., Seshu D.V (1990), Genetic studies on sanility tolerance in rice towards better productivity in salt affected soils, IRRI, Philippine 27 Matthias Frisch, Martin Bohn and Albrecht E Melchinger (2003) Comparison of Selection Strategies for Marker-Assisted Backcrossing of a Gene Acsess DL 28 Mohammadi N.G., Arzani1 A., Rezai1 A.M., Singh R.K., and Gregorio G.B (2008) Assessment of rice genotypes for salt tolerance using microsatellite markers associated with the saltol QTL, African Journal of Biotechnology Vol pp 730-736 29 Obara-Okeyo P and Kako S (1998), “Genetic diversity and identifi cation of Cymbidium cultivars as measured by random amplifi ed polymorphic DNA (RAPD) markers” Euphytica, (99), pp 95-101 30 Pei Q.L., Wang C.L., Liu P.Q., Wang J and Zhao K.J (2011) Marker-assisted selection for pyramiding disease and insect resistance genes in rice, Zhongguo Shuidao Kexue (Chinese Journal of Rice Science) 25( 2) pp 119-129 31 Robert Koebner (2003) Mas in cereals: Green for maize, amber for rice, still red for wheat and barly 32 Stéphanie Pflieger, Véronique Lefebvre, Mathilde Causse The candidate gene Học viện Nông nghiệp Việt Nam – Luận văn Thạc sỹ Khoa học Nông nghiệp Page 57 approach in plant genetics: a review (2001) pp 275-291 33 Shinji Kawasakia, Chris Borcherta, Michael Deyholosb, Hong Wangb, Susan Brazillea,Kiyoshi Kawaia, David Galbraitha and Hans J Bohnerta Gene Expression Profiles during the Initial Phase of Salt Stress in Rice The Plant Cell April 2001 vol 13 no pp 889-905 34 Thompson S.M (2007) Multiple Sequence Alignment & Analysis Florida State University Schoolof Computational Science and Information Technology (CSIT) 35 Teng S (1994) Gene tagging for salt tolerance in rice (Oryza sativa L.) The University of the Philippine, Los Banos, Laguna, Philippine 36 Vu Thi Thu Hien (2012) (Marker-assisted backcrossing (MABC) for improved salinity tolerance in rice (Oryza sativa L.) to cope with climate change in Vietnam- AJCS 6(12) pp 1649-1654 37 Vu Thi Thu Hien and Le Huy Ham (2012) Marker-assisted backcrossing (MABC) for improved salinity tolerance in rice (Oryza sativa L.) to cope with climate change in Vietnam- AJCS6(12) pp 1649-1654 38 Xu D., Duan X., Wang B., Hong B., Ho T.H.D., and Wu R (1996) Expression of a late embryogenesis abundant (LEA) protein gene, HavI, from barley confers tolerance to drought and sanility in transgenic rice, Plant Physiol.Vol 110 pp 249-247 Học viện Nông nghiệp Việt Nam – Luận văn Thạc sỹ Khoa học Nông nghiệp Page 58 [...]... gồm: - Xác định được các gen ứng viên liên quan đến tính chịu mặn ở một số giống lúa bản địa của Việt Nam đã giải mã; - Thiết kế được các chỉ thị ADN đặc trưng cho từng gen ứng viên chịu mặn phục vụ công tác nghiên cứu, chọn tạo giống lúa chịu mặn - Tạo được quần thể F1, BC1F1, BC2F1 của các tổ hợp lai và xác định được cá thể trong quần thể F1, BC1F1, BC2F1 mang gen ứng viên chịu mặn 1.3 YÊU CẦU CỦA ĐỀ... canh tác lúa vùng nhiễm mặn và cơ cấu sản xuất lúa vùng nhiễm mặn ở Việt Nam, giúp người nông dân trồng lúa vùng nhiễm mặn tăng thêm thu nhập, giảm đói nghèo 1.2 MỤC TIÊU NGHIÊN CỨU - Mục tiêu tổng quát là xác định các gen ứng viên liên quan đến tính chịu mặn ở một số giống lúa bản địa của Việt Nam đã giải mã, thiết kế các chỉ thị ADN chức năng để ứng dụng trong chọn tạo giống lúa chịu mặn Các mục tiêu... Xác định được các gen ứng viên liên quan đến tính chịu mặn ở một số giống lúa bản địa của Việt Nam đã giải mã; - Thiết kế được các chỉ thi ADN đặc trưng cho từng gen ứng viên chịu mặn phục vụ công tác nghiên cứu, chọn tạo giống lúa chịu mặn Học viện Nông nghiệp Việt Nam – Luận văn Thạc sỹ Khoa học Nông nghiệp Page 2 1.4 PHẠM VI NGHIÊN CỨU Vì thời gian hạn chế nên đề tài chỉ tập trung các nội dung thiết. .. tháng 6 năm 2014 đến tháng 12 năm 2015 3.3 VẬT LIỆU NGHIÊN CỨU 3.3.1 Nguồn vật liệu - Cơ sở dữ liệu trình tự genome của các giống lúa chịu mặn trong tập đoàn 36 giống lúa bản địa của Việt Nam đã được giải mã thuộc đề tài “Nghiên cứu giải mã genome một số giống lúa địa phương của Việt Nam - Các giống lúa nền ưu tú (Bắc thơm số 7, TSL1) Bảng 3.1 Danh sách 36 giống lúa bản địa đã giải mã 1 2 3 4 5 6 7... Fermentas, Invitrogen c Hoá chất chạy điện di: Điện di gel polyacrylamide gồm các hóa chất: acrylamide, APS, Temed, chất nhuộm Bromophenol blue, Ethidium bromide 3.4 NỘI DUNG NGHIÊN CỨU - Nghiên cứu xác định các gen ứng viên liên quan đến tính chịu mặn có trong các giống lúa đã giải mã; - Nghiên cứu thiết kế các chỉ thị ADN nhận dạng chính xác các gen ứng viên chịu mặn; - Ứng dụng chỉ thị ADN đã thiết kể để... 2.3.1 Các bước xác định gen ứng viên Học viện Nông nghiệp Việt Nam – Luận văn Thạc sỹ Khoa học Nông nghiệp Page 6 Gen ứng viên có thể được xác định bởi một số phương pháp, bao gồm kiến thức đã biết về con đường sinh học, các nghiên cứu liên kết gen, nghiên cứu biểu hiện gen, và nghiên cứu liên kết trên toàn bộ hệ gen Các bước xác định gen ứng viên bao gồm: Chọn, sàng lọc và xác nhận gen ứng viên Hình... lá ở các giai đoạn xử lý muối khác nhau Kết quả, quan sát được 8.275 gen ứng viên liên quan đến chịu mặn Trong đó, quan sát được 342 ortholog gen và 74 pathway gen gắn với sinh tổng hợp phản ứng với muối Cuối cùng, xác định được 6 gen biểu hiện một cách khác biệt giữa các giống chịu mặn tốt và chịu mặn kém bằng cách so sánh gen pathway và gen ortholog Trong số 6 gen, 3 gen là up-regulated và 3 gen. .. CHỈ THỊ ADN TRONG XÁC ĐỊNH GEN ỨNG VIÊN LIÊN QUAN ĐẾN TÍNH CHỊU MẶN 2.4.1 Chỉ thị ADN Chỉ thị phân tử (chỉ thị ADN) là các chỉ thị chọn lọc trực tiếp dựa trên cấu trúc phân tử ADN Số lượng các chỉ thị ADN là rất lớn, cây trồng có khoảng 108 - 1010 nucleotide trong ADN tổng số và vì thế, nếu giữa 2 cá thể chỉ cần có sự sai khác nhỏ thì giữa chúng sẽ có một số lượng khổng lồ các chỉ thị ADN để phân biệt... viên liên quan đến tính chịu mặn ở một số giống lúa bản địa của Việt Nam đã giải mã hệ gen là rất cần thiết, nhằm đưa ra nguồn thông tin hữu ích để phục vụ cho việc chọn ra các giống lúa có khả năng chịu mặn Kết quả nghiên cứu sẽ cung cấp cơ sở dữ liệu và vật liệu cho các nghiên cứu khoa học tiếp theo về cây trồng chống chịu mặn, đồng thời góp phần vào công tác chọn tạo giống lúa có khả năng chịu mặn, ... khoa học về tính chịu mặn, đồng thời góp phần vào công tác nghiên cứu chọn tạo giống lúa có khả năng chịu mặn phù hợp với điều kiện canh tác lúa vùng nhiễm mặn ở Việt Nam - Những thành công bước đầu trong thiết kế các chỉ thị ADN xác định các gen ứng viên liên quan đến tính chịu mặn sẽ mở ra khả năng ứng dụng rộng rãi trong công tác chọn tạo giống nói chung, không chỉ đối với khả năng chịu mặn mà còn
- Xem thêm -

Xem thêm: thiết kế và ứng dụng các chỉ thị adn xác định các gen ứng viên liên quan đến tính chịu mặn ở một số giống lúa bản địa của việt nam đã giải mã hệ gen , thiết kế và ứng dụng các chỉ thị adn xác định các gen ứng viên liên quan đến tính chịu mặn ở một số giống lúa bản địa của việt nam đã giải mã hệ gen , thiết kế và ứng dụng các chỉ thị adn xác định các gen ứng viên liên quan đến tính chịu mặn ở một số giống lúa bản địa của việt nam đã giải mã hệ gen , Phần 1. Mở đầu, Phần 2.Tổng quan tài liệu, 2 Nghiên cứu di truyền về giống lúa chống chịu mặn, 5 Ứng dụng chỉ thị phân tử trong chọn tạo giống lúa chịu mặn, Phần 3. Vật liệu, nội dung và phương pháp nghiên cứu, 5 Phương pháp nghiên cứu, Phần 4. Kết quả và thảo luận, 1 Kết quả xác định gen ứng viên chịu mặn, 2 Ứng dụng chỉ thị phân tử trong xác định, chọn lọc cá thể và con lai mang gen ứng viên chịu mặn, Tài liệu tham khảo

Từ khóa liên quan

Gợi ý tài liệu liên quan cho bạn