OCT-3/4 AND SOX-2 ARE KEY FACTORS FOR SDIA NEUROGENESIS OF MOUSE EMBRYONIC STEM CELLS STEPHEN WEIHUNG CHEN (BSc.), Brown University A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE DEPARTMENT OF BIOCHEMISTRY NATIONAL UNIVERSITY OF SINGAPORE Acknowledgements This work is supported by funding provided by The Bioprocessing Technology Institute (BTI) and the Agency for Science Technology and Research (A*STAR) Thanks to Prof Wang Nai-Dy, Prof Miranda Yap, Prof Tan Bor Leung, Prof James Chen, and Dr Paul Robson for their guidance, in addition to Peng Zhong Ni, Yoong Lifoong, John Gan Wuoqiang, Theodosia Tan, and Tan Yew Chung for their technical and personal support The author would also like to express gratitude for the wonderful discussions and advice from Dr Valerie Ng and Dr Jason Kreisberg, the latter providing invaluable feedback on submitted manuscripts and thesis revisions Thanks to MSc supervisor, Dr Andre Choo, for his suggestions and insight as well as Dr Steve Oh for his patience and providing motivation to persevere and succeed In particular, thank you to Prof Too Heng-Phon for providing countless days of humor and inspiration, and providing invaluable thoughts on science and life, and all things in between Table of Contents Abstract Introduction Results Culturing of Mouse Embryonic Stem Cells (mESC) a Culturing Conditions b Expression of Oct-3/4, Alkaline Phosphatase and SSEA-1 Neurogenesis Using PA6 Stromal-Derived Inducing Activity (SDIA) a PA6 Co-Culture Method b Heparin Neural-Inducing Factor (Hep-NIF) SDIA Feeder-Free Method Knockdown of Oct-3/4 and Sox-2 Transcription Factors in Mouse Embryonic Stem Cells a Establishment of Efficient Transfection Method b Oct-3/4, Sox-2 Knockdown and Differentiation Into Trophectoderm Generation of Inducible Tet-Repressor (Tet-R) Short Hairpin RNA (shRNA) mESC a Stable Transfection of Tet-R Protein into mESC i pLenti6/TR Lentiviral Propagation and Packaging ii pcDNA6/TR Plasmid b Generation of Tetracycline Inducible Short, Hairpin RNA (shRNA) mESC Lines i Construction and Design of shRNA Vectors ii Stable Transfection and Selection into mESC Differentiation of mESC Following Oct-3/4 and Sox-2 Knockdown a SDIA Differentiation Following Oct-3/4 and Sox-2 Knockdown i Establishment of Precise Transcript Quantification Using Cloned Standards ii Quantification of Oct-3/4, Sox-2, Canonical Transactivation Targets Following Knockdown b Screening for Alternative Cellular Fates i Transcript Quantification of Lineage-Specific Differentiation Markers ii Appearance of Glial-Like Cells during SDIA Differentiation Discussion and Future Work Materials and Methods References Appendix Media Formulations Appendix Related Articles by Author Abstract Utilizing a stromal-derived inducing activity (SDIA) model of neurogenesis, we investigated the effects of the targeted knockdown of Oct-3/4 and Sox-2 by short interfering RNAs (siRNAs) in mouse embryonic stem cells (mESC) Quantitative real-time PCR showed a 40-90% knockdown of specific transcripts with cognate Oct3/4 or Sox-2 siRNA transfection compared to FAM-labelled negative control (FAM) siRNAs or mock transfection, and was confirmed at the protein level by Western blot analysis Using PA6 SDIA co-cultures, neurogenesis was significantly diminished in Oct-3/4 or Sox-2 targeted mESC upon differentiation We observed that 45±12%, 65±13% and 90±8% (Mean +/- SD) of the colonies were stained with neuron-specific β-tubulin III in Oct-3/4, Sox-2, and FAM siRNA transfected mESC respectively Similar results were observed when differentiating mESC with neural-inducing factors (Hep-NIF) collected from the surface of PA6 cells using heparin In addition, differentiation of mESC using Hep-NIF but not Oct-3/4 and Sox-2 knockdown led to the pronounced appearance of discrete, dark granular glial acidic fibrilary protein (GFAP)-positive cells which also expressed the glial cell marker Vimentin Taken together, these results extend the role of Oct-3/4 in SDIA, implicate a similar role for Sox-2, and support emerging observations for the role of these factors and SDIA in gliogenesis List of Tables Table Selection of Real-Time PCR primer sets Table siRNA designs Table Primers sequences used for Real-Time PCR detection Table shRNA cassette designs List of Figures Figure Culturing conditions of mESC cells (AB2.2) Figure Pluripotent mESC markers, Oct-3/4, Alkaline Phosphatase (AP), and StageSpecific Embryonic Antigen-1 (SSEA-1) are readily detectable in E14 cells Figure LIF withdrawal caused mESC (E14) differentiation Figure PA6 Stromal-Derived Inducing Activity (SDIA) co-culture Figure Heparin Neural-Inducing Factor (Hep-NIF) feeder-free SDIA Figure Western blot detection of TuJ1 in Hep-NIF differentiated mESC Figure Detection of FAM oligodT after two hours Figure Detection of FAM oligodT after twelve hours Figure Establishment of efficient mESC transfection method Figure 10 Transient siRNA knockdown of Oct-3/4 Figure 11 Knockdown of Oct-3/4 and Sox-2 using siRNA Figure 12 Trophectodermal differentiation following Oct-3/4 or Sox-2 knockdown Figure 13 Tetracycline repressor (Tet-R) Lentiviral plasmid propagation Figure 14 Tetracycline repressor (Tet-R) Lentiviral packaging and selection in ECOPak cells Figure 15 Antibiotic selection of mESC – kill curve analysis Figure 16 Generation of Tet-R mESC lines, establishment of transient shRNA vector knockdown Figure 17 Morphology of stably transfected mESC Figure 18 Characterization of pluripotent markers (Oct-3/4, Sox-2, Nanog, SSEA-1) in stably transfected mESC Figure 19 Inducible shRNA knockdown of Oct-3/4 Figure 20 Cloning of Oct-Sox transactivation targets and lineage-specific markers Figure 21 Specific and efficient qRT-PCR detection of Oct-Sox transactivation targets, lineage-specific markers Figure 22 Characterization of canonical transactivation targets following Oct-3/4 knockdown Figure 23 Characterization of canonical transactivation targets following Sox-2 knockdown Figure 24 Attenuation of neurogenesis following Oct-3/4, Sox-2 siRNA knockdown in PA6 SDIA co-cultures Figure 25 Colony counts of PA6 SDIA co-cultures following Oct-3/4, Sox-2 siRNA knockdown Figure 26 Attenuation of neurogenesis following Oct-3/4, Sox-2 siRNA knockdown in PA6 SDIA co-cultures and Heparin feeder-free SDIA Figure 27 Detection of lineage-specific markers Figure 28 GFAP and TuJ1 expressions in SDIA cultures Figure 29 GFAP and Vimentin expressions in SDIA cultures List of Illustrations Illustration – Invitrogen BlockIT tetracycline inducible short, hairpin RNA system Introduction Mouse embryonic stem cells (mESC) are uniquely capable of differentiating into all somatic cell types in the body, a property known as pluripotency In addition, mESC are known to grow indefinitely in culture without reaching senescence The pluripotent capability of mESC has been particularly useful in the generation of transgenic or knockout mice, and have allowed the establishment of in vitro developmental and cellular differentiation models such as those for neurogenesis The propensity of mESC to preferentially differentiate into neurons provides evidence for a “default model” of neurogenesis (Munoz-Sanjuan and Brivanlou, 2002) This model proposes that embryonic stem (ES) cells for various species not require external factors such as fibroblast growth factors (FGFs) or wingless homologues (WNTs) to instruct ES cells to become neuronal subtypes, but rather that ES cells preferentially differentiate into neuronal subtypes by default, and are prevented from doing so by the presence of neurogenesis-inhibiting bone morphogenic proteins (BMPs) In Xenopus explant experiments, an autologously transplanted Spemann Organizer (a potent source of various BMP inhibitors) has been shown to be able to elicit neurogenesis in the recipient region The default model further proposes that the apparent capability of FGFs and WNTs to differentiate ES cells into neuronal subtypes is largely attributable to BMP inhibition, thereby releasing ES cells to differentiate into their preferential neuronal subtypes and not due to any direct cellular fate specification (Tropepe et al., 2001) The latter function has been described as an “instructive model” and is largely supported by chicken models in which explants similar to Xenopus are incapable of eliciting a similar “default” response A combination of FGFs and WNTs are requisite for neurogenesis, suggesting therefore that these factors to have a deterministic rather than an accessory role in neuronal subtype differentiation While exogenous factors clearly have a role in ES cellular fate specification, our understanding of a default or instructive model would be greatly aided by a better understanding of the transcription factors regulating ES cell pluripotency, immortality, and neuronal differentiation Of great interest are pluripotent transcription factors such as Oct-3/4 and Sox-2 and their possible roles in transiting the boundary from an ES cell to a neuronal, or other, cellular derivatives The PitOct-Unc (POU) transcription factor Oct-3/4, and Sox-2, a high mobility group (HMG) protein, are thought to be important factors in maintaining ES cell identity This hypothesis is however controversial as some contradictory reports suggest the necessity of a sustained expression of Oct-3/4 (also known as Pou5F1) for neurogenesis (Shimozaki et al., 2003) and that constitutive Sox-2 expression enhances neuronal differentiation (Sasai, 2001; Zhao et al., 2004) The apparent pleiotropy of these transcription factors in maintaining a pluripotent mESC identity may result from a diversity of binding to multiple transactivation targets While various mESC transcription factors, including Stat-3, FoxD3, Oct-3/4, Sox-2 and Nanog have all been demonstrated to be involved in maintaining a pluripotent phenotype (Cavaleri and Scholer, 2003), the apparent inability of any single given factor to maintain mESC pluripotency suggests the possibility of shared transactivation targets 10 (Invitrogen) 0.25 – µl, Lipofectamine 2000 (Invitrogen) 0.1 - 0.4 µl, Transfectin (Bio-Rad) 0.1 - 0.6 µl , Fugene (Roche) 0.15 - 0.3, Transpass (New England Biolabs) 0.5 - µl Exgen (Fermentas) was complexed in 150 mM NaCl solution with a reagent volume of 0.8 - 1.15 µl as specified by manufacturer Oct-3/4 or Sox-2 Knockdown Using Small Interfering RNAs For Oct-3/4 or Sox-2 knockdown, 2.5x105 E14 or AB2.2 cells were seeded per well in 12-well plates previously coated overnight with 0.1% gelatin (in water) in mL mESC media containing LIF-ESGRO Four to eight hours after seeding, cells were transfected with µl Transfectin (Bio-Rad) and either 30 pmoles Stealth RNAi (Invitrogen), FAM labelled negative control siRNA (Ambion), or mock transfection without nucleotide diluted in Opti-Mem I (Gibco) Sequences for siRNA designs are listed in Table Negative control cells seeded identically, but untransfected, served to establish basal transcript expression levels Cells were collected at both 12 and 24 hours post-transfection, with ES cell media change at 12 hours For RNA isolation, cells were harvested following 1x PBS wash and lysed with 500 µl Trizol (Invitrogen) and RNA was extracted using phenol choloroform phase separation For Western blotting, 2% SDS was added and cell lysate was homogenized using high speed vortexing following addition of glass beads For trophectoderm differentiation, mESC were trypsinized days post transfection and seeded in mL mESC cell culture media onto 0.1% gelatinized coated 6-well plates to avoid overgrowth with daily mESC media replacement 74 Table siRNA designs siRNA Design Gene Target / 5’ Start Position siOct-A Oct-3/4 / 712 CCCGGAAGAGAAAGCGAACUAGCAU siOct-B Oct-3/4 / 1151 GGUAGACAAGAGAACCUGGAGCUUU siSox-A Sox-2 / 667 GCACAUGAAGGAGCACCCGGAUUAU siSox-B Sox-2 / 669 ACAUGAAGGAGCACCCGGAUUAUAA siSox-C Sox-2 / 1173 ACCUCCGGGACAUGAUCAGCAUGUA Real-Time PCR Transcript Detection of Oct-3/4, Sox-2 and Canonical Targets of Cooperative Activity Four µg total RNA was reversed transcribed using MMLV-RT (Promega) in 54 µl reaction, µl of which were used in a single qRT-PCR reaction Measurement of initial knockdown of Oct-3/4 was performed using Taqman using Oct-3/4 specific probe (ABI cat no 4331182) and ABI Gapdh VIC endogenous control kit according to manufacturer protocol Reported values are calculated using ∆∆Ct method, normalized against endogenous Gapdh and calibrated against FAM negative control (Livak and Schmittgen, 2001) For precise quantification two to three primer pairs were designed for each target, amplified using PCR from a mixed pool of cDNAs from undifferentiated mESC, 12 and 24 hour post-transfection with either siOct or siSox mESC cDNAs Fragments were inspect for proper size and subsequently cloned into Promega pGEM-T EZ (Promega), linearized vector using TA cloning, quantitated using UV spectrometry, and digested using XmnI restriction enzyme (except for Fgf-4 which was linearized 75 using SacII as its amplicon contains an internal XmnI restriction site) Digested vector was further run on gel electrophoresis to ensure identical concentrations and serial dilutions ranging from 108 – 104 molecules per microliter were prepared as standards Primers were then tested for efficiency and sensitivity with 3.34 being an ideal slope for optimally efficient primers and sensitivity as determined by primerdimer formation in non-template controls Primers selected for real-time PCR are listed in Table Samples were amplified in duplicate with a standard curve prepared as described above to mitigate any systematic variations in instrument readings or sample preparation For differentiation markers, reported values are calculated using ∆∆Ct method (Livak and Schmittgen, 2001) Immunoblotting of primary antibodies were diluted as follows: Oct-3/4 (Santa Cruz, SC-5279) 1:1000, Sox-2 (Chemicon, AB5770) 1:1000, Vimentin (Boehringer, V9) 1:1000 and β-Actin (Chemicon, MAB1501) 1:2000 76 Table Primer sequences used for Real-Time PCR detection Gene Amplification Region Forward Primer / Reverse Primer Oct-3/4 1056 - 1153 Sox-2 71 - 230 Utf-1 865 - 1063 Opn 600 - 682 Fgf-4 552 - 673 Fbx-15 214 - 305 Nestin 1162 - 1305 Ptx-3 135-226 Brachyury 1637 - 1832 Gata-4 399 - 592 Gapdh 465 - 599 CCCTCTGTTCCCGTCACTG / ACCTCCCTTGCCTTGGCT GAAAGAAAGGAGAGAAGTTTGGAG / ATCTGGCGGAGAATAGTTGGG CACTTGGGCGACATCTCAAC / GGAGAAGAGGACTGATAACAAAGC ACAAGCAGACACTTTCACTCCA / ACCTCAGTCCATAAGCCAAGC GCCTTTCTTTACCGACGAGTGTA / TCTTGGTCCGCCCGTTCTTA CTATGATTGGCTGCGACAGAC / TAGTCCACCATTCTCCTGCC TCCTCAGCCCAACATCCTT / AGGGAGCCTCAGACATAGGT TGGAGTTTGGGCTGCTTGGT / ATGTTCTGGAAGCGGAGGGT TGAAGCCAAGGACAGAGAGAC / GGCAACAAGGGAGGACATTAG AGAGGTTTCTGCTTTGATGCTG / GCACGAGGCAGACAAGAACT GATGGGTGTGAACCACGAGAA / GATGGCATGGACTGTGGTCA 77 Kill-Curve Analysis and Stable Transfection of Tet-R using Lentiviral and Plasmid Delivery Kill curve analysis performed for ECO-PAK, E14 and AB2.2 mESC cells was done according to manufacturer instruction Briefly, for Blasticidin and Zeocin, cells were seeded at 30% confluency, left overnight with selection applied in separate experiments for Blasticidin concentrations ranging from 1-5 µg/mL (0, 1, 2.5, µg/mL) and Zeocin concentrations ranging from 50-1000 µg/mL (0, 50, 250, 500, 1000 µg/mL) Cells were observed continuously for one week with daily media change to determine lowest concentration necessary to completely eliminate viable cells and the next highest concentration was selected for further usage Vector pLenti6/TR encoding Tet-R protein was propagated using Invitrogen OneShot competent cells and digested with Hind III and Bgl II to insure proper restriction mapping Packaging was done in ECO-PAK cells, previously seeded at 50% confluency, transfected with µg GFP-C2 or pLenti6/TR plasmid and 15 µl Transfectin (Bio-Rad) per well Selection was applied 48 hours post-transfection with daily media change until stable colonies were observed Stable colonies were expanded for an additional week Following storage as frozen stocks, cells (ECOPAK/TR) were expanded with viral supernatant collected for transduction of mESC Transduction was done according to manufacturer protocol Eukaryotic expression vector encoding Tetracyline Repressor (TetR), pcDNA6/TR (Invitrogen), was propagated using OneShot competent cells (Invitrogen) and transfected using µg plasmid and 15µl Transfectin (Bio-Rad) into 5x105 ES cells 78 seeded onto 6-well gelatin coated plates as described above Embryonic stem cell media was changed and µg/mL Blasticidin S (Invitrogen) selection was applied 24 and 48 hours post-transfection, respectively Cells were left for five days with daily ES cell media (including Blasticidin selection, ES-Blast) replacement before being trypsinized with 100 µl Typsin, quenching with 900 µl ES-Blast media and seeding onto gelatin coated T75 flasks in a total volume of mL ES-Blast media Independent well transfection were designated as either “A” or “B” as carried forward as clonal lines Generation of Inducible, Stable Short Hairpin TetR ES Cell Lines Inducible, stable short hairpin TetR ES cell lines specifically targeting Oct-3/4 or Sox-2 were generated using pEntr H1/TO vector (Invitrogen) containing a 59-bp annealed duplex oligo previously ligated, cloned and screened using sequence verification Embryonic stem cells were seeded, transfected and selected in an identical manner as TetR ES host lines with 500 ug/mL Zeocin selection applied (ESBlast-Zeo) Cassette design was based on siRNA sequences described above with “shOct1” cassette containing same 21-bp sense sequence as “siOct-A” (shOct2 corresponds to siOct-B) for all constructs reported (Table 4), followed by originating clone designation (ie, “O1-4” designates clone 4) and “x” and “y” designations for independent well transfections carried forward as clonal lines Two cassette designs for Oct-3/4 were separately engineered into E14 and AB2.2 cell lines to minimize non-specific effects potentially originating from either design 79 Induction of stable knockdown was observed by addition of µg/mL tetracycline (Tc) to ES-Blast-Zeo media and detection using Western blot after three days RNAi mediated SDIA using heparin-NIF was performed as described above with Tc added either during seeding (day 0) or excluded from control cells as indicated Table shRNA cassette designs shRNA Design Cassette Sequence shOct1 shOct2 CACCGCCCGGAAGAGAAAGCGAACTAGCAT CGAA ATGCTAGTTCGCTTTCTCTTCCGGG CACCGGTAGACAAGAGAACCTGGAGCTTT CGAA AAAGCTCCAGGTTCTCTTGTCTACC Purple denotes ligation adapter Black denotes hairpin Green denotes sense sequence Red denotes inverted repeat sequence 80 References Ambrosetti DC, Basilico C, Dailey L 1997 Synergistic activation of the fibroblast growth factor enhancer by Sox2 and Oct-3 depends on protein-protein interactions facilitated by a specific spatial arrangement of factor binding sites Mol Cell Biol 17:6321-6329 Bjorklund A, Dunnett SB, Brundin P, Stoessl AJ, Freed CR, Breeze RE, Levivier M, Peschanski M, Studer L, Barker R 2003 Neural transplantation for the treatment of Parkinson's disease Lancet Neurol 2:437-445 Boiani M, Scholer HR 2005 Regulatory networks in embryo-derived pluripotent stem cells Nat Rev Mol Cell Biol 6:872-884 Botquin V, Hess H, Fuhrmann G, Anastassiadis C, Gross MK, Vriend G, Scholer HR 1998 New POU dimer configuration mediates antagonistic control of an osteopontin preimplantation enhancer by Oct-4 and Sox-2 Genes Dev 12:2073-2090 Boyer LA, Lee TI, Cole MF, Johnstone SE, Levine SS, Zucker JP, Guenther MG, Kumar RM, Murray HL, Jenner RG, Gifford DK, Melton DA, Jaenisch R, Young RA 2005 Core transcriptional regulatory circuitry in human embryonic stem cells Cell 122:947-956 Brustle O, Jones KN, Learish RD, Karram K, Choudhary K, Wiestler OD, Duncan ID, McKay RD 1999 Embryonic stem cell-derived glial precursors: a source of myelinating transplants Science 285:754-756 Carpenter L, Zernicka-Goetz M 2004 Directing pluripotent cell differentiation using "diced RNA" in transient transfection Genesis 40:157-163 81 Cavaleri F, Scholer HR 2003 Nanog: a new recruit to the embryonic stem cell orchestra Cell 113:551-552 Chambers I 2004 The molecular basis of pluripotency in mouse embryonic stem cells Cloning Stem Cells 6:386-391 Elbashir SM, Harborth J, Weber K, Tuschl T 2002 Analysis of gene function in somatic mammalian cells using small interfering RNAs Methods 26:199-213 Hammond SM 2005 Dicing and slicing: the core machinery of the RNA interference pathway FEBS Lett 579:5822-5829 Hay DC, Sutherland L, Clark J, Burdon T 2004 Oct-4 knockdown induces similar patterns of endoderm and trophoblast differentiation markers in human and mouse embryonic stem cells Stem Cells 22:225-235 Kania G, Corbeil D, Fuchs J, Tarasov KV, Blyszczuk P, Huttner WB, Boheler KR, Wobus AM 2005 Somatic stem cell marker prominin-1/CD133 is expressed in embryonic stem cell-derived progenitors Stem Cells 23:791-804 Kawasaki H, Mizuseki K, Nishikawa S, Kaneko S, Kuwana Y, Nakanishi S, Nishikawa SI, Sasai Y 2000 Induction of midbrain dopaminergic neurons from ES cells by stromal cell-derived inducing activity Neuron 28:31-40 Kitajima H, Yoshimura S, Kokuzawa J, Kato M, Iwama T, Motohashi T, Kunisada T, Sakai N 2005 Culture method for the induction of neurospheres from mouse embryonic stem cells by coculture with PA6 stromal cells J Neurosci Res 80:467-474 Liour SS, Yu RK 2003 Differentiation of radial glia-like cells from embryonic stem cells Glia 42:109-117 82 Liu Y, Wu Y, Lee JC, Xue H, Pevny LH, Kaprielian Z, Rao MS 2002 Oligodendrocyte and astrocyte development in rodents: an in situ and immunohistological analysis during embryonic development Glia 40:25-43 Livak KJ, Schmittgen TD 2001 Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method Methods 25:402408 Loh YH, Wu Q, Chew JL, Vega VB, Zhang W, Chen X, Bourque G, George J, Leong B, Liu J, Wong KY, Sung KW, Lee CW, Zhao XD, Chiu KP, Lipovich L, Kuznetsov VA, Robson P, Stanton LW, Wei CL, Ruan Y, Lim B, Ng HH 2006 The Oct4 and Nanog transcription network regulates pluripotency in mouse embryonic stem cells Nat Genet Mitsui K, Tokuzawa Y, Itoh H, Segawa K, Murakami M, Takahashi K, Maruyama M, Maeda M, Yamanaka S 2003 The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells Cell 113:631642 Mizuseki K, Sakamoto T, Watanabe K, Muguruma K, Ikeya M, Nishiyama A, Arakawa A, Suemori H, Nakatsuji N, Kawasaki H, Murakami F, Sasai Y 2003 Generation of neural crest-derived peripheral neurons and floor plate cells from mouse and primate embryonic stem cells Proc Natl Acad Sci U S A 100:5828-5833 Munoz-Sanjuan I, Brivanlou AH 2002 Neural induction, the default model and embryonic stem cells Nat Rev Neurosci 3:271-280 Nichols J, Zevnik B, Anastassiadis K, Niwa H, Klewe-Nebenius D, Chambers I, Scholer H, Smith A 1998 Formation of pluripotent stem cells in the 83 mammalian embryo depends on the POU transcription factor Oct4 Cell 95:379-391 Nishimoto M, Fukushima A, Okuda A, Muramatsu M 1999 The gene for the embryonic stem cell coactivator UTF1 carries a regulatory element which selectively interacts with a complex composed of Oct-3/4 and Sox-2 Mol Cell Biol 19:5453-5465 Niwa H, Masui S, Chambers I, Smith AG, Miyazaki J 2002 Phenotypic complementation establishes requirements for specific POU domain and generic transactivation function of Oct-3/4 in embryonic stem cells Mol Cell Biol 22:1526-1536 Niwa H, Miyazaki J, Smith AG 2000 Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells Nat Genet 24:372-376 Niwa H, Toyooka Y, Shimosato D, Strumpf D, Takahashi K, Yagi R, Rossant J 2005 Interaction between Oct3/4 and Cdx2 determines trophectoderm differentiation Cell 123:917-929 Okabe S, Forsberg-Nilsson K, Spiro AC, Segal M, McKay RD 1996 Development of neuronal precursor cells and functional postmitotic neurons from embryonic stem cells in vitro Mech Dev 59:89-102 Okuda A, Fukushima A, Nishimoto M, Orimo A, Yamagishi T, Nabeshima Y, Kuro-o M, Nabeshima Y, Boon K, Keaveney M, Stunnenberg HG, Muramatsu M 1998 UTF1, a novel transcriptional coactivator expressed in pluripotent embryonic stem cells and extra-embryonic cells Embo J 17:2019-2032 Okumura-Nakanishi S, Saito M, Niwa H, Ishikawa F 2005 Oct-3/4 and Sox2 regulate Oct-3/4 gene in embryonic stem cells J Biol Chem 280:5307-5317 84 Remenyi A, Scholer HR, Wilmanns M 2004 Combinatorial control of gene expression Nat Struct Mol Biol 11:812-815 Roussa E, Krieglstein K 2004 Induction and specification of midbrain dopaminergic cells: focus on SHH, FGF8, and TGF-beta Cell Tissue Res 318:23-33 Roybon L, Brundin P, Li JY 2005 Stromal cell-derived inducing activity does not promote dopaminergic differentiation, but enhances differentiation and proliferation of neural stem cell-derived astrocytes Exp Neurol 196:373-380 Sasai Y 2001 Roles of Sox factors in neural determination: conserved signaling in evolution? Int J Dev Biol 45:321-326 Sasai Y 2002 Generation of dopaminergic neurons from embryonic stem cells J Neurol 249 Suppl 2:II41-44 Shimozaki K, Nakashima K, Niwa H, Taga T 2003 Involvement of Oct3/4 in the enhancement of neuronal differentiation of ES cells in neurogenesis-inducing cultures Development 130:2505-2512 Suter DM, Cartier L, Bettiol E, Tirefort D, Jaconi ME, Dubois-Dauphin M, Krause KH 2006 Rapid generation of stable transgenic embryonic stem cell lines using modular lentivectors Stem Cells 24:615-623 Tokuzawa Y, Kaiho E, Maruyama M, Takahashi K, Mitsui K, Maeda M, Niwa H, Yamanaka S 2003 Fbx15 is a novel target of Oct3/4 but is dispensable for embryonic stem cell self-renewal and mouse development Mol Cell Biol 23:2699-2708 Tomioka M, Nishimoto M, Miyagi S, Katayanagi T, Fukui N, Niwa H, Muramatsu M, Okuda A 2002 Identification of Sox-2 regulatory region which is under the control of Oct-3/4-Sox-2 complex Nucleic Acids Res 30:3202-3213 85 Tropepe V, Hitoshi S, Sirard C, Mak TW, Rossant J, van der Kooy D 2001 Direct neural fate specification from embryonic stem cells: a primitive mammalian neural stem cell stage acquired through a default mechanism Neuron 30:6578 Uchida N, Buck DW, He D, Reitsma MJ, Masek M, Phan TV, Tsukamoto AS, Gage FH, Weissman IL 2000 Direct isolation of human central nervous system stem cells Proc Natl Acad Sci U S A 97:14720-14725 Urano Y, Iiduka M, Sugiyama A, Akiyama H, Uzawa K, Matsumoto G, Kawasaki Y, Tashiro F 2006 Involvement of the mouse Prp19 gene in neuronal/astroglial cell fate decisions J Biol Chem 281:7498-7514 Velkey JM, O'Shea KS 2003 Oct4 RNA interference induces trophectoderm differentiation in mouse embryonic stem cells Genesis 37:18-24 Yamazoe H, Murakami Y, Mizuseki K, Sasai Y, Iwata H 2005 Collection of neural inducing factors from PA6 cells using heparin solution and their immobilization on plastic culture dishes for the induction of neurons from embryonic stem cells Biomaterials 26:5746-5754 Ying QL, Nichols J, Chambers I, Smith A 2003 BMP induction of Id proteins suppresses differentiation and sustains embryonic stem cell self-renewal in collaboration with STAT3 Cell 115:281-292 Yuan H, Corbi N, Basilico C, Dailey L 1995 Developmental-specific activity of the FGF-4 enhancer requires the synergistic action of Sox2 and Oct-3 Genes Dev 9:2635-2645 Zhao S, Nichols J, Smith AG, Li M 2004 SoxB transcription factors specify neuroectodermal lineage choice in ES cells Mol Cell Neurosci 27:332-342 86 Appendix Media Formulations PA6 Media Alpha Mem 10% FBS 100x Pen-Strep 450 mL 50 mL mL Differentiation Media Glasgow Media 10% Knock-Out Serum 10 mM Non-Essential Amino Acid 200 mM L-Glutamine 100 mM Sodium Pyruvate 14.3 M β-Mercaptoethanol 435 mL 50 mL mL mL mL 3.5 µL ES Cell Culture Media High Glucose D-Mem 15% FBS 100x Glu-Pen-Strep 14.3 M β-Mercaptoethanol LIF-ESGRO (107 U / mL) 420 mL 75 mL 5.74 mL 5.74 µL 50 µL 87 Appendix Related Articles by Author Chen S, Choo A, Wang ND, Too HP, Oh SK 2006 Establishing efficient siRNA knockdown in mouse embryonic stem cells Biotechnol Lett 8:8 Chen S, Choo A, Wang ND, Too HP, Oh SK 2006 Knockdown of Oct4 and Sox2 Attenuate Neurogenesis of Mouse Embryonic Stem Cells Stem Cells Dev (accepted) 88 [...]... Niwa et al., 20 05; Velkey and O'Shea, 20 03) 29 A Oct- 3/ 4 120 % 100% 80% 60% 40 % * 20 % * 0% FAM MOCK NEGATIVE siOct-A siOct-B Sox- 2 3. 0% 2. 5% 2. 0% 1.5% * * 1.0% 0.5% 0.0% FAM MOCK NEGATIVE s iSox-A siSox-B s iSox-C B Figure 11 Knockdown of Oct- 3/ 4 and Sox- 2 using siRNA (A) Top Panel: Quantitative real-time PCR detection of Oct- 3/ 4 Bottom Panel: Sox- 2 detection Units are relative to endogenous Gapdh levels... of the protein 24 hours post-transfection (Figure 10C) 27 1 .4 1 .2 1 0.8 0.6 0 .4 * * siOct-A siOct-B 0 .2 0 FAM 4 hour Seeding B siOct-B Overnight Seeding C Oct- 3/ 4 C(t) 18.7 siOct-A AB2 .2 FA M ne ga t iv e si Oc t si -A Oc t-B FAM Oct- 3/ 4 Actin Gapdh C(t) 18.5 E 14 FA M ne ga t iv e si Oc t si -A Oc t-B Oct- 3/ 4 mRNA Expression A Oct- 3/ 4 Actin Figure 10 Transient siRNA knockdown of Oct- 3/ 4 (A) Quantitative... hours post-transfection of siRNAs, 4 hours post-seeding 28 b Oct- 3/ 4, Sox- 2 Knockdown and Differentiation into Trophectoderm We expanded upon these initial observations by measuring transcript and protein knockdown at 12 and 24 hour time points for Oct- 3/ 4, in addition to Sox- 2, using qRT-PCR and Western blot Following transfection with siRNAs cognate to Oct- 3/ 4 (siOct) or Sox- 2 (siSox), significant decreases... untransfected mESC cells following 1 week of application (Figure 15) Further attempts were made to alter passaging densities and selection time following transduction, without success Hind III digest 1 2 3 4 5 6 7 8 9 10 Bgl II digest 1 2 3 4 5 6 7 8 9 10 Observed: 35 00, 600, 40 0 bp Observed: 45 00, 35 00 bp Expected :33 44 , 31 26 , 5 84, 556, 35 3, 4 Expected: 45 92, 36 56, 66, 41 Figure 13 Tetracycline repressor (Tet-R)... phenotype (Chambers, 20 04) , suggesting Oct- 3/ 4 alone is insufficient to maintain stem cell identity Other factors which are LIF dependent, but Oct- 3/ 4 independent, may be required for the pluripotent phenotype Upon LIF removal for 1 week, AP expression was found to decrease, and the decrease in Oct3 /4 expression (Figures 3A and 3B, respectively) was observed after 2 -3 weeks later 14 A Oct- 3/ 4 Expression B... lines 21 3 Knockdown of Oct- 3/ 4 and Sox- 2 Transcription Factors in Mouse Embryonic Stem Cells a Establishment of Efficient Transfection Method In order to determine potential roles for Oct- 3/ 4 and Sox- 2 in neurogenesis, we established a robust RNAi knockdown method using siRNAs Several factors can contribute to the failure of an RNAi knockdown, including most commonly, inappropriate siRNA design and. .. compared to respective FAM control results and are representative of 3 independent experiments (B) Top Panel: Western blot detection of Oct- 3/ 4 at 12 and 24 hr post-transfection Bottom Panel: Western blot analyses of Sox- 2 expression at 12 and 24 hr post-transfection Controls (FAM oligos, mock transfection) and the various siRNAs are shown β-Actin serves as a loading control 30 A FAM siOct-A 10X B siSox-A... while siOct or siSox transfected cells differentiated into cells with the extensive cytoplasmic spreading and swollen nuclei characteristic of trophectoderm trophoblast cells, cells which were not visible in control conditions (Figure 12A and 12B) This finding is consistent with observations following forced abrogation of Oct- 3/ 4 and Sox- 2 expression (Niwa et al., 20 00; Niwa et al., 20 05; Velkey and O'Shea,... Quantification of Gapdh amplification (Pink) and Oct- 3/ 4 (Green) amplification in a single multiplexed reaction shows high transcript expression of Oct- 3/ 4, nearly equal to housekeeping gene, Gapdh (C) Top Panel: Western blot detection of Oct- 3/ 4 in AB2 .2 and Bottom Panel: E 14 mESC β-Actin loading controls shown below Negative indicates untransfected mESC, FAM, siOct-A, siOct-B are as described, collected 24 hours... al., 20 00; Shimozaki et al., 20 03) However, it should be noted that while Oct- 3/ 4 is a key molecule for ES cell identity, recent reports of co-regulation by Sox- 2 and Nanog have suggested similarly important roles for pluripotency (Mitsui et al., 20 03; Nichols et al., 1998; OkumuraNakanishi et al., 20 05; Tomioka et al., 20 02) The generation of ZbhTc4/ZbhTc6, requiring homologous recombination of either ... (Hep-NIF) SDIA Feeder-Free Method Knockdown of Oct-3/4 and Sox-2 Transcription Factors in Mouse Embryonic Stem Cells a Establishment of Efficient Transfection Method b Oct-3/4, Sox-2 Knockdown and. .. the role of Oct-3/4 in SDIA, implicate a similar role for Sox-2, and support emerging observations for the role of these factors and SDIA in gliogenesis List of Tables Table Selection of Real-Time... Institute (BTI) and the Agency for Science Technology and Research (A*STAR) Thanks to Prof Wang Nai-Dy, Prof Miranda Yap, Prof Tan Bor Leung, Prof James Chen, and Dr Paul Robson for their guidance,