GENETIC ENGINEERING OF HYBRIDS OF MAJOR MITE ALLERGENS OF DERMATOPHAGOIDES PTERONYSSINUS AND EVALUATION OF THEIR POTENTIAL AS VACCINES FOR IMMUNOTHERAPY LER CHIEW LEI (B.Sc. (Hons.), NUS) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE DEPARTMENT OF BIOLOGICAL SCIENCES THE NATIONAL UNIVERSITY OF SINGAPORE 2008 i Acknowledgements The brief years of graduate studies had been fulfilling. Beyond the academic progress and intellectual development, it had been an invaluable journey of self-discovery. I had sought to research on allergy as an undergraduate and am grateful for the opportunity to work in the Allergy and Molecular Immunology Laboratory, without having to compromise my interest. I hope my research has in one way or another contributed meaningfully to the field, in however minute ways. I would like to thank the National University of Singapore for the award of my research scholarship and the various institutions for the grants they have provided, without which this project could not have been completed. My sincere gratitude towards my supervisor, Dr Chew Fook Tim, for his guidance; for being an inspiration since my undergraduate years; for always challenging and pushing me to reach beyond what I thought I could; and for sharing with me his philosophy of life at times. With much appreciation and respect, I thank our research fellow, Dr Ong Tan Ching, for graciously imparting to me all the knowledge that she had gained with experience and being so ever patient with me. Thank you to Dr Shang Huishen for generously sharing his expertise in molecular cloning; to my lab mates Le Yau, Joshi, Louis and Ramani, for their kind assistance in various parts of the ii project and the engaging conversations we have had, bouncing off ideas with each other; and to the rest of the team for their friendship and support. Lastly, I especially want to thank my family and friends who had stood by me and supported me all the while. I appreciate your every presence in my life. iii TABLE OF CONTENTS ACKNOWLEDGEMENTS ...............................................................................II TABLE OF CONTENTS ................................................................................ IV SUMMARY ................................................................................................... VII LIST OF TABLES........................................................................................... X LIST OF FIGURES ........................................................................................ XI LIST OF FIGURES ....................................................................................... XII LIST OF SYMBOLS .................................................................................... XIII 1 INTRODUCTION .....................................................................................14 1.1 ALLERGY ......................................................................................................14 1.1.1 Mechanism of Allergy.................................................................................................... 14 1.2 ALLERGENS ..................................................................................................16 1.2.1 Mite as an important source of indoor allergens........................................................... 17 1.3 INCIDENCE OF ALLERGY ..............................................................................21 1.4 THERAPY ......................................................................................................21 1.4.1 Immunotherapy.............................................................................................................. 21 1.4.2 Molecular effects of immunotherapy ............................................................................. 22 1.4.3 Allergy Vaccines for Immunotherapy............................................................................. 23 1.5 AIMS AND OBJECTIVES.................................................................................26 1.5.1 Selection of allergens from Dermatophagoides pteronyssinus for incorporation into hybrids........................................................................................................................... 27 2 MATERIALS AND METHODS ................................................................28 2.1 GENETIC ENGINEERING OF HYBRID CONSTRUCTS .......................................28 2.1.1 Bacteria host strains for transformation ....................................................................... 28 2.1.2 Polymerase chain reaction – based molecular cloning................................................. 29 2.1.3 Ligation and transformation into Escherichia coli XL1-Blue ....................................... 30 2.1.4 Automated DNA Sequencing ......................................................................................... 31 2.2 PROTEIN EXPRESSION AND PURIFICATION ..................................................32 2.2.1 Transformation into Escherichia coli BL21(DE3) ........................................................ 32 2.2.2 Induction and expression of proteins............................................................................. 32 2.2.3 Protein Purification....................................................................................................... 33 2.2.4 Protein refolding............................................................................................................ 34 2.2.5 Quantification of protein concentration ........................................................................ 35 2.3 HUMAN SERA SAMPLES .................................................................................35 2.4 IMMUNIZATION OF RABBITS .........................................................................35 2.5 MICE IMMUNIZATION ...................................................................................36 2.6 IMMUNOLOGICAL STUDIES ...........................................................................37 iv 3 2.6.1 Inhibition ELISA............................................................................................................ 37 2.6.2 ELISA for the quantification of serum specific IgG....................................................... 38 2.6.3 Inhibition of human IgE binding by specific IgG antibodies......................................... 39 RESULTS ................................................................................................41 3.1 GENETIC ENGINEERING OF HYBRIDS CONTAINING THE MAJOR MITE ALLERGENS OF DERMATOPHAGOIDES PTERONYSSINUS ................................41 3.2 EXPRESSION AND PURIFICATION OF HYBRIDS IN ESCHERICHIA COLI (BL21 STRAIN). ........................................................................................................45 3.2.1 Expression and purification of Der p 1-2 ...................................................................... 45 3.2.2 Expression and purification of Der p 7-5 ...................................................................... 46 3.3 HYBRIDS HAVE REDUCED IGE BINDING .......................................................47 3.4 HYBRIDS INDUCE BLOCKING IGG ANTIBODIES ...........................................50 3.4.1 Hybrids Der p 1-2 and Der p 7-5 Induce IgG response in Rabbits ............................... 50 3.4.2 Hybrid-induced IgG binds to individual allergens ........................................................ 53 3.4.3 Hybrid induced IgG inhibits the binding of human IgE to the individual allergens...... 56 3.5 COMPARISON OF INDIVIDUAL DER P 1 AND HYBRID DER P 1-2 AS POTENTIAL VACCINES ......................................................................................................60 3.5.1 Recombinant Der p 1 induced IgG in rabbits that bound the native protein and blocked the binding of human IgE to the allergen. ..................................................................... 60 3.5.2 IgG antibodies induced by recombinant Der p 1 had reduced IgE blocking capacity in contrast to IgG antibodies induced by hybrid Der p 1-2............................................... 62 3.6 IMPORTANCE OF CONFORMATION ON GENERATION OF ALLERGY VACCINE 64 3.6.1 Recombinant Der p 1 induces IgG that bind to Native Protein ..................................... 64 3.6.2 Recombinant Der p 1 induced IgG inhibited the binding of human IgE to native Der p 1 ....................................................................................................................................... 65 3.6.3 IgG antibodies induced by recombinant Der p 1 showed reduced capacity to block IgE in comparison to IgG antibodies induced by native Der p 1 ............................................. 66 4 DISCUSSION ..........................................................................................69 4.1 HYBRIDS FOR HOUSE DUST MITE ALLERGENS OF DERMATOPHAGOIDES PTERONYSSINUS .............................................................................................69 4.2 GENETIC ENGINEERING OF HYBRIDS CONTAINING MAJOR MITE ALLERGENS OF DERMATOPHAGOIDES PTERONYSSINUS AND EXPRESSION IN ESCHERICHIA COLI ...............................................................................................................70 4.2.1 Vaccine candidates with disrupted three dimensional structure.....Error! Bookmark not defined. 4.2.2 Expression and purification of hybrids in denaturing conditions...Error! Bookmark not defined. 4.3 EVALUATION OF DER P 1-2 AND DER P 7-5 AS POTENTIAL VACCINES ..........73 4.3.1 Hybrids Der p 1-2 and Der p 7-5 have reduced IgE binding ........................................ 73 4.3.2 Hybrids Der p 1-2 and Der p 7-5 induced IgG antibodies that bound to the individual allergens and inhibited the binding of human serum IgE to them ................................. 77 4.4 COMPARISON OF INDIVIDUAL DER P 1 AND HYBRID DER P 1-2 AS POTENTIAL VACCINES ......................................................................................................84 v 4.4.1 Incorporation of Der p 1 into hybrid Der p 1-2 increases its immunogenicity and induces a stronger IgG response ................................................................................................ 84 4.4.2 Incorporation of Der p 1 into a hybrid widens the repertoire of the induced IgG ........ 85 4.5 MAINTAINING CONFORMATION IS IMPORTANT FOR ALLERGY VACCINES DESIGNED FOR ALLERGENS WITH PREDOMINANTLY CONFORMATIONAL EPITOPES .......................................................................................................87 4.5.1 Importance of the conformation and implications on the generation of allergy vaccines ....................................................................................................................................... 89 4.6 THE HYBRID APPROACH – WITH PERSPECTIVES FROM DUST MITE STUDIES ......................................................................................................................92 4.6.1 Hybrids as suitable replacement for individual allergens as vaccines.......................... 92 4.6.2 Hybrids enhance immunogenicity ................................................................................. 93 4.6.3 Hybrids enhance the repertoire of epitopes recognized by IgG induced by vaccine ..... 94 4.6.4 Hybrids can be hypoallergenic...................................................................................... 94 5 CONCLUSION ........................................................................................96 6 FUTURE WORK......................................................................................96 7 BIBLIOGRAPHY .....................................................................................98 vi Summary IgE-mediated (Type 1) allergy affects more than 25% of the industrialized populations. Atopic individuals usually mount IgE responses against innocuous environmental antigens, which when re-exposed to binds to effector cell bound IgE, causes crosslinking and consequent release of inflammatory mediators to elicit acute symptoms of allergy. Allergen specific immunotherapy, based on the administration of allergens as vaccines, is the only treatment that is aimed at long term relief of symptoms. Currently, it is carried out using natural extracts of allergen sources. This study explores the use of hybrids, comprising several allergens linked together, as allergy vaccines. As recombinants, hybrids can be produced in defined composition. This overcomes problems associated with undefined, non-standardized composition of natural extracts, such as under-representation of allergens and acquiring new sensitizations. Furthermore, most patients are sensitized to more than one allergen and even more than one allergen source. The use of hybrid vaccines allows for simultaneous immunotherapy against allergy caused by several allergens with the production of a single vaccine molecule. In this study, two hybrid molecules consisting of four major allergens of house dust mite Dermatophagoides pteronyssinus were constructed via genetic engineering. vii Both hybrids induced IgG antibodies in rabbits that were specific to each of their component allergens. The induced IgG antibodies further inhibited the binding of human IgE antibodies to the individual allergens. By inhibiting the formation of IgE-allergen complexes, the downstream IgE-mediated allergic responses could be prevented as well, as observed in immunotherapy. In particular, Der p 7-5 induced specific IgG responses at comparable levels to that induced by Der p 5 or Der p 7 alone; the IgG also inhibited IgE binding by comparable extents. Therefore, the hybrid could potentially replace both allergens as vaccines. The hybrids exhibited lower IgE binding ability than the individual allergens and could be safer vaccines, owing to their inability to elicit in vivo allergenic side effects. Together with the ability to induce blocking IgG, both hybrids were potential hypoallergenic vaccines for immunotherapy against their component allergens. This study also demonstrated that the incorporation of allergen, Der p 1, into a hybrid molecule led to an increase in Der p 1-specific IgG responses in rabbits, corroborating published findings on hybrids of pollen allergens where the hybrids similarly exhibited enhanced immunogenicity. Additionally, this study showed that alongside the increased immunogenicity, the repertoire of epitopes recognized by IgG antibodies that were induced by the hybrids appear to be wider than that induced by the viii single allergen. While the underlying explanations for the enhancement of immunogenicity and the induction of a slightly different IgG repertoire remain to be elucidated, the data clearly supported the use of hybrids over other types of allergy vaccines such as natural extracts, purified recombinants or recombinant cocktails, none of which could resolve the problem of poor vaccine immunogenicity. ix List of Tables Page Table 1: Mite Allergens and Corresponding Biochemical identities ..........................19 Table 2: Summary of hybrids of allergens previously studied ...................................26 Table 3: Strains of Escherichia coli used in study.. ....................................................28 Table 4: Primers used in the cloning of hybrid constructs..........................................29 Table 5: Sequence Homology of cDNA clones to published allergen sequences ......41 x List of Figures Page Figure 1: Mechanism of allergy ............................................................................................. 15 Figure 2: Genetic engineering of hybrids containing major mite allergens of Dermatophagoides pteronyssinus...........................................................42 Figure 3: Two successfully engineered hybrid constructs, Der p 1-2 and Der p 7-5. ................................................................................................44 Figure 4: Expression of Der p 1-2............................................................................45 Figure 5: Expression of Der p 7-5............................................................................46 Figure 6: Inhibition of human IgE binding to allergens by hybrid proteins. ...........48 Figure 7: Comparison of the inhibition capacity of hybrid proteins Der p 1-2 and Der p 7-5 ..........................................................................................49 Figure 8: Representative profile of IgG antibodies induction in rabbits with hybrid immunization...............................................................................51 Figure 9: Hybrids induced IgG antibodies in all immunized rabbits.......................53 Figure 10: Binding of Der p 1-2 induced IgG to individual allergens.....................54 Figure 11: Binding of Der p 7-5 induced IgG to individual allergens.....................55 xi List of Figures Page Figure 12: Inhibition of human IgE binding to native Der p 1 and Der p 2 by Der p 1-2 immunized rabbit antisera ......................................................58 Figure 13: Inhibition of human IgE binding to Der p 5 and Der p 7 by Der p 7-5 immunized rabbit antiesera.....................................................59 Figure 14: Comparison of IgG antibodies induced by recombinant Der p 1 and Der p 1-2. ................................................................................................61 Figure 15: Comparison of Der p 1 and Der p 1-2 as immunogens for induction of blocking IgG.......................................................................62 Figure 16: Binding of rabbit IgG to native Der p 1 at 5% v/v. ................................63 Figure 17: Induction of IgG in BALB/c mice following immunization with native Der p 1 and recombinant Der p 1.................................................64 Figure 18: Dose dependent inhibition of human IgE binding to native Der p 1 by mice antisera.. .......................................................................65 Figure 19: Inhibition of the binding of human IgE to native Der p 1......................67 Figure 20: Binding levels of mice sera at 8% v/v mice serum concentration..........68 xii List of Symbols cDNA Complementary deoxyribose nucleic acid CD4 Cluster of differentiation 4 Treg Regulatory T cells bp basepairs Da Dalton xiii 1 Introduction 1.1 Allergy Allergy is a type one immediate hypersensitivity reaction, in which an immunological response is elicited upon exposure to innocuous environmental antigens at doses tolerated by normal subjects, producing clinical reactions. Common allergic diseases include allergic rhinitis, asthma, atopic eczema, urticaria and systemic anaphylaxis. Phenotypically, it is marked by presence of allergen-specific immunoglobulin E (IgE), along with mast cell and eosinophil recruitment and activation (Wills-Karp et al., 2001). 1.1.1 Mechanism of Allergy Some individuals possess a predisposition to develop allergies. The susceptibility, termed atopy, is influenced by both genetic and environmental factors. In these individuals, allergy is elicited upon first exposure to the allergens (Figure 1). Antigen presenting cells in the peripheral tissues, such as dendritic cells and macrophages, phagocytose the antigens and migrate towards the lymph nodes, where they present antigenic T cell epitopes to naïve CD4+ T cells via appropriate major histocompatability complex (MHC) Class II molecules (Mosmann and Livingstone, 2004). This activates T cells differentiation into T helper two (Th2) cells which secrete cytokines such as interleukin-4 (IL-4). 14 Figure 1. Mechanism of Allergy. Allergy is initiated during the first exposure to an allergen. (A) Allergen-specific IgE antibodies are produced which bind to mast cells via FcέRI receptors. (B) During subsequent exposure, allergen binding to effector cell-bound specific IgE leads to the cross-linking of FcέRI receptors and the release of inflammatory mediators by means of degranulation, resulting in the immediate symptoms of allergy. (C) Late phase reaction sometimes follows hours to days following exposure, characterized by T cell proliferation and eosinophil recruitment. APC, antigen-presenting cell; DC, dendritic cell; TCR, T-cell receptor. (Adapted from Valenta, 2002) The antigens also bind bone marrow cells (B cells) via specific B cell epitopes. Through T-cell-B-cell interactions, secreted IL-4 stimulates isotype switching in 15 activated B cells which then differentiate into plasma cells, producing IgE antibodies (Valenta, 2002). The IgE binds with high affinity to their receptors, FcέRI, located on the surface of mast cells in tissues and basophils in the blood (Tanabe, 2007). During this phase of sensitization, Th2-polarized memory T cells and IgE memory B cells (Valenta, 2002) are established. During subsequent re-exposure, multivalent binding of allergen to bound IgE results in crosslinking of IgE receptors (Figure 1B). Degranulation occurs where inflammatory mediators such as histamine and leukotrienes are released from mast cells (Kemp and Lockey, 2002), resulting in acute allergic reactions. Late phase allergic reactions can be provoked by the activation of allergen-specific T cells after hours to days and this phase is characterized by T cell infiltration and eosinophil recruitment. Bound IgE antibodies have also been implicated in antigen-presentation to T cells. 1.2 Allergens Allergies are initiated by exposure to allergens. These are immunogenic antigens present in the environment, typically proteins or glycoproteins, with molecular masses of 5-80 kDa (Valenta, 2002). They are able to induce the production of 16 antibodies of the IgE subtype during sensitization; and elicit clinical response to the same or similar protein upon subsequent re-exposures (Akdis, 2006). To date, more than 500 allergens have been characterized (Tanabe, 2007). In accordance to the allergen nomenclature established by the Allergen Nomenclature Sub-Committee of the Interional Union of Immunological Societies (IUIS), an allergen is designated by the first 3 letters of the genus, the first letter of the species name, and then a number specifying the order in which the allergen was identified. Homologous allergens of related species are assigned to the same number. (Arlian et al., 2001). Based on the prevalence of IgE or skin reactivity in sensitized patients, allergens that result in noticeable changes in overall extract reactivity upon removal are termed ‘major allergens’ (Aalberse, 2000). Overall, the total annual exposure of an individual to allergens is estimated to be in the order of micrograms (Cookson, 1999). These typically involve indoor allergen sources such as house dust mites, cockroaches, animal danders and moulds and outdoor allergens consisting of inhaled grass pollen and fungal spores. 1.2.1 Mite as an important source of indoor allergens Mites are the most important source of allergens in the indoor environment. Dust mite allergies constitute a significant health problem both worldwide and locally, 17 with more than 50% of allergic patients being sensitized to them (Chew et al., 1999; Angus et al., 2004; Weghofer et al., 2005). Different species of mites thrive in different parts of the world as a result of climatic factors like relative humidity and temperature. Consequently, their importance as major allergens varies geographically. Allergies due to mites from the genus Dermatophagoides are clinically important, affecting up to 10% of general populations (Tanabe, 2007). In particular, D. pteronyssinus is the most prevalent in central Europe (Hart et al., 1990). Mite allergens are mainly derived from their bodies and fecal matter (Arlian et al., 1987) and are divided into groups based on their biochemical composition, sequence homology, and molecular weight (Arlian et al., 2001). A summary of the allergens identified to date and their corresponding biological identities is provided in Table 1. 18 Allergen Group Biological Function Molecular Weight (kDa) IgE Binding Frequency Reference† 1 Cysteine protease 25 70-90 Chua et al., 1988 2 Unknown 14 60-90 Chua et al., 1990 3 Trypsin 28, 30 51-90 Smith et al., 1994 4 Amylase 57, 60 25-46 Lake et al., 1991; Mills et al., 1999 5 Unknown 15 9-70 Tovey et al., 1989 6 Chymotrypsin 25 30-40 Yasueda et al., 1993 7 Unknown 22-31 50-62 Shen et al., 1993 8 Glutathione-S-tr ansferase 26 40 O’Neill et al., 1994 9 Collagenolytic serine protease 30 >90 King et al., 1996 10 Tropomyosin 33-37 5-80 Asturias et al., 1998 11 Paramyosin 92, 98, 110 80 Tategaki et al., 2000 12 Unknown 14 50 - 13 Fatty acid binding protein 14, 15 10-23 - 14 Apolipophorin 177 30, 39, 70 15 98 kDa chitinase 98 Epton et al., 2001 O’Neil et al., 2006 19 Allergen Group † Biological Function Molecular Weight (kDa) IgE Binding Frequency Reference† 16 Gelsolin-like protein/ villin 53 35 - 17 EF-hand calcium-binding protein 53 35 - 18 60 kDa chitinase 60 54 19 Anti-microbial peptide 7.2 - 20 Arginine kinase 40 # 21 Unknown 14 # O’Neil et al., 2006 Only references for allergens of Dermatophagoides pteronyssinus are shown. # Identified D. pteronyssinus allergens for which the sequence data is either listed in WHO/IUIS or Genbank but as yet unpublished. Table 1. Mite Allergens and Corresponding Biochemical identities. Table shows allergens that have been identified and updated with the WHO/IUIS, as of December 2007. Mite allergens are divided into specific groups based on their biochemical composition, sequence homology and molecular weight. 20 1.3 Incidence of Allergy The incidence of allergic diseases has risen dramatically over the last two decades in western Europe, the United States and Australasia (Mackay and Rosen, 2001), affecting up to thirty percent of these populations (Crameri and Rhyner, 2006). In particular, the prevalence of allergic asthma in industrialized countries has doubled since 1980 and corresponding healthcare expenditure is enormous (Umetsu et al., 2002). 1.4 Therapy At present, allergy treatment mainly includes allergen avoidance and pharmacotherapy where drugs such as anti-histamines and corticosteroids are administered to reduce the inflammation. The only treatment that provides long lasting relief of symptoms is allergen-specific immunotherapy. 1.4.1 Immunotherapy Although the mechanisms underlying allergen specific immunotherapy are still being elucidated, considerable evidence suggests that it has the character of vaccination (Valenta et al., 2004). The disease-eliciting allergens or the derivatives are administered to patients in increasing doses over a period of time. 21 1.4.2 Molecular effects of immunotherapy Immunological responses to allergen specific immunotherapy appear to be effected at a very early stage, thresholds for the activation of mast cells and basophils appear to be modulated, leading to the desensitization of these effector cells and consequently a reduction in IgE mediated histamine release (Pierkes et al., 1999). The mechanism underlying the desensitization effect is not understood as yet. Other effects frequently observed with immunotherapy include the induction of allergen specific Treg cells; suppressed proliferative and cytokine responses (Akdis and Akdis, 2007). During the course of therapy, the level of specific IgE in the serum has been shown to transiently increase before gradually decreasing over a period of months of years with treatment. Immunotherapy therapy also frequently induces allergen specific IgG antibodies in the serum. These antibodies, in particular, the IgG4 subclass, are believed to compete with human IgE for the allergen thus blocking IgE-dependent histamine release and the downstream acute phase responses. Recognizing the same epitopes as human IgE, IgG had been shown to suppress allergen-specific T cell responses in vitro by inhibiting IgE-mediated allergen-presentation to T cells (van Neerven et al., 1999; Wachholz et al., 2003). 22 1.4.3 Allergy Vaccines for Immunotherapy Currently, allergen-specific immunotherapy is performed using natural allergen extracts from the allergen sources. This approach exposes patients all components of the natural extracts –allergic and non-allergic– hence subjecting them to new sensitizations and the risks thereof (van Hage-Hamsten and Valenta, 2002). The allergen contents can also vary from batch to batch, depending on factors such as contamination with allergens from other sources, extraction procedures, proteolysis and degradation of allergens (Linhart and Valenta, 2004). As such, certain allergens could potentially be under-represented, contributing in part to the varying efficacies of therapy reported. A major problem associated with allergen specific immunotherapy pertains to the induction of local or even severe, life-threatening systemic anaphylaxis. When B cell epitope-containing antigens are administered as vaccines, the IgE antibodies could bind to the allergens, thereby eliciting the side effects. Purified recombinant allergens that resemble their natural counterparts in terms of structural and immunological characteristics could address the inadequacies of using natural extracts pertaining to undefined allergen composition. Not only can they be produced with high batch-to-batch consistency, the use of native-like recombinants permits the combination of various allergens into vaccine cocktails tailored according 23 to the sensitization profiles of patients while eliminating the possibility of new sensitizations at the same time. However, as with the natural extracts, native-life recombinant allergens pose similar risks of anaphylactic side effects. Therefore, allergens with reduced IgE binding, called hypoallergens, have been proposed to improve safety of immunotherapy. Approaches to the generation of hypoallergens include site-directed mutations of known IgE binding epitopes and the destruction of three dimensional protein conformation by disrupting disulphide bonds, fragmentation of proteins or through the use of peptides (Gafvelin et al., 2007). In the constant search for vaccines to address existing problems and improve efficacy and safety, combinatorial hybrid molecules have been explored as potential vaccines for allergy. 1.4.3.1 Hybrids Some allergen sources such as birch pollen and cat dander contain a single major allergen that includes most of the disease-eliciting epitopes (Linhart and Valenta, 2004). Immunotherapy against these sources would essentially require only the major allergen as vaccine. However, most other allergen sources such as dust mite contain several allergens that may not be immunologically related. Further, allergic patients are 24 frequently sensitized to more than one allergen from a source (Silvestri et al., 1996; Cuerra et al., 1998; Linhart and Valenta, 2004), therefore it would be necessary to vaccinate simultaneously against several allergens from the source. Hybrids are suitable for vaccination against these complex sources. They are fusion proteins that consist of two or more allergens or the derivatives that have been combined via genetic engineering. The cDNA encoding the individual components are assembled together by polymerase chain reaction (PCR) and the resultant constructs are expressed as a single recombinant protein. As recombinant proteins, hybrid allergens can be expressed and purified in defined composition. This eliminates problems of new sensitizations or under-representation of allergens, associated with natural extracts. Although a recombinant cocktail vaccine containing a mixture of uncombined recombinant allergens could similarly offer the same benefits, it overlooks the problem that some allergens or derivatives exhibit poor immunogenicity. In contrast, the fusion of poorly immunogenic allergens with allergens from the same source in a hybrid had been shown to strongly enhance the immunogenicity of the low immunogenic molecules (Linhart and Valenta, 2005). To date, hybrid allergens have been constructed for allergens involved in grass and weed pollen, wasp and bee venom associated allergies (Table 2). Although not 25 clinically tested as yet, the hybrids studied thus far have demonstrated to be potential allergy vaccines for allergen specific immunotherapy. Allergen Source Species Molecule/ Peptide* Reference Wasp Venom Vespula vulgaris; Polistes annularis Ves v 5 + Pol a 5 King et al., 2001 Bee Venom Apis mellifera Ap1 m 1 + Api m 2 Kussebi et al., 2005 Grass Pollen Phleum pratense Phl p 2 + Phl p 6; Phl p 6 + Phl p 2; Phl p 5 + Phl p 1 Phl p 6 + Phl p 2 + Phl p 5 + Phl p 1 Linhart et al., 2002 Par j 2 + Par j 1 Par j 1 + Par j 2; Bonura et al., 2007 González-Rioja et al., 2007 Weed Pollen Parietaria judaica Linhart et al., 2005 * Hybrid comprising allergens or its modified derivatives Table 2. Summary of hybrids of allergens previously studied. 1.5 Aims and Objectives The hybrid approach could be similarly applied to other allergen sources, such as dust mite, the most important indoor allergen source. This study aims to construct hybrids comprising important allergens of house dust mite Dermatophagoides 26 pteronyssinus and to evaluate their potential as potential vaccines for immunotherapy. 1.5.1 Selection of allergens from Dermatophagoides pteronyssinus for incorporation into hybrids Owing, in part, to the difficulties involved in producing a hybrid consisting of all allergens from a source, the incorporation of only a few selected, important allergens that affect a large proportion of the population into hybrids should suffice to generate a vaccine effective for most sensitized patients. The two most important major allergens from D. pteronyssinus are Der p 1 and Der p 2. In many populations tested, more than 80% of mite-allergic patients are sensitized to Der p 1 (van der Zee et al., 1988; Krilis et al., 1984) and 70-88% are sensitized to Der p 2 (Lynch et al., 1997; Shen et al., 1996). Der p 1- and Der p 2-specific IgE frequently accounted for more than 50% of total serum IgE against the whole mite extract (van der Zee et al., 1988; Lynch et al., 1997). Immunoblot studies with local mite-allergic patients further highlighted the importance of these two allergens, with frequencies of sensitization at 87.8% for Der p 1 and 78% for Der p 2 (Unpublished data). Der p 5 and Der p 7 represent the two other important allergens, where the frequencies of sensitization range from 50-77.4% for Der p 5 and approximate 52-53% 27 for Der p 7 (Shen et al., 1993; Lin et al., 1994; Lynch et al, 1996; Kuo et al., 2003). Specific IgE to these two allergens accounted for 20-25% of total IgE against mite extract (Lynch et al., 1996). Of note, although the frequency of sensitization to Der p 7 may be lower than Der p 2, its specific IgE binding was observed to be equally high, if not higher than that with Der p 2 in a large percentage of subjects, indicating the importance of this allergen (Shen et al., 1996). With considerations of their importance in terms of frequency of sensitizations in studied populations, Der p 1, Der p 2, Der p 5 and Der p 7 were selected to be incorporated into hybrids that could potentially act as vaccines for immunotherapy against these allergens. 2 Materials and Methods 2.1 Genetic engineering of hybrid constructs 2.1.1 Bacteria host strains for transformation Strain Genotype XL1-Blue [N1] Δ(mcrA) 183Δ(mcrCB-hsdSMR-mrr)173 end A1 supE44 thi-1 recA1 gyr 1A96 relA1 lac[F’proAB lacIqZ ΔM15Tn10(Tetr)] BL21(DE3) F-ompThsdSB(r-Bm-B)galdcm(DE3)pLysS Table 3. Strains of Escherichia coli used in study. 28 2.1.2 Polymerase chain reaction – based molecular cloning Plasmids expressing Der p 1-2 and Der p 7-5 were constructed from cDNAs clones that code for the mature proteins of Der p 1, Der p 2, Der 5 and Der p 7. Forward and reverse primers (Research Biolabs, Singapore) as shown in Table 4 were used to amplify the plasmids using high fidelity KOD XL DNA polymerase (Novagen, Madison Wisc., USA). The coding region of Der p 2 and Der p 5 clones were amplified using DP2F-DP2R and DP5F-DP5R forward and reverse primer pairs. The clones of Der p 1 and Der p 7 were amplified using AFTF-DP1R and AFTF-DP7R forward and reverse primer pairs. Primer AFTF DP1F DP2F DP2R DP5F DP5R DP7F DP7R Sequence ACCGGGCTTCTCCTCAACCATGGCG GAGAATGACAACATATGGATATTC GATCAAGTCGATGTCAAAGATTGTG TCAATCGCGGATTTTAGCATGAG GAAGATAAAAAACATGATTATCAA TTAAACTTCAATCTTTTTAACACGTGC GATCCAATTCACTATGATAAAATC CTATTGGTTGTTTCGTTCCAATTC Table 4. Primers used in the cloning of hybrid constructs. Each of the reactions were carried out in a 50 µl mixture comprising of 2.5 ng recombinant plasmids, 0.2 nM dNTPs, 0.4 µM forward primer, 0.4 µM reverse primer, 10 times PCR buffer and 2.5U KOD XL DNA polymerase. 29 Thermocycling was carried out in PTC-100™ Programmable Thermal Controller (MJ Research Inc., USA). For the amplification of the coding regions of the allergens, profile was set as follows: denaturation at 94°C for 30 seconds, annealing at 50°C for 20 seconds and extension at 74°C for 2 minutes and repeated for 32 cycles. Extension time was 8 minutes for the amplification along the entire length of plasmid. Amplified products of Der p 2 and Der p 5 were subjected to kinase reaction with 1 µl T4 polynucleotide kinase (Research Biolabs, Singapore), 4 µl 10 times kinase buffer and 1 µl ATP in a 40 µl reaction mixture, for one hour at 37°C. Products Der p 1 and Der p 7 amplification were incubated with restriction enzyme Dpn I (Stratagene, USA) in 10 times Dpn I reaction buffer and left to stand for an hour at 37°C. Thereafter, products were purified using the QIAquick PCR purification kit (Qiagen Inc., USA), following manufacturer’s manual. 2.1.3 Ligation and transformation into Escherichia coli XL1-Blue The purified products were ligated using T4 DNA ligase in 10 µl reaction mixture containing the 2 times T4 DNA ligase buffer and topped up with deionised water. Reaction mixture was left to stand for 4 hours at 37°C. Subsequently, 2µl of the ligation product was added to 100µl of XL1-Blue competent cells, mixed and placed on ice for 40 minutes, incubated at 42º C for 1.5 minutes and cooled on ice again for 5 30 minutes. Transformed cells were then allowed to grow in 1ml Luria-Bertani (LB) medium for 45 minutes at 37ºC with shaking. Following incubation, the cells were then plated on gels containing LB and 100 µg/ml ampicillin. Colonies from the agar plats were picked and inoculated into liquid LB medium that containing ampicillin. The culture was allowed to grow overnight at 37ºC. The plasmids were extracted using the QIAprep Spin Miniprep Kit (Qiagen Inc., USA) and sequenced in both forward and reverse directions. 2.1.4 Automated DNA Sequencing DNA sequencing was performed as suggested in Prism™ cycle sequencing kits (Perkin Elmer, USA) using a 20µl reaction mixture of 2 µl terminator ready reaction mix, 250 ng DNA templates and 10 pmole forward or reverse primers. Thermocycling profile was set for denaturation at 96° C for 30 seconds, annealing at 50° C for 15 seconds, extension at 60° C for 4 minutes and repeated for 29 cycles. After cycle sequencing, 3 µl of 3 M sodium acetate (pH 4.6), 62.5 µl of 95% ethanol and 14.5 µl deionised water were added to reaction mixture and incubated at room temperature for 5 minutes. Thereafter, precipitated DNA was subjected to centrifugation at 13 000 g for 21 minutes. DNA pellet was washed with 500 µl of 70% ethanol. Centrifugation was performed for another 5 minutes and the supernatant was 31 removed by pipetting. Finally, the pellet was air-dried before DNA sequence analysis on ABI Prism 377 DNA sequencer. Sequencing gel fraction services were provided by DNA Sequencing Laboratory, Department of Biological Sciences, NUS. 2.2 Protein Expression and Purification 2.2.1 Transformation into Escherichia coli BL21(DE3) Recombinant plasmids coding for hybrids Der p 1-2, Der p 7-5 and the individual allergens Der p 1, Der p 2, Der p 5 and Der p 7 were first transformed into Escherichia coli BL21 (DE3) (Novagen, Madison Wisc., USA) as described earlier. This strain of E. coli lacks the Ion protease and the ompT outer membrane protease that can degrade proteins during purification (Grodberg and Dunn, 1988) and is a commonly used host for gene expression. 2.2.2 Induction and expression of proteins A single colony was picked from the plate and inoculated into 2 ml LB liquid medium containing ampicillin and grown overnight at 37°C with shaking (230 rpm). The culture was then transferred to a 200 ml fresh medium with ampillin and cultured at 37°C with shaking (230 rpm), until the OD600 reaches 0.6. Expression was induced by the addition of 1 mM isopropyl 1-thio-β-D-galactoside (IPTG) for 4 hours at 37°C with shaking (230 rpm). At the end of protein induction, cells were harvested by 32 centrifugation at 3,500 rpm for 5 minutes at 4°C. Cell pellets were kept at -20°C. until ready for purification. 2.2.3 Protein Purification Der p 5 and Der p 7 were purified in non-denaturing conditions while recombinant allergens Der p 1, Der p 2 and D. pteronyssinus hybrid proteins Der p 1-2 and Der p 7-5 were purified in the presence of 8M urea denaturant. 2.2.3.1 Protein purification under non-denaturing conditions Cell pellets from the 200 ml cultures were resuspended in 50 ml of Nickel binding buffer (0.5 M NaCl, 5 mM Immidazole and 20 mM Tris-Cl, pH 7.9). The suspension was divided into 2 tubes and sonicated on ice for 3 minute each at 38% sonication amplitude. Four rounds of sonication were carried out and then centrifuged for 30 minutes at 13,000 rpm at 4°C. The supernatant was incubated with charged Ni-NTA resin (Novagen) and washed with 10 times volume of wash buffer (0.5 M NaCl, 60 mM Immidazole, and 20 mM Tris-HCl, pH 7.9) to remove unbound proteins and finally eluted with elution buffer (300 mM imidazole, 0.5 M NaCl and 20 mM Tris-HCl, pH 7.9). 33 2.2.3.2 Protein purification under denaturing condition Cell pellets from the 200 ml cultures were resuspended in 40 ml of 1X nickel binding buffer (0.5 M NaCl, 5 mM Immidazole and 20 mM Tris-HCl, pH 7.9). The suspension was sonicated on ice for 3 minutes at 38% sonication amplitude. Four rounds of sonication were carried out. Suspension was centrifuged at 13,000 rpm for 20 minutes at 4°C, the supernatant was decanted. The pellet was resuspended in fresh nickel binding buffer and centrifuged for a second time, to collect inclusion bodies and cellular debris. 10 ml of nickel binding buffer containing 8M urea was then added and the suspension was incubated on ice for an hour to solubilize proteins residing within inclusion bodies and centrifuged at 13,000 rpm for 20 minutes at 4°C. Cell lysate was incubated with charged Ni-NTA resin (Novagen) and washed with 10 times volume of wash buffer (0.5 M NaCl, 60 mM Immidazole, and 20 mM Tris-HCl, pH 7.9) with 8M urea to remove unbound proteins and finally eluted with elution buffer (300 mM imidazole, 0.5 M NaCl and 20 mM Tris-HCl, pH 7.9) containing 8M urea. 2.2.4 Protein refolding Purified Der p 2 and Der p 7 were further refolded by rapid dilution and dialysis respectively. With the aid of a peristaltic pump, purified Der p 2 was dropped into 50 mM sodium acetate, pH 4.6 at 4°C. The refolded protein was concentrated using 34 Amicon Stir Cell (Millipore) using a membrane with 3000 Da molecular weight cut off. Der p 7, on the other hand, was refolded by dialyzing it into PBS overnight at 4°C, using a SnakeskinT Dialysis Tubing (Pierce Biotechnology) with a molecular weight cut off of 3500 Da. 2.2.5 Quantification of protein concentration Concentration of purified proteins was determined using Bio-Rad protein assay (Bio-rad Laboratories, CA, USA) as per manufacturer’s instructions using serially diluted bovine serum albumin (BSA) as standard. 2.3 Human sera samples Consecutive serum samples from local patients showing clinical symptoms of allergies were used in this study. Approval to conduct the studies was obtained from the Institutional Review Board of the National Healthcare Group, KK Women’s and Children’s Hospital, and Singapore General Hospital. 2.4 Immunization of rabbits Groups of three New Zealand White rabbits (2.5 to 3 kg) were each immunized subcutaneously with 420 µg of purified hybrid proteins or the individual allergens recombinant Der p 1, Der p 5 or Der p 7 diluted in PBS to a volume of 700 µl, and 35 mixed well with an equal volume of Freund’s complete adjuvant (Sigma-Aldrich). Control rabbit was immunized with the protein buffer in which the hybrids were purified. Boosters were mixed with Freund’s incomplete adjuvant (Sigma-Aldrich) instead and given once every two weeks. Before immunization, rabbits were first anaesthetized subcutaneously with ketamine and xylazine. Blood was drawn using an infusion set through the ears of the rabbits. Blood collected was kept at 4˚C overnight to permit clotting and subsequently centrifuged at 3,000x g for 20 minutes at 4˚C. Sera were collected from the supernatant and kept in -20˚C until further analysis. Animals were maintained in the Animal Holding Unit of the Faculty of Medicine, National University of Singapore, in accordance to the local guidelines. 2.5 Mice Immunization Mouse immunization studies were performed using eight weeks old female BALB/c mice. Groups of four mice were immunized with 15 µg of affinity purified native Der p 1 (Indoor Biotechnologies) or purified recombinant Der p 1 mixed with 1.25 mg/ml aluminium hydroxide gel (Sigma-Aldrich) once every two weeks via intra-peritoneal injections. Two mice were similarly immunized with the same 36 volume of the buffer in which recombinant Der p 1 was purified, again mixed with 1.25 mg/ml aluminium hydroxide gel. All dilutions were made with PBS buffer. Before injection, mice were anaesthetized intra-peritoneally with a ketamine (75mg/kg) and medetomidine (1mg/kg) mixture. Following each immunization, blood was drawn from the mice via orbital bleeding. Thereafter, reversing anesthesia comprising antisedan (atipamezole hydrochloride) was administered to facilitate the recovery of the animal. Blood collected was kept at 4˚C overnight and subsequently centrifuged at 5,000 rpm for 25 minutes at 4˚C. Sera were collected from the supernatant and kept in -20˚C until further analysis. Animals were maintained in the Animal Holding Unit of the Faculty of Medicine, National University of Singapore, in accordance to the local guidelines. 2.6 Immunological studies 2.6.1 Inhibition ELISA Sensitized human sera were pre-adsorbed overnight at 4˚C with serially diluted allergens nDer p 1, Der p 2, Der p 5, Der p 7, Der p 1-2, Der p 7-5 or with BSA as negative control. ELISA plates were coated with 250ng per well of the individual allergens, nDer p 1, Der p 2, Der p 5 or Der p 7 at 4˚C overnight. 37 The plates were washed and blocked using 0.1% PBS-Tween 20. 50 µl of the pre-incubated human sera were added to each well and incubated at 4˚C overnight. IgE binding of the human sera to the ELISA plate coated antigens was detected on the following day by incubating with biotinylated anti-human IgE monoclonal antibody (1:250 v/v in PBS) for 2 hours at room temperature, followed by avidin-alkaline phosphatase (1:1000 v/v in PBS). Microtiter plates were washed with 0.05% PBS-T between each step. Finally, 100 µl of 4-Nitrophenyl phosphate disodium salt dissolved in alkaline phosphatase buffer was added as substrate and absorbance measurements were read at 405 nm. Percentage inhibition of IgE binding to each of the allergens was calculated as follows, relative the negative control BSA: Percentage of inhibition of IgE binding = 100 – (ODA / ODBSA) X 100. ODA and ODBSA represent the optical density after pre-incubation with allergens and BSA, respectively. 2.6.2 ELISA for the quantification of serum specific IgG Rabbit or mice IgG responses against their immunogens were determined using direct ELISA. The binding of IgG antibodies to individual allergens nDer p 1, Der p 2, Der p 5 or Der p 7 were determined using the same assay. Antigens were coated at 250 ng per well onto Maxisorp plates (NUNC, Denmark) at 4˚C overnight. The plates were blocked with 0.1% PBS-Tween 20 for one hour at room temperature. Rabbit or mice antisera were serially diluted in PBS and incubated with the coated antigens for 2.5 hours at room temperature. Bound rabbit and mice IgG antibodies were detected using 38 alkaline phosphatase conjugated anti-rabbit IgG and anti-mouse IgG antibodies, respectitvely. Microtiter plates were washed with 0.05% PBS-Tween 20 between each step. 4-Nitrophenyl phosphate disodium salt dissolved in alkaline phosphatase buffer was added as substrate and absorbance measurements were read at 405 nm. 2.6.3 Inhibition of human IgE binding by specific IgG antibodies Allergens native Der p 1 (Indoor Biotechnologies) or purified recombinant Der p 2, Der p 5 and Der p 7 were coated at 250 ng per well onto Maxisorp ELISA plates (NUNC, Denmark) at 4˚C overnight. Plates were blocked with 0.1% PBS-T for 1 hour at room temperature the following day and incubated with 100 µl of rabbit or mouse serum serially diluted in PBS for 2.5 hours at room temperature. 50 µl of PBS-diluted human sera was then added to the wells and incubated at 4˚C overnight. Human IgE bound to the coated allergens were detected by incubating with biotinylated anti-human IgE monoclonal antibody (BD-Pharmingen, USA) (1:250 v/v in PBS) for 2 hours, and then with avidin conjugated alkaline phosphatase (1:1000 v/v in PBS) for another 30 minutes. Microtiter plates were washed with 0.05% PBS-T between each step. 4-Nitrophenyl phosphate disodium salt dissolved in alkaline phosphatase buffer was added as substrate and absorbance measurements were read at 405 nm. 39 All experiments were carried out in duplicates and results were reported as mean values. Percentage of inhibition of human IgE binding was determined with the following formula: % inhibition of IgE binding = 100 – (ODI/ODC) X 100, where ODI represents the absorbance value after pre-incubation with serum from immunized rabbit or mouse sera and ODC represents that of control respectively. 40 3 Results 3.1 Genetic engineering of hybrids containing the major mite allergens of Dermatophagoides pteronyssinus As Der p 1, Der p 2, Der p 5 and Der p 7 were determined to be the important allergens of Dermatophagoides pteronyssinus, the cDNA clones of the individual allergens in pET32 vectors (5917 bp) were used to engineer hybrids comprising them. These clones were derived previously using the Expressed Sequence Tag (EST approach. A cDNA library generated for D. pteronyssinus was sequenced for identification of allergens through homology searches (Table 5). All sequences returned alignments with 99-100% sequence identity with published sequences of D. pteronyssinus allergens. Allergen Accession No % Identity (E-value) Reference Der p 1 Der p 2 Der p 5 Der p 7 P08176 P49278 P14004 P49273 100% (0.0) 100% (1e-79) 100% (4e-69) 100% (2e-120) Chua et al., 1993 Chua et al., 1990 Lin et al., 1994 Shen et al., 1993 Table 5. Sequence homology of cDNA clones to published allergen sequences. Sequences of clones encoding cDNA of Der p 1, Der p 2, Der p 5 and Der p 7 were searched against a non-redundant protein sequence database at the site for the National Center for Biotechnology Information (NCBI). Amongst the returned result, only the highest scoring alignment with the lowest expectation value score is shown with the corresponding accession number of the published sequence. 41 Clones identified to encode allergens were then sub-cloned into pET32 vectors with the signal peptides, as predicted using SignalP software (SignalP 3.0, Center for Biological Sequence Analysis, TUD), deleted from the open reading frames. These were then used for the construction of the hybrids. A schematic diagram showing the cloning strategy is shown in Figure 2. Allergen A Allergen B PCR Amplification PNK P P Ligation DpnI Hybrid B-A Figure 2. Genetic engineering of hybrids containing the major mite allergens of Dermatophagoides pteronyssinus. The cDNAs of allergens Der p 1, Der p 2, Der p 5 and Der p 7 were genetically combined, two at a time, into a hybrid construct. Allergen A and Allergen B denote any two allergens involved in each combination. PNK, polynucleotide kinase; dpnI, exonuclease that digests methylated DNA. 42 Combining two allergens at a time, a long range DNA polymerase was used to amplify the cDNA sequence encoding one allergen (Allergen A). The cDNA clone of another (Allergen B) was linearized by amplifying the entire length of the plasmid (Figure 2), with the deletion of its stop codon during the amplification. Polynucleotide kinase incorporated an inorganic phosphate to the 5’ ends of the PCR products of amplified allergen A to allow for ligation subsequently. This, however, was not done to the linearized allergen B plasmid to prevent its re-ligation into the original cDNA clone, which, when transformed into competent cells, would grow on the selective media alongside cells transformed with successfully constructed hybrids. Instead, restriction exonuclease DpnI was added to the PCR products of allergen B to digest the parental plasmids, as the intact plasmids have enhanced transformation efficiency and may therefore potentially reduce the transformation of successfully ligated hybrids. Following their respective treatment with PNK and DpnI, products from PCR amplification of allergen A and allergen B were purified, ligated, transformed into Escherichia coli (XL1-Blue strain) competent cells and grown on selective media containing ampicillin. Colonies obtained following transformation were inoculated into liquid media and the plasmids were extracted thereafter (Figure 3). The open reading frames of the 43 hybrids were sequenced to ensure that the component allergens had been linked together in the right reading frame. Two successfully ligated hybrids were obtained, Der p 1-2 and Der p 7-5. Der p 1-2 had a length of 1320 bp while Der p 7-5 was 960 bp. The extracted hybrid plasmid was then transformed into E. coli (BL21 strain) for protein expression. Marker Der p 1-2 Der p 7-5 8000 6000 Figure 3. Two successfully engineered hybrid constructs, Der p 1-2 and Der p 7-5. Extracted plasmids of Der p 1-2 and Der p 7-5 were extracted and subsequently sequenced. Der p 1-2 had a length of 1320 bp while Der p 7-5 was 960 bp. Consequently, the estimated sizes of their plasmids were approximately 7.2 kbp and 6.8 kbp. Lane 1, 1 kb DNA ladder; Lane 2, Der p 1-2 plasmid; Lane 3, Der p 7-5 plasmid. 44 3.2 Expression and purification of hybrids in Escherichia coli (BL21 strain). 3.2.1 Expression and purification of Der p 1-2 Der p 1-2 was a 439 amino-acid long peptide that contained a six-histidine protein purification tag at the N terminal, followed by the mature Der p 1 sequence and mature Der p 2 (Figure 4A). It had a theoretical isoelectric point (pI) of 6.02 and a predicted molecular weight of 49316.42 Da (ExPASy proteomics server, Swiss Institute of Bioinformatics). A. 1 21 41 61 81 101 121 141 161 181 201 221 241 261 281 301 321 341 361 381 401 421 B. MDHHHHHHRP KAFNKSYATF LESVKYVQSN SLDEFKNRFL TQFDLNAETN EIDLRQMRTV SCWAFSGVAA QSLDLAEQEL GDTIPRGIEY YYRYVAREQS ISNYCQIYPP QTHSAIAVII YDGRTIIQRD NIVGYSNAQG DTNWGDNGYG IEEYPYVVIL HEIKKVLVPG RGKPFQLEAV KIEIKASIDG NACHYMKCPL TWNVPKIAPK MGDDGVLACA SSIKTFEEYK EDEEAARKNF GGAINHLSDL MSAEAFEHLK ACSINGNAPA TPIRMQGGCG TESAYLAYRN VDCASQHGCH IQHNGVVQES CRRPNAQRFG NVNKIREALA GIKDLDAFRH NGYQPNYHAV VDYWIVRNSW YFAANIDLMM DQVDVKDCAN CHGSEPCIIH FEANQNTKTA LEVDVPGIDP VKGQQYDIKY SENVVVTVKV IATHAKIRD* 20 40 60 80 100 120 140 160 180 200 220 240 260 280 300 320 340 360 380 400 420 439 45 Figure 4. Expression of Der p 1-2. (A) Successfully cloned Der p 1-2 contained a six-histidine purification tag, the mature Der p 1 protein (green) and mature Der p 2 (blue). The construct was transformed and expressed in E. coli (BL21); and (B) purified in 0M urea (lane 2), 4M urea (lane 3) and 8M (lane 4). Marker (lane 1). 45 Der p 1-2 was expressed with low yield under non-denaturing conditions (Figure 4B). However, increasing the concentration of the urea denaturant increased the yield correspondingly. The observed molecular weight of Der p 1-2 on SDS-PAGE is approximately 45 kDa. 3.2.2 Expression and purification of Der p 7-5 Der p 7-5 was a 319 amino-acid long peptide that contained a six-histidine purification tag at the N terminal, followed by mature Der p 7 sequence and then the mature Der p 5 (Figure 5A). Its theoretical isoelectric point (pI) was 5.18 and the molecular weight was predicted to be 36817.00 Da (ExPASy proteomics server, Swiss Institute of Bioinformatics). Like Der p 1-2, expressed Der p 7-5 was contained mainly within inclusion bodies. It had an observed molecular weight of slightly less than 45 kDa on SDS-PAGE (Figure 5B). A. 1 21 41 61 81 101 121 141 161 181 201 221 241 261 281 301 MDHHHHHHDP NKAVDEAVAA KVPDHSDKFE ELDMRNIQVR ANVKSEDGVV DVVSMEYDLA HVISDIQDFV GNMTLTSFEV GGLSILDPIF FQDTVRAEMT LERNNQEDKK LMERIHEQIK EQINHFEEKP EMDTIIAMID QRKDLDIFEQ DILERDLKKE IHYDKITEEI IEKSETFDPM RHIGIIDLKG GLKQMKRVGD KAHLLVGVHD YKLGDLHPNT VELSLEVSEE RQFANVVNHI AVLSDVLTAI KVLAPAFKKE HDYQNEFDFL KGELALFYLQ TKEMKDKIVA GVRGVLDRLM YNLEMAKKSG EARVKKIEV* 20 40 60 80 100 120 140 160 180 200 220 240 260 280 300 319 B. 45 Figure 5. Expression of Der p 7-5. (A) Der p 7-5 contained a His-purification tag, Der p 7 (red) and Der p 5 (brown). The construct was transformed and expressed in E. coli (BL21); and (B) purified in 8M urea (lane 2). Marker (lane 1). 46 3.3 Hybrids have reduced IgE binding To evaluate the IgE binding capacities of the hybrids, the hybrids were pre-incubated in various concentrations with human sera that had been shown to be sensitized to the individual Der p 1, Der p 2, Der p 5 and Der p 7 allergens, before allowing the human sera to bind to the individual allergens coated on ELISA plates. Levels of human IgE bound onto the coated allergens were then measured. Hybrid proteins that bound human IgE act as inhibitors, reducing the level of unbound IgE that could therefore bind to the coated allergens. Consequently, levels of inhibition reflect the IgE binding capacities. The percentages of inhibition were calculated relative to a non-binding negative protein control, BSA, to eliminate the effects of steric hindrance. Percentages of inhibition obtained with Der p 1-2 or Der p 7-5 as the inhibitor were compared to that with the individual allergens performed in the same assay. 47 Inhibition of Human IgE binding to Der p 5 by Der p 5 and Hybrid Der p 7-5 100 % Inhibition 80 60 40 Der p 5 20 0.1 0.01 0.001 BSA 0.0001 0 Der p 7-5 Inhibitor Concentration (µg/ml) Figure 6. Inhibition of human IgE binding to allergens by hybrid proteins. ELISA inhibition assays were performed where human sera sensitized to Der p 1, Der p 2, Der p 5 or Der p 7 were preincubated with various concentration of hybrids or allergens (self) or BSA (negative control) as inhibitors, before being tested for the level of allergen-specific IgE. Levels of inhibition were expressed as percentages relative to negative control BSA. A representative inhibition curve for all four assays is shown. Typically, high levels of inhibition can be obtained at a low concentration of the self inhibitor (individual allergen) (Figure 6). On the other hand, a higher concentration of hybrids was needed to observe a small increase in the percentage inhibition. For instance, 0.25 µg/ml of Der p 7-5 was needed to elicit an inhibition of 7%. In contrast, 0.025 µg/ml of Der p 7 alone was able to cause an inhibition of 29%. A representative inhibition curve for all four assays is shown in Figure 6. 48 Percentage Inhibition of the Binding of Human Serum IgE to A. % Inhibition native Der p 1 100 80 80 60 60 40 40 20 20 0 0 native Der p 1 B. % Inhibition Der p 2 100 Der p 1-2 Der p 2 Der p 5 Der p 7 100 100 80 80 60 60 40 40 20 20 0 Der p 1-2 0 Der p 5 Der p 7-5 Der p 7 Der p 7-5 Inhibitor Figure 7. Comparison of the inhibition capacity of hybrid proteins Der p 1-2 and Der p 7-5. Hybrid proteins were tested for their abilities to inhibit the binding of human serum IgE to individual allergens Der p 1, Der p 2, Der p 5 and Der p 7, and compared to that of the individual allergens (as self inhibitors). Indirectly, this assay measures the IgE binding capacities of (A) Der p 1-2 and (B) Der p 7-5. In comparison to the individual allergens, Der p 1-2 inhibited the binding of human IgE to native Der p 1 by 13%, as opposed to 84% inhibition with self protein, native Der p 1 (Figure 7A). The hybrid hardly inhibited Der p 2 (0.3%), in contrast to the level of inhibition (79%) elicited by the same concentration of self inhibitor Der p 2. 49 In the inhibition of human IgE binding to Der p 5, hybrid Der p 7-5 exhibited reduced inhibition (7%) compared to the Der p 5 allergen (65%) (Figure 7B). Der p 7-5 inhibited IgE binding to Der p 7 by 44% while Der p 7 inhibited to a level of 69%. Taken together, both hybrids Der p 1-2 and Der p 7-5 had reduced capacity to inhibit the binding of human IgE to their component allergens. Correspondingly, the implication was that both hybrids had lower IgE binding capacity to each of their component allergens. 3.4 Hybrids Induce Blocking IgG antibodies 3.4.1 Hybrids Der p 1-2 and Der p 7-5 Induce IgG response in Rabbits To determine if the hybrids were capable of inducing IgG responses in vivo, New Zealand White (NZW) rabbits were immunized with either Der p 1-2, Der p 7-5 or protein buffer (control) once every two weeks. Rabbit sera were collected during each immunization. The levels of hybrid-specific rabbit IgG was determined in an ELISA binding assay where diluted rabbit sera in various concentrations were incubated with the respective hybrids. Binding was detected using anti-rabbit IgG and the level of which was reflected in the optical density (OD) readings. 50 Induction of IgG response in DP12A following immunization with Der p 1-2 4 OD 3 2 Pre-Immunization 1st Immunization 1 1st Booster 2nd Booster 0 0.0001 0.001 Rabbit Serum Concentration (v/v) Figure 8. Representative profile of IgG antibodies induction in rabbits with hybrid immunization. New Zealand White rabbits were immunized with Der p 1-2 or Der p 7-5 once every 2 weeks. Rabbit antisera was collected at every immunization and tested, in various dilutions, for binding to the respective immunogens, Der p 1-2 or Der p 7-5. Levels of rabbit IgG specific for the hybrids were determined using anti-rabbit IgG antibodies. Figure 8 shows the level of Der p 1-2 specific IgG in sera collected from one rabbit, DP12A, in response to immunization with hybrid Der p 1-2. IgG antibodies from sera collected following the first immunization, first and second booster injections bound to coated Der p 1-2 in a dose dependent manner. In contrast, no binding was detected with the pre-immunization sera. Comparing the levels of IgG between the sera collected at different times during the immunization scheme, Der p 1-2 specific IgG antibodies increased with each immunization or booster, until the second booster, which did not drastically increase 51 the level of IgG. At this point, the maximal inducible IgG response was considered to be achieved. Similar assays performed with sera from all other Der p 1-2 immunized or Der p 7-5 immunized rabbits showed the same profile of IgG induction. In rabbits that were immunized with Der p 1-2, maximal IgG induction was attained following two immunizations. The second booster did not increase IgG levels drastically. For immunization with Der p 7-5, maximal induction was obtained after three doses. However, one of the Der p 7-5 immunized rabbits, DP75F, became sick following the first immunization and was culled after the first booster. All other rabbits were culled when the maximal inducible IgG was reached. The hybrid proteins had been injected into groups of three rabbits during the immunization. Disregarding the death of one rabbit from the Der p 1-2 group, the hybrid had induced IgG responses in both the remaining rabbits, DP12A and DP12B (Figure 9A). Similarly, Der p 7-5 induced IgG responses in all three rabbits that had been immunized with the hybrid (Figure 9B). 52 A. Binding of Der p 1-2 Induced B. Binding of Der p 7-5 Induced Rabbit IgG to Der p 1-2 4 Rabbit IgG to Der p 7-5 4 PostImmunization Sera 3 OD 3 OD PostImmunization Sera 2 DP12A DP12B Pre- 1 Immunization Sera 0 0.0001 0.001 Rabbit Serum Concentration (v/v) 2 DP75D DP75E DP75F 1 0 0.0001 PreImmunization Sera 0.001 Rabbit Serum Concentration (v/v) Figure 9. Hybrids induced IgG antibodies in all immunized rabbits. (A) Two rabbits immunized with Der p 1-2 had IgG antibodies that bound to the hybrid coated on an ELISA plate. (B) Der p 7-5 also induced IgG responses in all three rabbits in the group. 3.4.2 Hybrid-induced IgG binds to individual allergens Hybrids induced rabbit IgG were tested for their ability to recognize the individual allergens of which the hybrids were composed. Rabbit antisera, diluted to varying extents, were incubated with the individual allergens coated into wells of an ELISA plate. Bound rabbit IgG were then detected and the level of binding was reflected in the OD readings. 53 Dose Dependent Binding of Rabbit Antisera to native Der p 1 B. 4 4 3 3 OD OD A. 2 1 0 Dose Dependent Binding of Rabbit Antisera to Der p 2 2 1 r r r r r r r 0 0.0001 0.001 Rabbit Serum Concentration (v/v) r Control r r r r r r r r r 0.0001 0.001 Rabbit Serum Concentration (v/v) DP12A DP12B Figure 10. Binding of Der p 1-2 induced IgG to individual allergens. Antisera from Der p 1-2 immunized rabbits, DP12A and DP12B, were tested in various dilutions for IgG binding to (A) native Der p 1 and (B) Der p 2. The two rabbits that had been immunized with hybrid Der p 1-2, DP12A and DP12B, had IgG that bound to native Der p 1 in a dose dependent manner, reaching maximal binding titer at approximately 2% v/v rabbit serum level (Figure 10A). In contrast, control rabbit that had been immunized with the protein buffer that Der p 1-2 was purified in did not exhibit any significant binding. Besides native Der p 1, the antisera from rabbits DP12A and DP12B also contained IgG antibodies that bound to the individual Der p 2 protein (Figure 10B). Control rabbit, however, did not bind have IgG induced against Der p 2. 54 A. B. Dose Dependent Binding of Rabbit Antisera to Der p 5 Dose Dependent Binding of Rabbit Antisera to Der p 7 4 4 3 3 OD OD ² 2 ² ² ² r r ² ² ² 2 ² 1 r 1 ² 0 r 0.0001 r r r r r r r r 0 0.0001 0.001 0.01 Rabbit Serum Concentration (v/v) r Control DP75D DP75E DP75F r r r r r 0.001 0.01 Rabbit Serum Concentration (v/v) DP5 ² ² DP7 Figure 11. Binding of Der p 7-5 induced IgG to individual allergens. Antisera from Der p 7-5 immunized rabbits, DP75D, DP75E and DP75F, were tested in various dilutions for IgG binding to (C) Der p 5 and (D) Der p 7. Antisera from rabbits immunized with Der p 5 (DP5 « ) and Der p 7 (DP7 ² ) alone were included in the same assay for comparison. Antisera from the three Der p 7-5 immunized rabbits, DP75D, DP75E and DP75F were tested for binding to the component allergens Der p 5 and Der p 7 in an ELISA binding assay. For comparison purposes, two rabbits were immunized with the individual allergens, Der p 5 or Der p 7 alone, using the same immunization scheme as for hybrid Der p 7-5, where injections were given once every two weeks, until the maximal inducible IgG level was obtained. The rabbits were then culled and the antisera were similarly tested for binding to the allergens in the same assay. The IgG antibodies from DP75D, DP75E and DP75F were demonstrated to bind to Der p 5 (Figure 11A). The level of binding increased as the level of rabbit serum 55 (v/v) increased, until a maximal binding titer was obtained at approximately 2% v/v. A similar binding profile was obtained with the IgG that was induced against Der p 5 allergen alone. IgG antibodies from the same Der p 7-5 immunized rabbits bound to Der p 7 as well (Figure 11B). Maximal binding titer for DP75D and DP75E was about 2% v/v while that for DP75F was slightly higher at 8% v/v. Binding profile of the IgG induced by Der p 7 immunization was comparable to that of DP75F. 3.4.3 Hybrid induced IgG inhibits the binding of human IgE to the individual allergens Having shown that hybrid-induced rabbit IgG could bind to component allergens of the corresponding hybrid (Figure 10 and 11), an inhibition assay was performed to further determine if the IgG could inhibit the binding of human IgE to the allergens. Briefly, allergens were coated onto ELISA plates and incubated with rabbit antisera in various dilutions. Following that, the plates were washed and thereafter incubated with human sera that had been tested to be positively sensitized to the specific allergens. Binding of human serum IgE to the allergens was then detected using anti-human IgE antibodies. 56 Evident from the binding assays performed earlier (Figure 10 and 11), unspecific binding of the antisera to coated allergens could occur at high antiserum levels (control serum). This could, in turn, sterically hinder the binding of human IgE to the coated allergens, thus resulting in apparent inhibition even in the absence of allergen-specific IgG. To eliminate the effects of unspecific steric hindrance, the level of inhibition obtained with each rabbit serum was expressed as a percentage relative to the control rabbit. Each of the two rabbit antisera from immunization with Der p 1-2 inhibited the binding of IgE from human serum 1 to native Der p 1 up to a maximal inhibition level was achieved at about 63-71% (Figure 12A). The same antisera could also inhibit the binding of IgE from human serum 2 to correctly folded Der p 2 in a dose dependent manner (Figure 12B). However, percentages of inhibition obtained with the group two assay were only 29-49% at the higheset level of rabbit antiserum (v/v) tested. 57 A. Inhibition of Binding of Human Serum 1 IgE to Native Der p 1 100 % Inhibition 80 60 40 20 0 r r r r 0.1 Rabbit Serum Concentration (v/v) B. Inhibition of Binding of Human Serum 2 IgE to Der p 2 100 % Inhibition 80 60 40 20 r 0 r r r r 0.1 Rabbit Serum Concentration (v/v) r Control DP12A DP12B Figure 12. Inhibition of human IgE binding to native Der p 1 and Der p 2 by Der p 1-2 immunized rabbit antisera. Capacity of hybrid induced IgG to inhibit IgE binding to (A) native Der p 1 and (B) Der p 2 was tested in an inhibition ELISA assay using serial dilutions of the rabbit antisera. Percentages of inhibition were expressed relative to control rabbit. Antisera from all the three rabbits immunized with Der p 7-5 inhibited IgE binding to Der p 5 by levels as high as 63-81%, at the highest rabbit antiserum 58 concentration tested (10% v/v). At the same level of antiserum, Der p 5 immunized antiserum inhibited maximally at 76% (Figure 13A). A. Inhibition of Binding of Human Serum 3 IgE to Der p 5 100 % Inhibition 80 60 40 20 r 0 r r r r 0.01 0.1 Rabbit Serum Concentration (v/v) B. Inhibition of Binding of Human Serum 4 IgE to Der p 7 100 ² 80 ² 60 ² ² 40 20 r 0 r r r 0.01 0.05 Rabbit Serum Concentration (v/v) r Control DP75D DP5 DP75E ² DP7 DP75F Figure 13. Inhibition of human IgE binding to Der p 5 and Der p 7 by Der p 7-5 immunized rabbit antisera. Capacity of hybrid induced IgG to inhibit IgE binding to (A) Der p 5 and (B) Der p 7 was tested in an inhibition ELISA assay using serial dilutions of the rabbit antisera. Percentages of inhibition were expressed relative to control rabbit. Inhibitions due to IgG induced by individual allergens Der p 5 or Der p 7 alone were included for comparison purposes. 59 The same antisera inhibited IgE binding to Der p 7 in a dose dependent manner (Figure 13B). Limited by the volume of human sera available, the highest level of antisera concentration tested was 5% v/v. Nonetheless, Der p 7-5 immunized antisera inhibited by 86-92%, while that obtained with rabbit immunized with Der p 7 alone was 87%. 3.5 Comparison of individual Der p 1 and hybrid Der p 1-2 as potential vaccines To compare the effect of incorporating a single allergen into a hybrid, recombinant Der p 1, similarly expressed under denaturing conditions as with Der p 1-2, was injected into a NZW rabbit once every two weeks, using the same immunization scheme as that for Der p 1-2. 3.5.1 Recombinant Der p 1 induced IgG in rabbits that bound the native protein and blocked the binding of human IgE to the allergen. Immunization with recombinant Der p 1 induced IgG antibodies that could recognize and bind to the native protein in an ELISA assay, in contrast to that of control rabbit (Figure 14A). However, the IgG response was lower than that induced by immunization with Der p 1-2. 60 A. Dose Dependent Binding of Rabbit Antisera to native Der p 1 4 OD 3 2 1 0 r r r r r r r 0.00025 0.001 0.004 0.004 Rabbit Serum Concentration (v/v) B. Dose Dependent Inhibition of the Binding of Human Serum 1 IgE to Native Der p 1 100 % Inhibition 80 60 40 20 0 r 0.016 r r r r 0.032 0.05 0.1 Rabbit Serum Concentration (v/v) Control rDP1 DP12A DP12B Figure 14. Comparison of IgG antibodies induced by recombinant Der p 1 and Der p 1-2. Rabbits immunized with the recombinant form of Der p 1 ( « ) had induced IgG that could (A) bind to native Der p 1 and (B) inhibit the binding of human serum IgE to the allergen, in a dose dependent manner. Further, antiserum from Der p 1 immunized rabbit inhibited the binding of IgE from Der p 1-sensitized human serum in a dose dependent manner, albeit by a small percentage (14%) (Figure 14B). 61 3.5.2 IgG antibodies induced by recombinant Der p 1 had reduced IgE blocking capacity in contrast to IgG antibodies induced by hybrid Der p 1-2 To validate if Der p 1 induced IgG antibodies consistently blocked IgE binding to a smaller extent as compared to the hybrid, an additional inhibition assay was performed with a different human serum and at the antiserum concentration where maximal inhibition was achieved (Figure 14B). The levels of inhibition obtained with the two immunogens were then compared (Figure 15). Comparison of the Percentage Inhibition of IgE binding to native Der p 1 Human Serum 5 80 80 40 0 D P1 2 D P1 2 1 D er p C on Rabbit C on tr ol D er p 1 0 B 20 A 20 D P1 2B 40 60 2A 60 D P1 % Inhibition 100 tr ol % Inhibition Human Serum 1 100 Rabbit Figure 15. Comparison of Der p 1 and Der p 1-2 as immunogens for induction of blocking IgG. Der p 1 and Der p 1-2 were used to immunized NZW rabbits and the levels of inhibition obtained by the corresponding IgG induced were compared rabbit antiserum concentration of 5% v/v. 62 In both human sera tested, each of the rabbits immunized with Der p 1-2 exhibited higher levels of inhibition as opposed to that achieved with Der p 1 alone. With human serum 1, Der p 1 immunized antiserum inhibited to 14% while Der p 1-2 immunized antisera inhibited by 63-71%. In the assay performed with human serum 5, Der p 1 immunized antiserum failed to inhibit human IgE binding to native Der p 1. In contrast, hybrid-immunized DP12A and DP12B inhibited by 31-33% (Figure 15). Binding of Rabbit Antisera to Native Der p 1 at blocking dilution 4 OD 3 2 1 Rabbit P1 2B D rD P1 D P1 2A C on tr ol 0 Figure 16. Binding of rabbit IgG to native Der p 1 at 0.05 v/v. At the same antiserum concentration where Der p 1 and Der p 1-2 showed distinct difference in their capacity to induce blocking IgG, the binding of IgG antibodies induced by both proteins to native Der p 1 was found to be comparable (Figure 16). 63 3.6 Importance of conformation on generation of allergy vaccine 3.6.1 Recombinant Der p 1 induces IgG that bind to Native Protein To determine the importance of maintaining conformation in an allergy vaccine, groups of BALB/c mice were immunized once every two weeks with native Der p 1 (nDer p 1), recombinant Der p 1 (rDer p 1) expressed in denaturing conditions or with the protein buffer as control. All mice immunized with nDer p 1 and rDer p 1 had IgG antibodies that bound to the native protein (Figure 17). Binding of Mice Antisera to Native Der p 1 4 3 OD Control Pre-Immunization Control Post-Immunization 2 nDP1 Pre-Immunization nDP1 Post-Immunization 1 rDP1 Pre-Immunization rDP1 Post Immunization 0 0.0001 0.001 0.01 Mice Serum Concentration (v/v) Figure 17. Induction of IgG in BALB/c mice following immunization with native Der p 1 and recombinant Der p 1. Groups of BALB/c mice were immunized once every two weeks with native Der p 1, recombinant Der p 1 expressed in denaturing conditions or protein buffer (control). Pre- and post-immunization mice sera were incubated, at various dilutions, with coated native Der p 1 on ELISA plates. Binding of mice IgG to the native protein was detected using anti-mice IgG antibodies. Figure shows a representative profile of mice from all three groups. OD readings reflect the extent of binding by mice IgG. 64 All sera collected from before the immunization did not exhibit binding at all tested levels of mice serum (Figure 17), suggesting that the binding activity observed was attributed to IgG that had been induced in response to the immunization. 3.6.2 Recombinant Der p 1 induced IgG inhibited the binding of human IgE to native Der p 1 Dose Dependent Inhibition of the Binding of Human Serum IgE to native Der p 1 100 Control nDP1A % Inhibition 80 nDP1B nDP1C 60 rDP1A 40 rDP1B rDP1C 20 0 0.005 0.02 0.08 Mice Serum Concentration (v/v) Figure 18. Dose dependent inhibition of human IgE binding to native Der p 1 by mice antisera. Antisera of immunized mice were tested for the ability to inhibit the binding of human IgE to native Der p 1. Different concentrations (v/v) of mice sera were incubated with coated nDer p 1 before incubation with human serum. Finally bound human IgE was detected using anti-human IgE antibodies. Inhibition was expressed as a percentage relative to control rabbit. The ability of the induced IgG to inhibit the binding of human IgE to nDer p 1 was tested in an inhibition ELISA assay. Percentages of inhibition were expressed relative to the control mice, to eliminate the effects steric hindrance. As seen from 65 Figure 18, all the antisera from nDer p 1 immunization (nDP1A, nDP1B, nDP1C) inhibited IgE binding to nDer p 1 by 39-73%, reaching maximal inhibition at mice antiserum concentration of approximately 8% v/v. Recombinant immunized mice antisera (rDP1A, rDP1B, rDP1C) similarly inhibited IgE in a dose dependent manner (Figure 18). 3.6.3 IgG antibodies induced by recombinant Der p 1 showed reduced capacity to block IgE in comparison to IgG antibodies induced by native Der p 1 To compare the levels of inhibition attained with both groups of mice, inhibition assays were performed with a total of three individual and one pooled human sera. As maximal inhibition was obtained at 8% v/v mice serum concentration (Figure 18), all the four assays were performed using mice serum at this concentration. Native-immunized mice antisera consistently displayed higher percentage of inhibition than rDer p 1-immunized antisera in all three assays tested (Figure 19). 66 Percentage Inhibition of the Binding of human serum IgE to native Der p 1 rDP1C rDP1A nDP1B rDP1B rDP1C rDP1B 0 rDP1A 0 nDP1D 20 Control 20 rDP1C 40 rDP1B 40 rDP1A 60 nDP1C 60 nDP1B 80 nDP1A 80 Control Pooled Sera 100 nDP1C Human Serum 8 nDP1A 0 nDP1B 0 Control 20 Human Serum 7 nDP1A 20 rDP1C 40 rDP1B 40 rDP1A 60 nDP1C 60 nDP1B 80 nDP1-A 80 100 % Inhibition 100 Human Serum 6 Control % Inhibition 100 Rabbit Antisera Figure 19. Inhibition of the binding of human IgE to native Der p 1. Inhibition ELISA assays were performed at the same mice serum concentration (8% v/v) using three individual human sera and one pooled human sera. Levels of inhibition were expressed as a percentage of the control. Black bars (n) represent antisera of mice that had been immunized with native Der p 1. Unshaded bars (o) represent antisera from mice immunized with the recombinant. 67 A binding assay performed at the mice serum concentration used for the inhibitions demonstrated that all native and recombinant induced IgG bound the nDer p 1 at comparable levels (Figure 20). Binding of Mice Antisera to native Der p 1 at Mice Blocking Concentration 4 2 Pre-Immunization 0 recombinant Der p 1 immunized antisera rDP1A rDP1B rDP1C native Der p 1 immunized antisera nDP1A nDP1B nDP1C nDP1D 1 Control OD 3 Control Mice Antisera Figure 20. Binding levels of mice sera at 8% v/v mice serum concentration. 68 4 Discussion 4.1 Hybrids for house dust mite allergens of Dermatophagoides pteronyssinus Many allergen sources are complex, comprising several immunologically unrelated allergens. Often, patients are sensitized to more than one allergen from the source (Linhart and Valenta, 2004). Natural extracts allow for immunotherapy against all allergens to which patients are sensitized. However, the presence of other allergens in the extract had been shown to result in new sensitizations during the course of therapy (van Hage-Hamsten and Valenta, 2002). At the same time, as natural extracts have variable compositions, this may lead to under representation of allergens to which patients may be allergic. The combination of allergens into a single recombinant hybrid protein as allergy vaccine similarly allows for simultaneous therapy against allergies caused by several allergens. The capacity to be expressed and purified in defined composition, however, addresses the issues of allergen under-representation. Currently, the hybrid approach has only been studied in wasp and bee venom allergy and grass and weed pollen allergy (Table 2). This study aims to generate hybrids that combine allergens from house dust mite, Dermatophagoides pteronyssinus, a 69 clinically important allergy-causing mite species worldwide. It is unnecessary to include all allergens from the mite into the hybrids. Therefore, on the basis of high frequencies of sensitization, the major D. pteronyssinus allergens Der p 1, Der p 2, Der p 5 and Der p 7 were selected for incorporation. The cDNA clones were PCR-amplified and ligated in various ways to generate hybrids comprising of two allergens joined together. 4.2 Genetic engineering of hybrids containing major mite allergens of Dermatophagoides pteronyssinus and expression in Escherichia coli cDNA clones encoding the individual allergens, mature Der p 1, Der p 2, Der p 5 and Der p 7, were used in the genetic engineering of the D. pteronyssinus hybrids. They were previously generated using the expressed sequence tag (EST) approach and sub-cloned into pET32 vectors, during which signal peptides were deleted, ensuring the expression of only the mature form of the allergens, to which patients are exposed. The allergens were incorporated, two at a time, into the hybrids. The strategy employed in the genetic engineering of the hybrids utilized the polymerase chain reaction for the amplification of one allergen while linearizing another, before their ligation in a blunt end manner (Figure 2). In contrast to conventional restriction-type cloning, this approach bypassed the requirement for the presence of restriction sites at 70 the cDNA-vector sites in the clones; allows the allergens to be linked in series without the insertion of additional foreign amino acids between the allergens; and permitted the deletion of the stop codon at the 3’ end of the first allergen in the same step. In this study, two hybrids were successfully constructed. Der p 1-2 was composed of Der p 1 and Der p 2 while Der p 7-5 comprised Der p 7 and Der p 5, in that order. No foreign amino acids were inserted in between the two components of the hybrids and a six-histidine protein purification tag in the N terminal facilitated protein purification using a Nickel column (Figure 4A and 5A). Although the construction of hybrids with the component allergens in the reverse order had been unsuccessful, Linhart et al. had demonstrated that the sequence of the allergens did not matter in the generation of hybrid vaccines for immunotherapy (Linhart et al., 2002). Both hybrids were expressed in E. coli (BL21) competent cells and found to be contained within inclusion bodies, despite adjustments such as lowering the culture temperature during induction. When purified in non-denaturing buffer, low yields of protein were obtained (Figure 4B). The yield, however, increased with the addition of increasing concentration of urea, a protein denaturant (Figure 4B), suggesting that the proteins were largely insoluble. However, lack of conformation does not render a protein incapable as a vaccine. In fact, fragments of cow dander allergen Bos d 2 (Zeiler et al., 1997), grass pollen 71 allergen Bet v 1 (Vrtala et al., 1997; van Hage-Hamsten et al., 1999); and short synthetic peptides of Phl p 1 (Focke et al., 2001) and Phl p 7 (Westritschnig et al., 2004) had been proposed as vaccine candidates for immunotherapy, despite the apparent loss of three dimensional structure as detected from circular dichroism spectra. These peptides retained the capacity to stimulate allergen-specific T cells proliferation, as the linear T cell epitopes of the allergens were preserved independent of spatial conformation. Synthetic peptides of Phl p 1, Phl p 7 and two structural mutants of carrot allergen Dau c 1, Dau c 1.01 and Dau c 1.02 (Focke et al., 2001; Westritschnig et al., 2004; Reese et al., 2007) were demonstrated to able to induce IgG antibodies in mice or rabbits which could inhibit the binding of patient serum IgE to the wildtype allergen. A consistent observation for all allergen derivatives with disrupted three dimensional structures was a reduction in allergenicity, whether measured in vitro by the determination of specific IgE levels, inhibition assays, histamine release, cell degranulation or in vivo using skin prick tests. Interestingly, the degree of conformational change elicited in dust mite allergen Der f 2 had been demonstrated to correlate with the degree of reduction in allergenic activities (Takai et al., 2000). As discussed, partial loss or even complete disruption of conformation may not diminish the capacity of an antigen to be a potential vaccine. Since the hybrids could 72 not be purified in significant yield unless under denaturing conditions, and in view of the above reasons, Der p 1-2 and Der p 7-5 were expressed in denaturing conditions in this study and assessed for their potential as vaccines for D. pteronyssinus-associated allergies. 4.3 Evaluation of Der p 1-2 and Der p 7-5 as potential vaccines 4.3.1 Hybrids Der p 1-2 and Der p 7-5 have reduced IgE binding One of the many shortcomings of natural extracts is the occurrence of side effects such as local or even systemic anaphylaxis during the immunotherapy as a result of the binding of administered vaccines to specific IgE in vivo during vaccination. To overcome this, hypoallergens have been proposed as vaccines instead. These modified allergens have reduced allergenicity and are unable to bind IgE in vivo, thus preventing the inflammatory side effects. As Gafvelin et al. correctly summarizes, strategies to generate hypoallergens broadly involve either site directed mutagenesis of B cell epitopes (Beezhold et al., 2001; Swoboda et al., 2002 and Holm et al., 2004) or the disruption of the three dimensional structure of the allergen (Gafvelin et al., 2007). The former is a more straightforward approach. The B cell epitopes of an allergen are specific, antigenic sites on the protein that are recognized by B cell receptors or the corresponding IgE antibodies (van Regenmortel, 1996). Mutation of these sites serves to prevent the binding of human IgE to the allergens, hence generating a hypoallergen with reduced 73 allergenicity. However, this approach requires existing knowledge about the B cell epitopes of the allergen, which sometimes may not be available. For instance, of the four important D. pteronyssinus allergens, no literature has as yet done any epitope mapping for Der p 5 and Der p 7. Epitopes are classified as linear (continuous) or conformational (discontinuous), depending on whether the residues involved are contiguous in sequence or brought into spatial proximity by conformational protein folding (Stern, 1991). The latter approach exerts the hypoallergenic effects more specifically through disruption of conformational B cell epitopes. In addition, since the primary structure of the allergens remains intact, thus linear T cell epitopes that are necessary for antigenicity are retained. The approach is particularly suitable for allergens where conformational epitopes predominate human IgE sensitization, like Der p 1 and Der p 2, and where a detailed epitope map is not available. In this study, hybrids Der p 1-2 and Der p 7-5 had been expressed and purified under denaturing conditions and therefore presumed to have lost their overall three dimensional structures. To evaluate if they had reduced IgE binding activity as compared to the component allergens, inhibition assays as described in Section 2.6.1 were performed. 74 It has to be noted that, as the hybrids comprised two allergens, the use of the inhibition assay was necessary in determining the level of IgE binding to each of the component allergens. In contrast, the use of direct IgE binding ELISA would be complicated by the possibility that the human sera contained IgE against both components or any other cross-reacting epitopes. Human sera that were tested to be sensitized to the allergens were allowed to bind to the allergens in the presence of inhibitors such as the individual allergens (self inhibition), the hybrid proteins and BSA (negative control). As the proteins had to bind to serum IgE in order to inhibit, the level of inhibition is an indirect measure of the IgE binding activity. The levels of inhibition obtained with the hybrid proteins were low but increased at high concentrations of the inhibitors (Figure 6). With the effects of steric hindrance eliminated through expression of the inhibition levels relative to the negative control BSA, the increasing levels of inhibition observed with increasing concentrations of hybrid inhibitors suggested that the hybrids contained some IgE epitopes that could be recognized by human serum IgE. However, at all doses tested, the levels of inhibition obtained with the hybrids were much reduced in comparison to that with individual allergens (Figure 6), 75 suggesting that the hybrids exhibited a still lower IgE binding capacity when compared to the individual allergens. From Figure 7A, Der p 1-2 had reduced IgE binding to native Der p 1 and Der p 2 allergens. This was not unexpected because patients are known to be predominantly sensitized to the conformational epitopes of each of these allergens (Greene and Thomas, 1992; Collins et al., 1996; Chua et al., 1991; van’t Hof et al., 1991). Yet these epitopes were likely to have been disrupted as a result of the effects of the urea denaturant on overall three dimensional structure and of the convalent fusion to the allergen partner. In consequence, human IgE that are mainly targeted at conformational sites would be less likely to bind to the hybrids. In the same way, Der p 7-5 was shown to have reduced IgE binding to both Der p 5 and Der p 7, in comparison to the individual allergens (Figure 7B). Interestingly, in the inhibition of binding to Der p 7, the difference in inhibition levels between Der p 7 and Der p 7-5 was notably less pronounced, as compared to that observed in all three other assays with the other allergens (Figure 7B). A possible explanation could be that the human serum could have been sensitized to more linear epitopes, therefore, despite the loss of conformation, Der p 7-5 was able to bind to human IgE and inhibit its subsequent binding to coated allergens. 76 Nonetheless, Der p 1-2 and Der p 7-5 both exhibited reduced IgE binding in vitro in comparison to their component allergens, making them suitable hypoallergenic candidate vaccines for the immunotherapy for Der p 1 and Der p 2, and Der p 5 and Der p 7 respectively. 4.3.2 Hybrids Der p 1-2 and Der p 7-5 induced IgG antibodies that bound to the individual allergens and inhibited the binding of human serum IgE to them In many studies, the ability to induce T cell proliferation and apparent reduction of in vitro or in vivo allergenicity were measures commonly used to access the potential of an allergen or its modified derivatives for use as allergy vaccines. However, while these measures promise the safety of the potential vaccine and ensure the feasibility of its use, they by no means warrant the efficacy of the candidates as vaccines. In this study, the capacity of hybrids to induce blocking IgG in vivo was included in addition to reduced allergenicity as the preliminary criteria to assess the hybrids as potentially efficacious vaccines. 77 4.3.2.1 Hybrids can induce IgG responses in vivo As potential vaccines, the hybrids should exhibit appropriate immunogenicity in vivo and be capable of raising antibodies (Stern, 1991). As seen from Figure 8, with each immunization of the hybrid proteins, the level of IgG antibodies recognizing the hybrid protein increased. Contrasted with the sera collected before immunization began, where hardly any IgG bound the coated hybrids, it is evident that the rabbits had no hybrid specific IgG antibodies prior to the immunization and therefore the hybrid specific IgG observed following the first immunization were responses induced by the immunization. Each hybrid was injected into a group of three rabbits. However, one rabbit from the Der p 1-2 group died following the first immunization. Nonetheless, Der p 1-2 was demonstrated to induce IgG antibodies in both the remaining rabbits (Figure 9A). Similarly, Der p 7-5 induced IgG antibodies in all three immunized rabbits (Figure 9B). Of note, although DP75F became sick following the first immunization and was culled soon following the administration of the first booster, its IgG titer was comparable to that attained with the other two rabbits DP75D and DP75E, for which maximal IgG was attained after administration of the second booster. 78 4.3.2.2 Hybrid-induced IgG bound to individual component allergens It is believed that the protective effect of IgG antibodies induced during immunotherapy arises through direct competition with the sensitizing IgE antibodies for the allergens (Cooke et al., 1935; Loveless, 1940; Wachholz and Durham, 2004). The IgG would have to bind to the allergen in order to exert the blocking effect. To evaluate the potential efficacy of hybrids as vaccines that induce blocking IgG, it is therefore necessary to ensure that the IgG induced by the hybrids were able to bind to the individual allergens. In a direct ELISA binding assay, Der p 1-2 induced IgG were demonstrated to bind both native Der p 1 and Der p 2 in a dose dependent manner (Figure 10). In contrast, little binding was observed with the control rabbit. Similarly, Der p 7-5 immunized rabbits had IgG antibodies that bound to both Der p 5 and Der p 7 allergens (Figure 11). It seemed, therefore, that polyclonal antibodies had been raised against the entire length of the hybrid peptide, with IgG antibodies recognizing both the component allergens. Further, the Der p 5-specific IgG responses induced by hybrid Der p 7-5 was shown to be comparable to that induced by Der p 5 alone (Figure 10). Likewise, IgG from the hybrid immunized antisera bound Der p 7 to similar extents as did the IgG raised from immunization with the individual allergen alone (Figure 11). These results suggested that Der p 7-5 possessed similar capacities as Der p 5 and Der p 7 to induce allergen-specific IgG in rabbits. 79 4.3.2.3 Hybrid-induced IgG blocks the binding of human IgE to individual allergens. While the induction of allergen-specific IgG is frequently observed with immunotherapy efficacy (Golden, 1982), the correlation is not without contend. Increased levels of allergen-specific IgG may sometimes not be observed with improved clinical outcomes (Ewan et al., 1993; Djurup et al., 1987). Moreover, there seems to be accumulating evidence that immunotherapy could alter antibody affinity and specificity (Till et al., 2004), both of which contribute to IgG blocking. Hence, it is important to measure the blocking activity, instead of the crude levels of allergen-specific IgG (Akdis and Akdis, 2007). Having established that the IgG antibodies induced by Der p 1-2 and Der p 7-5 were able to bind to the component allergens of the respective hybrids, the capacity of these IgG antibodies to block the binding of IgE to the same allergens were tested in an inhibition ELISA assay. Antisera from the two rabbits immunized with Der p 1-2 were able to inhibit the binding of human IgE to both native Der p 1 and Der p 2 in a dose dependent manner (Figure 12). Similarly, each of the antisera from rabbits immunized with Der p 7-5 blocked IgE binding by at least 63% (Figure 13). As the hybrids had been expressed and purified under denaturing conditions, it was unlikely that the repertoire of IgG thus induced recognized conformational epitopes. The observed inhibition could instead be due to IgG antibodies binding to 80 linear epitopes situated along the lengths of the hybrid peptides, which would not have been disrupted by the lack of a global conformation. 4.3.2.3.1 Blocking by Der p 1-2 induced IgG antibodies The levels of inhibition observed from the assay were dependent not only the induction of IgG antibodies in rabbits that bound the allergens, but also the type of epitopes against which the human IgE antibodies were sensitized. Both Der p 1 and Der p 2 are known to consist primarily of conformational IgE binding epitopes (Greene and Thomas, 1992; Collins et al., 1996; Chua et al., 1991; van’t Hof et al., 1991). It is therefore interesting that IgG induced by hybrid Der p 1-2 inhibited binding to native Der p 1 up to a level as high as 63% (Figure 12). Besides blocking IgE that were targeted at linear epitopes, the binding of rabbit IgG to these sites could have sterically hindered the binding of other IgE targeted at conformational epitopes that are in close proximity. Additionally, there could be rabbit IgG induced against continuous regions on the hybrids that formed part of the conformational epitopes recognized by the human serum. Although Der p 1-2 immunized antisera could inhibit IgE binding to Der p 2, the level of inhibition was only 29-49% at the highest serum concentration tested. With consideration that Der p 1-2 IgG bound the allergen well in the direct binding assay 81 (Figure 10B), the lack of blocking could reflect a difference in the epitopes recognized by rabbit antibodies and that by human IgE. This could in part be due to genetic differences or altered antigen processing between the two hosts (Chapman et al., 1987); however, a more probably cause would be the disruption of conformational epitopes in the hybrid peptide to which most Der p 2-sensitized patient IgE are directed. Alternatively, differences in the affinities of rabbit IgG and human IgE for the same epitopes (Hantusch et al., 2005) could also have contributed to low levels of inhibition. 4.3.2.3.2 Blocking by Der p 7-5 induced IgG antibodies Antisera from all three rabbits immunized with hybrid Der p 7-5 inhibited IgE binding to the component allergens Der p 5 and Der p 7, up to more than 80% (Figure 13). This could be an indication that the predominant IgE binding epitopes are linear. To date, the nature of these epitopes has yet to be elucidated, although previous studies with the Der p 5 homolog from mite Blomia tropicalis, Blo t 5, suggested that patients react mainly to linear epitopes on mite group 5 allergens (Unpublished data). Nonetheless, Der p 7-5 was able to induce IgG in vivo which could inhibit IgE binding to both component allergens in vitro. In fact, the levels of inhibition achieved with hybrid-immunization were comparable if not higher than that obtained using the single allergens as the immunogens in rabbits (Figure 13). 82 4.3.2.4 Implications on the potential of Der p 1-2 and Der p 7-5 as vaccines Taken together, results from both the binding and inhibition assays suggested that hybrid Der p 7-5 was an appropriate immunogen that not only retained similar capacity as Der p 5 and Der p 7 alone for the in vivo induction of allergen specific IgG responses; beyond this, it probably retained the same IgG epitopes inducible by the individual allergens. Furthermore, Der p 7-5 had reduced IgE binding to human IgE in as compared to the individual counterparts. As such, Der p 7-5 is a suitable vaccine candidate for immunotherapy against allergies due to Der p 5 and Der p 7 at the same time. Der p 1-2 was demonstrated to exhibit reduced IgE binding and the capacity to induce blocking IgG antibodies to both its component allergens. Although the levels of inhibition obtained with Der p 2 was, as discussed, relatively lower compared to levels obtained with hybrid IgG against other allergens, additional studies should be performed to determine if this low level of IgE blocking is sufficient to inhibit the downstream IgE mediated allergic reactions. 83 4.4 Comparison of individual Der p 1 and hybrid Der p 1-2 as potential vaccines To enable a fair assessment of the effect of incorporating the allergen into a hybrid, the recombinant form of Der p 1 (rDer p 1) was expressed and purified under the same denaturing conditions as that for hybrid Der p 1-2. It was then injected into a NZW rabbit using the same immunization scheme as that for the hybrid. 4.4.1 Incorporation of Der p 1 into hybrid Der p 1-2 increases its immunogenicity and induces a stronger IgG response IgG antibodies induced by rDer p 1 were demonstrated to bind the native allergen, nDer p 1 (Figure 14A). However the level of IgG responses specific to nDer p 1 was much lower than that induced by hybrid Der p 1-2. It seemed, therefore, that the incorporation of Der p 1 into a larger fusion protein had increased its immunogenicity. A similar observation was made in a study on allergy vaccines of timothy grass pollen, where hybrids composed of two of the four major allergens induced stronger and earlier IgG responses in mice than individual allergens and even the whole allergen extract (Linhart et al., 2002). As with the pollen hybrids, this phenomenon could be explained by classical carrier effects. Der p 1 appears to have reduced immunogenicity compared to Der p 2 in 84 its capacity to induce IgG antibodies, as demonstrated in a recent pilot subcutaneous allergen-specific immunotherapy (SCIT) study on atopic dermatitis patients (Bussmann et al., 2007). It is believed that when a poorly immunogenic antigen, in this case Der p 1, is presented with a covalently linked, more immunogenic partner, Der p 2, T cell epitopes of the latter can enhance the immunogenicity of the former. While the complete understanding of this awaits further elucidation, that immunogenicity of Der p 1 was enhanced in Der p 1-2 demonstrated an important advantage of the hybrid vaccines over other types of allergy vaccines, corroborating findings from hybrid studies published previously (Linhart et al., 2002; Linhart et al., 2005). 4.4.2 Incorporation of Der p 1 into a hybrid widens the repertoire of the induced IgG Comparing the levels of inhibition elicited by immunization with either protein at 5% v/v rabbit antiserum concentration, each of the rabbits immunized with Der p 1-2 consistently exhibited higher levels of inhibition as opposed to that achieved with Der p 1 alone (Figure 15). Interestingly, results from the ELISA binding assay indicated that at the same rabbit antiserum concentration, IgG antibodies induced by Der p 1 bound the native 85 allergen as strongly as could that induced by the hybrid (Figure 16). It seemed therefore, that the difference in the levels of inhibition induced by the immunogens lay, not in the level of IgG bound to the allergen, but in the epitopes being recognized. Apart from those already recognized through immunization with Der p 1 alone, the incorporation of Der p 1 into a larger hybrid protein could have induced IgG that targeted additional antigenic epitopes, to which the human IgE also bound, hence leading to the apparent increase in the levels of inhibition. This observation is much akin to the phenomenon of epitope spreading, where the epitope specificity of immunological responses are diversified and increased to include more epitopes on the same molecule (Vanderlugt and Miller, 2002). Nonetheless, that the hybrid enhanced the repertoire of epitopes recognized by the IgG antibodies raised should expectedly improve the efficacy of hybrids for use as vaccines. 86 4.5 Maintaining conformation is important for allergy vaccines designed for allergens with predominantly conformational epitopes The data with Der p 7-5 had demonstrated that the unstructured hybrid could act as vaccine for Der p 5 and Der p 7 (Figure 8). However, the percentage inhibition of IgE binding to Der p 1 due to Der p 1-2 induced IgG was only up to 63%; while that for Der p 2 was also moderate at a mean of 33% inhibition. As discussed, the level of inhibition reflected was dependent on two factors, the type of epitopes that the human sera were sensitized to and the type of epitopes that the hybrids induced IgG recognized. With the knowledge that both Der p 1 and Der p 2 consist mainly of conformational epitopes (Greene and Thomas, 1992; Collins et al., 1996; Chua et al., 1991; van’t Hof et al., 1991), it seemed possible that the expression of hybrid Der p 1-2 under denaturing conditions could have led to the lack of IgG induced against conformational epitopes and consequently the moderate level of inhibition attained. To evaluate whether the lack of conformation had any significant impact on the ability to induce blocking IgG against allergens predominantly composed of conformational epitopes, BALB/c mice were immunized with either native Der p 1 (nDer p 1) or recombinant Der p 1 (rDer p 1) that had been expressed and purified in the 87 same denaturing conditions as in the preceding section. The IgG antibodies induced in all native- and recombinant- immunized antisera were demonstrated to bind the native protein in an ELISA assay (Figure 17). Inhibition assays were performed to determine if the antisera could, further, block the binding of human IgE to the allergen. Each of the native immunized antisera was able to inhibit IgE binding to nDer p 1; antisera from recombinant immunized mice similarly inhibited in a dose dependent inhibition (Figure 18). Der p 1 had previously been found to be denatured irreversibly by the protein denaturants, guanidine (6M) and urea (6M) (Lombardero et al., 1990). Therefore, it would be unlikely that the mice IgG repertoire induced by the recombinant protein in this study, expressed in an even higher concentration of the denaturant (8M urea), would recognize conformational epitopes on the allergen. As with the hybrids, the inhibition exhibited by mice antisera following immunization with the unstructured recombinant could be explained by the presence of linear epitopes on Der p 1, which could not have been disrupted by the presence of the urea denaturant. Binding of IgG antibodies induced against the linear regions of native Der p 1 in the inhibition assay could have directly blocked the binding of IgE directed against the very same sites, or sterically prevented IgE binding to regions in the vicinity. 88 However, the percentage of inhibition obtained with rDer p 1 immunization was consistently lower than that with nDer p 1 (Figure 19). Therefore, it seemed that the disruption of structure in the recombinant indeed had an effect on the ability to induce blocking IgG and consequently the potential as a vaccine. Additionally, IgG binding was comparable between the native- and recombinant- induced IgG antibodies at the level of mice serum that the inhibition assays were performed (Figure 20). Therefore, the reduced capacity of rDer p 1-induced IgG to block IgE binding was attributable to genuine differences in the induced IgG repertoire, rather than differences in IgG titers. This further supported the possibility that the loss of conformation in the recombinant antigen affected the induction of blocking IgG antibodies by restricting the epitopes that repertoire of induced IgG could recognize. 4.5.1 Importance of the conformation and implications on the generation of allergy vaccines Modification of the overall three dimensional structure of an allergen had been an effective strategy of obtaining allergy vaccine candidates by disrupting the IgE binding B cell epitopes and retaining the linear T cell epitopes, to reduce allergenicity and retain antigenicity, respectively (Smith and Chapman, 1996; Takai et al., 1997; Vrtala et al., 2001; Saarne et al., 2005). Amongst these studies, a number of them had 89 also demonstrated that allergen derivatives with complete loss of overall conformation also retained the capacity to induce blocking IgG (Westritschnig et al., 2004; Focke et al., 2001; Reese et al., 2007). Similar observations were made in the evaluation of Der p 7-5 as a candidate vaccine. Despite expression in the presence of urea denaturant, the hybrid was able to induce IgG antibodies in all immunized rabbits that were able block the binding of human sera to the individual allergens by more than 80%. Reasonably, that allergen with disrupted conformation can induce IgG is not surprising. Linear epitopes are not affected by alterations in the three dimensional structure; any IgG induced against such regions would therefore be capable of blocking human IgE binding. However, this strategy is not as straight forward for allergens such as Der p 1. While the group one mite allergen had been shown to contain a few linear epitopes (Greene and Thomas, 1992), most human sera appeared to be sensitized to predominantly conformational epitopes of Der p 1 (Collins et al., 1996). The study with mice gave evidence that retaining the structure of the immunogen was important in the generation of blocking IgG antibodies. Yet, preservation of three dimensional structure prevents the reduction of allergenicity in such allergens where conformational epitopes are important (Reese et al., 2007). 90 Returning to the hybrids in this study, even with its conformation disrupted, Der p 1-2, induced IgG in rabbits that nonetheless blocked human serum IgE binding to native Der p 1 by up to 62%, comparable to levels achieved with nDer p 1 immunized mice antisera. Moreover, the inhibition percentages reflect only the capacity of the induced IgG to block IgE in vitro. It remains to be established whether the IgG are able to inhibit the downstream biological activities associated with IgE-mediated pathogenesis, such as degranulation of effector cells such as mast cells and basophils, release of inflammatory mediators, or IgE-mediated allergen presentation to T cells. 91 4.6 The hybrid approach – with perspectives from dust mite studies Most studies on hybrids of allergen had been done only in pollen and venom allergies. In this study, allergens from the clinically important house dust mite, Dermatophagoides pteronyssinus, had been used to study the applicability of the hybrid approach to mite allergies. 4.6.1 Hybrids as suitable replacement for individual allergens as vaccines As a combinatorial vaccine, a hybrid should be able to act as effective vaccine for all its component allergens. In one of the pioneering studies that explored the use of allergen hybrids, Linhart et al. demonstrated that IgG antibodies that were raised against hybrids consisting of major grass pollen allergens were capable of inhibiting IgE binding to all the purified allergens (Linhart et al., 2002; Linhart et al., 2005). Similar results were obtained with the Parietaria weed pollen allergens (Bonura et al., 2007). In this study with mite allergens, the hybrids constructed exhibited the capacity to induce IgG antibodies that inhibited the IgE binding to purified individual allergens in vitro. In particular, the inhibition levels achieved with Der p 7-5 was comparable to 92 that elicited by immunization with the individual allergens. This suggested that the hybrid could potentially replace Der p 5 and Der p 7 as vaccines to treat allergies to both allergens concurrently. 4.6.2 Hybrids enhance immunogenicity Arguably, cocktail recombinant vaccines could similarly provide solution for multiple sensitization while negating the disadvantages attributed to undefined composition of natural extracts. However, their use does not take into account that some allergens (natural or recombinant as well as the modified derivatives) could be poorly immunogenic, such as the major mite allergen Der p 1 (Busmann et al., 2007). Grass pollen hybrids had been demonstrated to induce stronger and earlier specific IgG responses as compared to the single allergens or the total allergen extract (Linhart et al., 2002; Linhart et al., 2005). Furthermore, the hybrids elicited stronger lymphoproliferative responses than the individual allergens, equimolar mixture of all component allergens and the extract. With mite allergens, the incorporation of Der p 1 into a hybrid molecule with Der p 2 initiated a stronger specific IgG response in NZW rabbits than when Der p 1 administered alone. The enhanced immunogenicity associated with hybrids could be attributed to the sheer increase in the molecular size of the immunogen or classical carrier effects. 93 4.6.3 Hybrids enhance the repertoire of epitopes recognized by IgG induced by vaccine This study has further established that along with enhanced immunogenicity, presenting Der p 1 in a hybrid induced a repertoire of IgG antibodies that possibly directed at more epitopes in addition to those recognized by IgG induced with Der p 1 alone, much akin to the phenomenon of epitope spreading. Indeed, this enhanced repertoire possibly contributed to the boost in the inhibition levels from 14% with Der p 1 alone to 63-71% with the hybrid. 4.6.4 Hybrids can be hypoallergenic Linhart et al. reported in their findings that hybrids of Phleum pretense retained most of the IgE binding epitopes and exhibited levels of allergenicity comparable to that with allergen extract (Linhart et al., 2002; Linhart et al., 2005). However, many others have demonstrated that it is possible to introduce hypoallergenicity into hybrids using similar strategies as those applied to individual recombinant allergens. Using variants of the allergens with deleted epitopes (King et al., 2001; González-Rioja et al., 2007) or mutations (Bonura et al., 2006), hybrids thus generated had reported reduction in IgE binding and allergenicity, both in vitro and in vivo. Similarly in this study, through expression under denaturing conditions, hybrids Der p 1-2 and Der p 7-5 were demonstrated to have reduced IgE binding capacities. 94 The reduced allergenicity discussed above not only renders the hybrids a safer vaccine in terms of reducing the risk of local and systemic anaphylactic reactions, it also allows for a higher dose of vaccine to be administered during immunotherapy. This could, in turn, favor allergen specific tolerance and suppression of IgE as well as permit an immunization scheme with reduced number of injections (Kussebi et al., 2005; Brehler et al., 2000). 95 5 Conclusion Specific immunotherapy is the only curative therapy approach for the treatment of allergy. As exemplified by previous studies on venom and pollen allergen, and with mite allergens in this study, hybrids present a good alternative to existing forms of allergy vaccines. 6 Future Work In this study, it was demonstrated that hybrids comprising the major allergens from house dust mite Dermatophagoides pteronyssinus had reduced IgE binding capacity and induced blocking IgG in vivo. Succeeding this, further studies should be done to assess the ability of the induced IgG to block the biological effects mediated by IgE antibodies and to determine if immunization with the hybrids modulates T cell responses. Hypoallergenicity of the hybrids could be confirmed in allergenic individuals through skin prick tests or immunoblot studies using human serum samples. The hybrids in this study have demonstrated efficacy despite expression in denaturing conditions; however, it is recognized that for application as vaccines to be administered to human patients, alternatives to urea as denaturant should be explored. The insolubility of the vaccines remains an important caveat that needs to be addressed. Whilst Der p 1-2 has demonstrated potential as a hypoallergenic vaccine 96 nonetheless, observations from studies comparing the use of native Der p 1 and recombinant Der p1 as vaccine candidates (Section 4.5) highlighted the importance of retaining conformation in a vaccine; hence, it may be worthwhile to look into ways of increasing the solubility of the vaccines, such as through the introducing a soluble fusion peptide by means of genetic engineering to enhance overall solubility of the expressed product or explore other means of expression such as in vitro. Alternatively, dialysis or dilution against a suitable buffer may reduce the urea denaturant present and refold the hybrids into the native conformation of the component allergens. Lastly, the hybrids could be further combined to construct a hybrid that comprises all the four major allergens, which could potentially benefit most patients sensitized to D. pteronyssinus. 97 7 Bibliography Aalberse, R.C. (2000). Structural biology of allergens. J Allergy Clin Immunol 106, 228-238. Akdis, C.A. (2006) Allergy and hypersensitivity – mechanisms of allergic disease. Curr Opin Immunol 18, 718-726. Akdis, M and Akdis, C.A. (2007) Mechanisms of allergen-specific immunotherapy. J Allergy Clin Immunol 119, 780-789. Angus, A.C., Ong, S.T. and Chew, F.T. (2004). Sequence tag catalogs of dust mite-expressed genomes. Am J Pharmacogenomics 4, 357-369. Arlian, L.G., Bernstein, I.L., Vyszenski-Moher, D.L. and Gallagher, J.S. (1987). Investigations of culture medium-free house dust mites. III: antigens and allergens of body and fecal extract of Dermatophagoides farinae. J Allergy Clin Immuno 79, 457-466. Arlian, L.G., Thomas, W.R. and Platts-Mills, A.E. (2001). The biology of dust mites and the remediation of mite allergens in allergic disease. J Allergy Clin Immunol 107, S406-413. 98 Beezhold, D.H., Hickey, V.L., and Sussman, G.L. (2001) Mutational analysis of the IgE epitopes in the latex allergen Hev b 5. J Allergy Clin Immunol 107, 1069-1076. Bendtsen, J.D., Nielsen, H., von Heijne, G. and Brunak, S. (2004) Improved prediction of signal peptides: SignalP 3.0. J Mol Biol 340, 783-795. Bonura, A., Corinti, S., Artale, A., Di Felice, G., Amoroso, S., Melis, M., Geraci, D. and Colombo, P. (2006). A hybrid expressing genetically engineered major allergens of the Parietaria pollen as a tool for specific allergy vaccination. Int Arch Allergy Immunol 142, 274-284. Brehler, R., Wolf, H., Kutting, B., Schnitker, J. and Luger, T. (2000) Safety of a two-day ultrarush insect venom immunotherapy protocol in comparison with protocols in longer duration and involving a larger number of injections. J Allergy Clin Immunol 105, 1231-1235. Bussmann, C., Maintz, L., Hartz, J., Allam, J-P., Vrtala, S., Chen, K-W., Bribes, T., Thomas, W.R., Valenta, R., Zuberbier, T., Sager, A. and Novak, N. (2007) Clinical improvement and immunological changes in atopic dermatitis patients undergoing subcutaneous immunotherapy with a house dust mite allergoid: a pilot study. Clin Exp Allergy 37, 1277-1285. 99 Chapman, M.D., Heymann, P.W. and Platts-Mills, T.A.E. (1987) Epitope mapping of two major inhalant allergens, Der p I and Der f I, from mites of the genus Dermatophagoides. 139, 1479-1484. Chew, F.T., Lim, S.H., Goh, D.Y.T. and Lee, B.W. (1999). Sensitization to local dust-mite fauna in Singapore. Allergy 54, 1050-1059. Chua, K.Y., Doyle, C.R., Simpson, R.J., Turner, K.J., Stewart, G.A. and Thomas, W.R. (1990) Isolation of cDNA coding for the major mite allergen Der p II by IgE plaque immunoassay. Int Arch Allergy Appl Immunol 91, 118-123. Chua, K.Y., Greene, W.K., Kehal, P. and Thomas, W.R. (1991) IgE binding studies with large peptides expressed from Der p II cDNA constructs. Clin. Exp. Allergy 21, 161-166. Chua, K.Y., Kehal, P.K. and Thomas, W.R. (1993) Sequence polymorphisms of cDNA clones encoding the mite allergen Der p I. Int Arch Allergy Immunol 101, 364-368. Collins, S.P., Ball, G., Vonarx, E., Hosking, C., Shelton, M., Hill, D. and Howden, M.E. (1996) Absence of continuous epitopes in the house dust mite major allergens Der 100 p I from Dermatophagoides pteronyssinus and Der f I from Dermatophagoides farinae. Clin Exp Allergy 26, 36-42. Cooke, R.A., Barnard, J.H., Hebald, S. and Stull, A. (1935) Serological evidence of immunity with coexisting sensitization in a type of human allergy (hay fever). J exp Med 62, 733-751. Cookson, William. (1999). The alliance of genes and environment in asthma and allergy. Nature 402, B5-11 Crameri, Reto and Rhyner, Claudio. (2006) Novel vaccines and adjuvants for allergen-specific immunotherapy. Curr Opin Immunol 18, 761-768. Djurup, R. and Malling, H.J. (1987) High IgG4 antibody level is associated with failure of immunotherapy with inhalant allergens. Clin Allergy 17, 459-468. Ewan, P.W., Deighton, J., Wilson, A.B., Lachmann, P.J. (1993) Venom-specific IgG antibodies in bee and wasp allergy: lack of correlation with protection from stings. Clin Exp Allergy 23, 647-660. Focke, M., Marler, V., Ball, T., Sperr, W.R., Majlesi, Y., Valent, P., Kraft, D. and Valenta, R. (2001) Nonanaphylactic synthetic peptides derived from B cell epitopes of 101 the major grass pollen allergen, Phl p 1, for allergy vaccination. FASEB J 15, 2042-2044. Gafvelin, G., Parmley, S., Neimert-Andersson, T., Blank, U., Eriksson, T.L.J., van Hage, M. and Punnonen, J. (2007) Hypoallergens for allergen-specific immunotherapy by directed molecular evolution of mite group 2 allergens. J. Biol. Chem. 282, 3778-3787. Golden, D.B., Meyers, D.A., Kagey-Sobotka, A., Valentine, M.D., Lichtenstein, L.M. (1982) Clinical relevance of the venom-specific immunoglobulin G antibody level during immunotherapy. J Allergy Clin Immunol 69, 489-493. González-Rioja, R., Ibarrola, I., Arilla, M.C., Ferrer, A., Mir, A., Andreu, C., Martínez, A. and Asturias, J.A. (2007) Genetically engineered hybrid proteins from Parietaria judaica pollen for allergen-specific immunotherapy. J Allergy Clin Immunol 120, 602-609. Greene, W.K. and Thomas, W.R. (1992) IgE binding structures of the major house dust mite allergen Der p I. Mol Immunol 29, 257-262. 102 Grodberg, J. and Dunn, J.J. (1988) ompT encodes the Escherichia coli outer membrane protease that cleaves T7 RNA polymerase during purification. J. Bacteriol 170, 1245-1253. Guerra, S., Allegra, L., Blasi, F. and Cottini, M. (1998) Age at symptom onset and distribution by sex and symptoms in patients sensitied to different allergens. Allergy 53, 863-869. Hantusch, B., Schöll, I., Harwanegg, C., Krieger, S., Becker, W-M., Spitzauer, S., Boltz-Nitulescu, G. and Jensen-Jarolim, E. (2005) Affinity determinations of purified IgE and IgG antibodies against the major pollen allergens Phl p 5a and Bet v 1a: discrepancy between IgE and IgG binding strength. Immunol Lett 97, 81-89. Hart, B.J. and Whitehead, L. Ecology of house dust mites in Oxfordshire. Clin Exp Allergy 20, 52-59. Holm, J., Gajhede, M., Derreras, M., Henriksen, A., Ipsen, H., Larsen, J.N., Lund, I., Jacobi, H., Millner, A., Wurtzen, P.A., and Spangfort, M.D. (2004) Allergy vaccine engineering: epitope modulation of recombinant Bet v 1 reduces IgE binding but retains protein folding pattern for induction of protective blocking-antibody responses J Immunol 173, 5258-5267. 103 Kemp, S.F. and Lockey, R.F. (2002). Anaphylaxis: a review of causes and mechanisms. Curr Rev Allergy Clin Immunol 110, 341-348. King, T.P., Jim, S.Y., Monsalve, R.I., Kagey-Sobotka, Anne., Lichtenstein, L.M. and Spangfort, M.D. (2001) Recombinant allergens with reduced allergenicity but retaining immunogenicity of the natural allergens: Hybrids of yellow jacket and paper wasp venom allergen antigen 5s. J Immunol 166, 6057-6065. Krilis, S., Baldo, B.A., Sutton, R. and Basten, A. (1984) Antigens and allergens from the common house dust mite Dermatophagoides pteronyssinus. J Allergy Clin Immunol 74, 142-146. Kuo, I.C., Cheong, N., Trakultivakorn, M., Lee, B.W. and Chua, K.Y. (2003) An extensive study of human IgE cross-reactivity of Blo t 5 and Der p 5. J Allergy Clin Immunol 111, 603-609. Kussebi, F., Karamloo, F., Rhyner, C., Schmid-Grendelmeier, P., Salagianni, M., Mannhart, C., Akdis, M., Soldatova, L., Markovic-Houseley, Z., von Beust, B.R., Kundig, T., Kemeny, D.M., Blaser, K., Crameri, R. and Akdis, C.A. (2005) A major allergen gene-fusion protein for potential usage in allergen-specific immunotherapy. J Allergy Clin Immunol 115, 323-329. 104 Lin, K.L., Hsieh, K.H., Thomas, W.R., Chiang, B.L. and Chua, K.Y. (1994) Characterization of Der p V allergen, cDNA analysis, and IgE-mediated reactivity to the recombinant protein. J Allergy Clin Immunol 94, 989-996. Linhart, B., Jahn-Schmid, B., Verdino, P., Keller, W., Ebner, C., Kraft, D. and Valenta, R. (2002) Combination vaccines for the treatment of grass pollen allergy consisting of genetically engineered hybrid molecules with increased immunogenicity. FASEB J. 16, 1301-1302. Linhart, B. and Valenta, R. (2004) Vaccine engineering improved by hybrid technology. Int Arch Allergy Immunol 134, 324-331. Linhart, B., Hartl, A., Jahn-Schmid, B., Verdino, P., Keller, W., Krauth, M-T., Valent, P., Horak, F., Wiedermann, U., Thalhamer, J., Ebner, C., Kraft, D. and Valenta, R. (2005) A hybrid molecule resembling the epitope spectrum of grass pollen for allergy vaccination. J Allergy Clin Immunol 115, 1010-1016. Linhart, Birgit and Valenta, Rudolf. (2005) Molecular design of allergy vaccines. Curr Opin Immunol 17, 1-10. 105 Lombardero, M., Heymann, P.W., Platts-Mills, T.A.E., Fox, J.W. and Chapman, M. (1990) Conformational stability of B cell epitopes on group I and group II Dermatophagoides spp allergens. J Immunol 144, 1353-1360. Loveless, M.H. (1940) Immunological studies of pollinosis: the presence of two antibodies related to the same pollen antigen in serum of treated hay fever patients. J Immunol 38, 25-50. Lynch, N.R., Thomas, W.R. and Garcia, N.M. et al. (1997) Biological activity of recombinant Der p 2, Der p 5 and Der p 7 allergens of the house dust mite Dermatophagoides pteronyssinus. Int Arch Allergy Immunol 114, 59-67. Mackay, I.R. and Rosen, F.S. (2001). Allergy and allergic diseases – first of two parts. N Engl J Med 334, 30-37. Mosmann, T.R. and Livingstone, A.M. (2004). Dendritic cells: the immune information management experts. Nat Immunol 5, 564-566. Pierkes, M., Bellinghausen, I., Hultsch, T., Metz, G., Knop, J., Saloga, J. (1999) Decreased release of histamine and sulfidoleukotrienes by human peripheral blood leukocytes after wasp venom immunotherapy is partially due to induction of IL-10 and IFN-gamma production of T cell. J Allergy Clin Immunol 103, 326-332. 106 Reese, G., Ballmer-Weber, B.K., Wangorsch, A., Randow, S. and Vieths, S. (2007) Allergenicity and antigenicity of wild-type and mutant, monomeric, and dimeric carrot major allergen Dau c 1: destruction of conformation, not oligomerization, is the roadmap to save allergen vaccines. J Allergy Clin Immunol 119, 944-951. Saarne, T., Kaiser, L., Gronlund, H., Rasool, O., Gafvelin, G. and van Hage-Hamsten, M. (2005) Rational design of hypoallergens applied to the major cat allergen Fel d 1. Clin Exp Allergy 35, 657-663. Shen, H.D., Chua, K.Y., Lin, K.L., Hsieh, K.H. and Thomas, W.R. (1993) Molecular cloning of a house dust mite allergen with common antibody binding specificities with multiple components in mite extracts. Clin Exp Allergy 23, 934-940. Shen, H.D., Chua, K.Y., Lin, W.L., Chen, H.L., Hsieh, K.H. and Thomas, W.R. (1996) IgE and monoclonal antibody binding by the mite allergen Der p 7. Clin Exp Allergy 26, 308-315. Silvestri, M., Oddera, S., Rossi, G.A. and Crimi, P. (1996) Sensitization to airborne allergens in children with respiratory symptoms. Ann Allergy Asthma Immunol 76, 239-244. 107 Smith, A.M. and Chapman, M.D. (1996) Reduction in IgE binding to allergen variants generated by site-directed mutagensis: contribution of disulfide bonds to the antigenic structure of the major house dust mite allergen Der p 2. Mol Immunol 33, 399-405. Stern, P.S. (1991) Predicting antigenic sites on proteins. TIBTECH 9, 163-169. Swoboda, I., de Weerd, N., Bhalla, P.L., Niederberger, V., Sperr, W.R., Valent, P., Kahlert, H., Fiebig, H., Verdino, P., Keller, W., Ebner, C., Spitzauer, S., Valenta, R. and Singh, M.B. (2002) Mutants of the major ryegrass pollen allergen, Lol p 5, with reduced IgE-binding capacity: candidates for grass pollen-specific immunotherapy. Eur J Immunol 32, 270-280. Takai, T., Yokota, T., Yasue, M., Nishiyama, C., Yuuki, T., Mori, A., Okudaira, H. and Okumura, Y. (1997) Engineering of the major house duste mite allergen Der f 2 for allergen-specific immunotherapy. Nat Biotechnol 15, 754-758. Takai, T., Ichikawa, S., Yokota, T., Hatanaka, H., Inagaki, F. and Okumura, Y. (2000) Unlocking the allergenic structure of the major house dust mite allergen Der f 2 by elimination of key intramolecular interactions. FEBS Lett 484, 102-107. Tanabe, Soichi. (2007) Epitope peptides and immunotherapy. Curr Protein and Peptide Science 8, 109-118. 108 Takai, T., Ichikawa, S., Yokota, T., Hatanaka, H., Inagaki, F. and Okumura, Y. (2000) Unlocking the allergenic structure of the major house dust mite allergen Der f 2 by elimination of key intramolecular interactions. FEBS Lett 484, 102-107. Till, S.J., Francis, J.N., Nouri-Aria, K., Durham, S.R. (2004) Mechanisms of immunotherapy. J Allergy Clin Immunol 113, 1025-1034. Umetsu, D.T., Mclntire, J.J., Akbari, O., Macaubas, C. and DeKruyff, R.H. (2002). Asthma: an epidemic of dysregulated immunity. Nat Immunol 3, 715-720. Valenta, Rudolf. (2002). The future of antigen-specific immunotherapy of allergy. Nat Rev Immunol 2, 446-453. Valenta, R., Ball, T., Focke, M., Linhart, B., Mothes, N., Niederberger, V., Spitzauer, S., Swoboda, I., Vrtala, S., Westritschnig, K., and Kraft, D. (2004) Immunotherapy of allergic disease. Adv Immunol 82, 105-153. van der Zee, J.S., van Swieten, P., Jansen, H.M. and Aalberse, R.C. (1988) Skin tests and histamine release with P1-depleted Dermatophagoides pteronyssinus body extracts and purified P1. J Allergy Clin Immunol 81, 884-896. 109 van Hage-Hamsten, M., Kronqvist, M., Zetterström, O., Johansson, E., Niederberger, V., Vrtala, S., Grönlund, H., Grönneberg, R. and Valenta, R. (1999) Skin test evaluation of genetically engineered hypoallergenic derivatives of the major birch pollen allergen, Bet v 1: results obtained with a mix of two recombinant Bet v 1 fragments and recombinant Bet v 1 trimer in a Swedish population before the birch pollen season. J Allergy Clin Immunol 104, 969-977. van Hage-Hamsten, M. and Valenta, R. (2002) Specific immunotherapy - the induction of new IgE-specificities? Allergy 57, 375-378. van Neerven, R.J., Wikborg, T., Lund, G., Jacobsen, B., Brinch-Nielsen, A., Arnved, J., et al. (1999) Blocking antibodies induced by specific allergy vaccination prevent the activation of CD4+ T cells by inhibiting serum-IgE-facilitated allergen presentation. J Immunol 163, 2944-2952. van Regenmortel, M.H.V. (1996) Mapping epitopes structure and activity: from one-dimensional prediction to four-dimensional description of antigenic specificity. Methods: A companion to methods in enzymology 9, 465-472. van’t Hof, W., Driedijk, P.C., van den Berg, M., Beck-Sickinger, A.G., Jung, G. and Aalberse, R.C. (1991) Epitope mapping of the Dermatophagoides pteronyssinnus house dust mite allergen Der p 2. Mol. Immunol. 33, 399-405. 110 Vanderlugt, C.L. and Miller, S.D. (2002) Epitope spreading in immune-mediated diseases: Implications for immunotherapy. Nat Rev Immunol 2, 85-95. Vrtala, S., Hirtenlehner, K., Vangelista, L., Pastore, A., Eichler, H-G., Sperr, W.R., Valent, P., Ebner, C., Kraft, D. and Valenta, R. (1997) Conversion of the major birch pollen allergen, Bet v 1, into two nonanaphylactic T cell epitope-containing fragments. J Clin Invest 99, 1673-1681. Vrtala, S., Hirtenlehner, K., Susani, M., Akdis, M., Kussebi, F., Akdis, C.A., Blaser, K., Hufnagl, P., Binder, B.R., Politou, A., Pastore, A., Vangelista, LO., Sperr, W.R., Semper, H., Valent, P, BEbner, C., Kraft, D. and Valenta, R. (2001) Genetic engineering of a hypoallergenic trimer of the major birch pollen allergen, Bet v 1. FASEB J 15, 2045-2047. Wachholz, P.A., Soni, N.K., Till, S.J., Durham, S.R. (2003) Inhibition of allergen-IgE binding to B cells by IgG antibodies after grass pollen immunotherapy. J Allergy Clin Immunol 112, 915-22. Wachholz, P.A. and Durham, S.R. (2004) Mechanisms of immunotherapy: IgG revisited. Curr Opin Allergy Clin Immunol 4, 313-318. 111 Weghofer, M., Thomas, W.R., Pittner, G., Horak, F., Valenta, R. and Vrtala, S. (2005) Comparison of purified Dermatophagoides pteronyssinus allergens and extract by two-dimensional immunoblotting and quantitative immunoglobulin E inhibitions. Clin Exp Allergy 35, 1384-1391. Westritschnig, K., Focke, M., Verdino, P., Guessler, W., Keller, W., Twardusz, A., Mari, A., Horak, F., Wiedermann, U., Hartl, A., Thalhamer, J., Sperr, W.R., Valent, P. and Valenta, R. (2004) Generation of an allergy vaccine by disruption of the three-dimensional structure of the cross-reactive calcium-binding allergen, Phl p 7. J Immunol 172, 5684-5692. Wills-Karp, M., Santelilz, J. and Karp, C.L. (2001). The germless theory of allergic disease: revisiting the hygiene hypothesis. Nat Rev Immunol 1, 69-75. Zeiler, T., Taivainen, A., Rytkönen, M., Rautiainen, J., Karjalainen, H., Mäntyjärvi, R., Tuomisto, L. and Virtanen, T. (1997) Recombinant allergen fragments as candidate preparations for allergen immunotherapy. J Allergy Clin Immunol 100, 721-727. 112 [...]... sources such as house dust mites, cockroaches, animal danders and moulds and outdoor allergens consisting of inhaled grass pollen and fungal spores 1.2.1 Mite as an important source of indoor allergens Mites are the most important source of allergens in the indoor environment Dust mite allergies constitute a significant health problem both worldwide and locally, 17 with more than 50% of allergic patients... percentage of subjects, indicating the importance of this allergen (Shen et al., 1996) With considerations of their importance in terms of frequency of sensitizations in studied populations, Der p 1, Der p 2, Der p 5 and Der p 7 were selected to be incorporated into hybrids that could potentially act as vaccines for immunotherapy against these allergens 2 Materials and Methods 2.1 Genetic engineering of hybrid... problems and improve efficacy and safety, combinatorial hybrid molecules have been explored as potential vaccines for allergy 1.4.3.1 Hybrids Some allergen sources such as birch pollen and cat dander contain a single major allergen that includes most of the disease-eliciting epitopes (Linhart and Valenta, 2004) Immunotherapy against these sources would essentially require only the major allergen as vaccine... comprising allergens or its modified derivatives Table 2 Summary of hybrids of allergens previously studied 1.5 Aims and Objectives The hybrid approach could be similarly applied to other allergen sources, such as dust mite, the most important indoor allergen source This study aims to construct hybrids comprising important allergens of house dust mite Dermatophagoides 26 pteronyssinus and to evaluate their potential. .. evaluate their potential as potential vaccines for immunotherapy 1.5.1 Selection of allergens from Dermatophagoides pteronyssinus for incorporation into hybrids Owing, in part, to the difficulties involved in producing a hybrid consisting of all allergens from a source, the incorporation of only a few selected, important allergens that affect a large proportion of the population into hybrids should suffice... and updated with the WHO/IUIS, as of December 2007 Mite allergens are divided into specific groups based on their biochemical composition, sequence homology and molecular weight 20 1.3 Incidence of Allergy The incidence of allergic diseases has risen dramatically over the last two decades in western Europe, the United States and Australasia (Mackay and Rosen, 2001), affecting up to thirty percent of. .. enhance the immunogenicity of the low immunogenic molecules (Linhart and Valenta, 2005) To date, hybrid allergens have been constructed for allergens involved in grass and weed pollen, wasp and bee venom associated allergies (Table 2) Although not 25 clinically tested as yet, the hybrids studied thus far have demonstrated to be potential allergy vaccines for allergen specific immunotherapy Allergen Source...List of Figures Page Figure 1: Mechanism of allergy 15 Figure 2: Genetic engineering of hybrids containing major mite allergens of Dermatophagoides pteronyssinus 42 Figure 3: Two successfully engineered hybrid constructs, Der p 1-2 and Der p 7-5 44 Figure 4: Expression of Der p 1-2 45 Figure 5: Expression of Der p 7-5 46 Figure 6: Inhibition of human... seconds and extension at 74°C for 2 minutes and repeated for 32 cycles Extension time was 8 minutes for the amplification along the entire length of plasmid Amplified products of Der p 2 and Der p 5 were subjected to kinase reaction with 1 µl T4 polynucleotide kinase (Research Biolabs, Singapore), 4 µl 10 times kinase buffer and 1 µl ATP in a 40 µl reaction mixture, for one hour at 37°C Products Der p 1 and. .. kDa chitinase 60 54 19 Anti-microbial peptide 7.2 - 20 Arginine kinase 40 # 21 Unknown 14 # O’Neil et al., 2006 Only references for allergens of Dermatophagoides pteronyssinus are shown # Identified D pteronyssinus allergens for which the sequence data is either listed in WHO/IUIS or Genbank but as yet unpublished Table 1 Mite Allergens and Corresponding Biochemical identities Table shows allergens ... 4.1 HYBRIDS FOR HOUSE DUST MITE ALLERGENS OF DERMATOPHAGOIDES PTERONYSSINUS .69 4.2 GENETIC ENGINEERING OF HYBRIDS CONTAINING MAJOR MITE ALLERGENS OF DERMATOPHAGOIDES PTERONYSSINUS AND. .. such as house dust mites, cockroaches, animal danders and moulds and outdoor allergens consisting of inhaled grass pollen and fungal spores 1.2.1 Mite as an important source of indoor allergens Mites... B-A Figure Genetic engineering of hybrids containing the major mite allergens of Dermatophagoides pteronyssinus The cDNAs of allergens Der p 1, Der p 2, Der p and Der p were genetically combined,