Chapter CHAPTER 3: CLONING, EXPRESSION AND IMMUNOLOGICAL CHARACTERIZATION OF THE RECOMBINANT Curvularia lunata PUTATIVE ALLERGENS 97 Chapter 3.1 INTRODUCTION In order to further understand and establish the allergenicity of the various putative allergens of Curvularia lunata, immunological characterization of the putative allergens was performed. The first and foremost step towards the characterization of these allergens involved generating the recombinant proteins for these putative allergens. As some of the ESTs already had a full-length putative allergen (as per BLAST X alignment), the sequences were sub-cloned and expressed. For the ESTs which possessed truncated allergen sequences (generally on the 5` end), the rapid Amplification of cDNA Ends (RACE) strategy was used. These putative allergen genes were cloned, expressed and a purified recombinant protein was obtained. These proteins were then further used for characterization to confirm the allergenicity of these recombinants. 3.2 MATERIALS AND METHODS 3.2.1 Cloning and Expression of the isolated putative C. lunata allergens 3.2.1.1 General analysis of the C. lunata putative allergens Various putatively allergenic C. lunata sequences as isolated earlier were further analyzed in order to ascertain whether the obtained sequences (from the ESTs) were the full-length open reading frames or truncated. A total of 14 different types of allergens were obtained. Out of these, contained full-length open reading frames. The full-length of the open reading frames was confirmed by comparing with known allergens using BLASTX alignments and also by checking for the Start/Stop codons. The initiation sites were predicted by checking for the Kozak consensus sequence 98 Chapter (Kozak, 1984). For the rest of the sequences which were not full-length, RACE strategy was utilized. 3.2.1.2 RACE amplification of the truncated putative allergen sequences For the remaining truncated sequences, SMARTTM RACE cDNA amplification kit (BD Bioscience) was used as per the manufacturer’s protocol. An overview of the RACE procedure is given in Figure 3.1. The figure is taken from the SMART RACE cDNA amplification kit (K1811-1) user manual. Finally, all the DNA sequence of all the sequences was confirmed three times in order to get the exact sequence. 3.2.1.3 Allergen submission to NCBI and nomenclature The sequences which were supposed to be used for further characterization were submitted to NCBI and were also given allergen names as per the International Union of Immunological Societies (IUIS) – Allergen Nomenclature Subcommitee nomenclature system. Since Cur l and Cur l are already published, the allergens were named accordingly, i.e. Cur l and so on. 3.2.1.4 Cloning of the putative allergens Cloning/expression of the allergens was done using commercially available bacterial expression kits due to their diverse, rapid and inexpensive nature as well as the ease of having a broad selection of fusion proteins, affinity purification tags. Moreover, protein yields for the bacterial expression systems are higher as compared to other expression systems available. The pET expression system (Novagen) was chosen due to its higher protein expression yields, specificity, inducibility, increased solubility and overall stability of the proteins. Moreover, there is a hexa-histidine tag which can be used for Nickel based affinity chromatographic purification (Figure 3.2). 99 Chapter Figure 3.1: Overview of the SMART RACE procedure [Taken from SMART RACE cDNA amplification kit (K1811-1) user manual] Total RNA was used for the RACE amplification of the Curvularia lunata allergens 100 Chapter Moreover, this vector involves ligation independent cloning (LIC) technology which bypasses the traditional digestion/ligation steps. A simple annealing of the inserts (with overhangs generated via PCR) to the vector is used. Furthermore, enterokinase (Ek) can be used to remove the fusion protein. Hence the vector is called pET32 Ek/LIC vector. Ligation independent cloning was carried out using the pET expression system (Novagen) as per the manufacturer’s protocol. Briefly, total RNA was reversed transcribed with the iScript cDNA Synthesis Kit (Bio-Rad Laboratories). Signal peptide sequence if present was removed from the full-length allergen sequence, Prediction of the signal peptide cleavage site was based on the (-3-1) rule (von Heijne, 1986) and was achieved using the Signal P software version 1.1 (Nielsen et al., 1997). Primers for polymerase chain reaction (PCR) amplification were designed according to the 3’ and 5’ ends of the respective open reading frames. Each primer pair however had a 5’- GAC GAC GAC AAG ATX-3’ and 5’-GAG GAG AAG CCC GGT-3’ overhangs respectively at the sense and anti-sense ends, rendering them compatible for pET32a vector annealing. The list of specific primers used is given in Table 3.1. PCR amplification was performed using Expand Long Template PCR System (Roche Diagnostics) possessing proofreading activity. A 50µl reaction consisted of 0.5µl of each primer (100µM), 5µl of Expand Long Template Buffer 1, 2µl of dNTP (10µM), 3µl of cDNA and 1µl of Expand Long Template Enzyme mix containing the thermostable DNA polymerases Taq and Tgo. Thermocycling conditions consisted of an initial denaturation at 94ºC for 10 min, followed by 30-35 cycles starting with 94ºC for 10s, 50-53ºC for 30s and 68°C for if the insert size is less than 1kb, and an 101 Chapter Figure 3.2: Schematic diagram of the pET32Ek/LIC vector showing locations of various solubility as well as affinity tags (Taken from www.emdbiosciences.com) Figure 3.3: Strategy used for directional cloning using pET32Ek/LIC vector (Taken from www.emdbiosciences.com) 102 Chapter Table 3.1: Sequences of the primers used for the cloning of C. lunata allergen sequences into pET32Ek/LIC vector The sequence of the forward primer (F) is shown first, followed by that of the reverse primer (R). Each forward primer has a 5’- GACGACGACAAGATX-3’ and each reverse primer has 5’-GAGGAGAAGCCCGGT-3’ overhangs on the 5` as well as 3` ends respectively for proper annealing with the pET32/EkLIC vector. Allergen Cur l Cur l Cur l Cur l Cur l Cur l Cur l Cur l 10 Cur l 11 Cur l 12 Cur l 13 Cur l 14 Primer Sequences for cloning into pET32Ek/LIC F: 5’- GACGACGACAAGATGGAACTGCATCACAGC - 3` R: 5’- GAGGAGAAGCCCGGTTTAAATAGACGCTTT - 3` F: 5’- GACGACGACAAGATGAGCGAAGAAACCAAG - 3` R: 5’- GAGGAGAAGCCCGGT TTACTCGTAGTTGGAC - 3` F: 5’- GACGACGACAAGATGTCCAACCCCCGTGTT - 3` R: 5’- GAGGAGAAGCCCGGTTTATAGCTGGCCGGAC - 3` F: 5`- GACGACGACAAGATGGATCTCTTCAAGAAGACACTCAAGCCC - 3` R: 5`- GAGGAGAAGCCCGGTCTACAACTCGTCGTGGTCCTGGG - 3` F: 5`- GACGACGACAAGATCCACGAGGCTGAGAACGCCGT - 3` R: 5`- GAGGAGAAGCCCGGTCTACAACTCGTCGTGGTCCTGGG - 3` F: 5’- GACGACGACAAGATGCGCTCGCTCGGCCAG - 3` R: 5’- GAGGAGAAGCCCGGTTTACTTCTGCATCAT - 3` F: 5’- GACGACGACAAGATGCTCCAAAAGGGTCTT - 3` R: 5`- GAGGAGAAGCCCGGTTTAGCAAGGTTGATG - 3` F: 5`- GACGACGACAAGATGAGCAACATTCCCCAAGAG - 3` R: 5`- GAGGAGAAGCCCGGT TTACTTGGATGTGTCGAG - 3` F : 5`- GACGACGACAAGATCACTGTCAGCTACGACCCG - 3` R: 5`- GAGGAGAAGCCCGGT TTAAAGACCGCAGTTGCT - 3` F: 5`- GACGACGACAAGATCATCACTGTCTACGACAACTCTGGCG - 3` R: 5`- GAGGAGAAGCCCGGTTTAGACGACGCTCCATGAGGCC - 3` F: 5`- GACGACGACAAGATCCCCACCGACTTTGATCCTAGCAA - 3` R: 5`- GAGGAGAAGCCCGGTTCAGCCTGCACGACACGGAA - 3` F: 5'- GACGACGACAAGATGTCCTGGCAAGCATAC - 3` R: 5’- GAGGAGAAGCCCGGTTTAACGTACAAAAGA - 3` 103 Chapter additional 1min for every 1kb increase in insert size. The final extension was done at 68ºC for 4-7 min, depending on insert size. Agarose gel electrophoresis was further carried out on 1% agarose in tris-acetate-EDTA (TAE) buffer (40mM Tris-acetate, 1mM EDTA, pH 8). The required product was recovered after gel electrophoresis with QIAquick Gel Extraction Kit (QIAGEN), as per manufacturer’s instructions. The GeneRuler™ 1kb DNA Ladder (MBI Fermentas) was loaded as a standard for comparison. All DNA quantification was done using the SmartSpec™ Plus Spectrophotometer (Bio-Rad Laboratories). To confirm the identity of the amplicon, DNA sequencing was performed as explained earlier. Single stranded overhangs complementary to the pET32 Ek/LIC vector were generated on the extended specific insert by the 3´→ 5´ exonuclease activity of T4 DNA polymerase (Novagen) in the presence of dATP (Promega). The exonuclease removes nucleotides from the PCR product obtained from the previous section until it encounters an adenosine residue, after which the exonuclease activity is counteracted by the 5´ polymerase activity of the same enzyme (Figure 3.3). For the T4 DNA polymerase treatment, the amount (µl) of the purified PCR product to be added was calculated using the formulae: [{(Number of base pairs of the insert x 650)/5000} x {1/2(concentration of the DNA in µg/ml)}]. This calculated amount of the product was added to a sterile tube containing 10x T4 DNA Polymerase buffer, 0.5µl of dATP (50mM), 0.2µl of T4 DNA Polymerase (2.5 units/ml) and topped up to 10µl with nuclease-free water. The tube was then incubated at 22°C for 30min, followed by 75°C for 20 min. 104 Chapter The Ek/LIC vector containing the specific non-complementary single-stranded overhangs (allowing directional cloning without restriction enzymes) was annealed to the previously generated T4 polymerase treated product. Briefly, 0.5µl of the vector to 1µl of the product was incubated for at 22°C followed by the addition of 0.5µl of 25mM EDTA. The annealing was allowed to occur at room temperature for 1-2h, and the products were stored at 4°C until further use. The annealed insert-vector plasmids (1 µl) were then transformed, using a heat shock treatment (40 on ice, 90s at 42°C, on ice) into 50µl of DH5α competent cells. This mix was then incubated with 900µl of LB broth at 37°C for 45 with constant shaking at 200 rpm. After incubation, the broth was centrifuged at 13,000 rpm for 15s and 900µl of LB broth was removed and the remaining broth was resuspended and plated on LB agar containing ampicillin (100µg/ml) plates. Plates were then incubated for 16 h at 37°C and the transformants were selected. The transformant colonies were then picked and suspended in 6µl of sterile water, out of which 1µl was used as the template in the PCR. A ten-reaction master mix consisted of 10µl of 10X Buffer, 2µl of primers specific for the Ek/LIC Vector, 2µl of dNTP (10µM), 6µl of 25mM MgCl2 and 1µl of Taq Polymerase was topped up to 90µl with autoclaved water. The cycling conditions were set at 95ºC for min, followed by 35 cycles of denaturation (94ºC for 30s), annealing (50ºC for 30s) and extension (72ºC for 1min if the insert size was less than 1kb, and an additional for every 1kb increase in size). Final extension was carried out at 72ºC for 4-7 min. After PCR, agarose gel electrophoresis was performed to confirm the size of the insert in the transformants. 105 Chapter The transformant colonies showing proper sized insert was inoculated overnight in LB broth containing 100µg/ml of ampicillin and were incubated at 37°C at 230 rpm overnight. Plasmid extraction was then carried out using the QIAprep Spin Miniprep Kit (QIAGEN) and sequenced to confirm the inserts. Upon confirmation of the size and sequence of the allergen inserts, the extracted plasmids were transformed into BL21 E.coli cells (same as that of DH5α). Transformants were checked for size and glycerol stocks of the transformants with correct insert were prepared and stored in -80°C for future use. 3.2.1.5 Protein expression of the putative allergens Transformant colonies having correct allergen insert were inoculated into 5ml of LB broth containing 100µg/ml of ampicillin and incubated at 37°C at 230 rpm overnight. From the grown starter culture, 2ml was added to 200ml of LB broth containing ampicillin (100µg/ml) and incubated at 230 rpm for 2.5 h at 37°C. Protein expression was induced with 200µl of 0.5M isopropyl 1-thio-β-Dgalactoside (IPTG). The culture was then incubated at 230 rpm for either h at 37°C or overnight at 22°C. After incubation, the supernatant was discarded after centrifugation at 3800 rpm at 4°C for 10 and the cell pellet was resuspended with 20ml of binding buffer (40mM imidazole, 4M NaCl, 160mM Tris-HCl, pH7.9) containing 6M of urea. The cells were lysed by sonication and the debris was removed by centrifugation at 13,000rpm for 15 min. The expressed recombinant proteins using pET32-Ek/LIC possessed an Nterminal fusion protein that contained three tags [thioredoxin tag (109 aa), His•Tag (6 aa) and S•Tag (15 aa)], adding approximately 17.3 kDa to the existing molecular mass of the recombinant protein. 106 Chapter Figure 3.4: Successful full-length amplification for C. lunata alcohol dehydrogenase by 5` RACE As shown below, the shaded region is the sequence available from the EST. First row represents the cDNA sequence while the second row shows the translated amino acid sequence for the corresponding triplet codons. The gene specific primer for 5` RACE is showed in yellow. As seen in the figure, after 5`RACE, a full-length sequence for the alcohol dehydrogenase allergen was obtained with the start (ATG) and the stop codon (TAA). 114 Chapter Table 3.2: List of C. lunata putative allergens with the NCBI accession numbers as well as allergen name The two allergens not present in the below list are C. lunata homologs of Alt a 10 and Mal f which were not submitted to NCBI and were not given any allergen name as the sequence lengths were too small for future immunological characterizations. Allergen nomenclature: First three letters are taken from genus (Cur from Curvularia) followed by the first letter of the species (l from lunata) followed by a unique Arabic number. Lengths of the allergen sequences are given in base pairs (bp). Allergen Identity/Homology Allergen name NCBI Accession Length (bp) Asp f (Mn, Superoxide Dismutase) [Aspergillus fumigatus] Cur l AY291574 588 Cop c (Thioredoxin) [Coprinus comatus] Cur l AY291577 339 Cyclophilin allergen [Malassezia sympodialis] Cur l AY291576 516 Pen c 19 (Heat Shock Protein 70) [Penicillium citrinum] Cur l DQ911620 627 Pen n 18 (Vacuolar Serine Protease) [Penicillium notatum] Cur l DQ911621 627 Jun o (Ca+2 binding protein) [Juniperus oxycedrus] Cur l AY291578 342 Asp f [Aspergillus fumigatus] Cur l AY291573 468 Can a (Alcohol Dehydrogenase) [Candida albicans] Cur l 10 DQ911619 1059 Asp f 15 precursor (Asp f 13) [Aspergillus fumigatus] Cur l 11 AY291575 417 Asp f [Aspergillus fumigatus] Cur l 12 DQ911618 321 Tri r (Serine Protease) [Trichophyton rubrum] Cur l 13 DQ911623 564 Par j (Profilin) [Parietaria judaica] Cur l 14 AY291579 357 115 Chapter 3.3.1.3 Cloning and expression of the putative allergens pET32/EkLIC vector (Novagen) was used for the cloning/expression of the putative allergens. Using the specific forward and reverse primers for each allergen, the amplicon was obtained. Figure 3.5 shows the agarose gels for all the C. lunata allergen amplicons after PCR with pET32/EkLIC specific primers. As seen in the figure, each amplicon was around 50bp longer than expected. This is due to the presence of LIC overhangs present in the primer sequences (around 25 bases on each primer). Furthermore, the successfully cloned sequences in the pET32/EkLIC vector were expressed to generate recombinant proteins (with the fusion protein as mentioned earlier). These expressed recombinant proteins (with histidine tag) were then purified by Nickel based affinity purification in buffer with 6M urea. Protein quantification of the proteins was done to get the amount of expression. Protein expression yields for the expressed recombinant putative allergens were around 1mg/ml. There was some problem with the Cur l 14 expression as it was not giving the protein of right size. Hence, Cur l 14 was not purified and was not included in further studies. A list detailing the estimated molecular weights of the allergens using the Compute pI/Mw tool (http://www.expasy.ch/tools/pi_tool.html) is shown in Table 3.3. The quality and purity of the expressed recombinants was checked by 12% SDS PAGE (Figure 3.6). As seen in the figure, proteins with single, clear band of correct expected size were obtained. 116 Chapter Figure 3.5: 1% agarose gels for the amplicons of C. lunata putatively allergenic sequences after PCR amplification with pET32/EkLIC specific primers Length is shown in base pairs (bp). GeneRuler™ 1kb DNA Ladder (MBI Fermentas) is loaded as standard for comparison of the amplicon sizes. Due to the presence of LIC overhangs present in the primer sequences (around 25 bases on each primer), the observed lengths of the amplicons are 50bp longer than expected lengths. 1000bp 750bp 750bp 750bp 500bp 500bp 500bp 500bp 250bp 500bp 250bp Cur l 500bp 250bp Cur l 250bp Cur l Cur l Cur l 1000bp 250bp 500bp Cur l 500bp 500bp 250bp 500bp 750bp 250bp 500bp 250bp 250bp Cur l Cur l 10 Cur l 11 117 Cur l 12 Cur l 13 Cur l 14 Chapter Table 3.3: Estimated molecular weights of the expressed C. lunata putative allergens Estimated molecular mass of the allergens calculated using Compute pI/Mw tool (http://www.expasy.ch/tools/pi_tool.html). Estimated molecular mass (kDa) pI 195 21.8 7.59 Cop c (Thioredoxin) [Coprinus comatus] 112 12.3 4.84 Cur l Cyclophilin allergen [Malassezia sympodialis] 171 18.3 8.75 Cur l Pen c 19 (Heat Shock Protein 70) [Penicillium citrinum] 208 22.3 5.41 Cur l Pen n 18 (Vacuolar Serine Protease) [Penicillium notatum] 208 22.3 5.27 Cur l Jun o (Ca+2 binding protein) [Juniperus oxycedrus] 113 13.0 3.95 Cur l Asp f [Aspergillus fumigatus] 155 17.3 6.22 Cur l 10 Can a (Alcohol Dehydrogenase) [Candida albicans] 352 37.5 7.02 Cur l 11 Asp f 15 precursor (Asp f 13) [Aspergillus fumigatus] 138 14.3 5.47 Cur l 12 Asp f [Aspergillus fumigatus] 106 11.2 4.43 Cur l 13 Tri r (Serine Protease) [Trichophyton rubrum] 187 21.1 5.20 Allergen name Allergen Identity/Homology Length (aa) Cur l Asp f (Mn, Superoxide Dismutase) [Aspergillus fumigatus] Cur l 118 Chapter Figure 3.6: Purified recombinant C. lunata putatively allergenic proteins after expression 12% SDS PAGE was used. Molecular size is shown in kilo daltons (kDa). Due to the presence of the fusion protein (made up of the thioredoxin, his and S tags with some linking sequences) of approximately 18kDa, the observed protein bands were around 18kDa higher than that of the expected size. 119 Chapter 3.3.2 Confirmation of allergenicity for the generated recombinant allergens Various Curvularia lunata recombinant proteins as well as C. lunata total extract were tested on various populations in order to confer allergenicity to the putative allergens. The putative allergens were tested on the local Singaporean fungal atopic population. A total of 152 Singaporean (76 patients and 76 controls) sera were tested. All of the C. lunata recombinants tested showed binding to the patients specific IgEs. Cur l 10 showed maximum IgE binding frequency (60%) as compared to any of the other allergens tested. As per IUIS – allergen nomenclature subcommittee, an allergen reacting with the IgE binding frequency equal to or greater than 50% is considered as a major allergen. Hence as per this definition, Cur l 10 can be considered as a major allergen of C. lunata. Cur l showed least IgE binding frequency of 8%. IgE binding frequencies of the C. lunata total extract was lower than Cur l 3,4,9,10,11 and 12. This might be due to the fact that the individual allergen concentration might be getting diluted when present together with other proteins in the total extract, hence reducing allergenicity. IgE binding frequencies of A.fumigatus and P.citrinum were higher than C. lunata total extract (Figure 3.7) with IgE binding frequencies of 55% and 40% respectively while that of C. lunata being 32%. Amongst the control sera, only 4% of the patients showed positive IgE binding to Cur l 10 whilst around 2.5% of the patients showed positive reactions to Cur l and Cur l each. The rest all recombinants showed no reactions. For the tested crude extracts, A.fumigatus and P.citrinum showed IgE binding frequency to 10% and 8% of the tested sera while C. lunata extract showed around 1%. Hence, with the help of this experiment, it was established that the putative C. lunata 120 Chapter Figure 3.7: IgE binding study of C. lunata recombinant allergens for fungal atopic Singaporean population (N=160) Reaction above the intensity of 20 units is considered as a positive reaction. Cur: Curvularia lunata, Asp: Aspergillus fumigatus and Pen: Penicillium citrinum total extracts 121 Chapter recombinant proteins were truly allergenic. Further, IgE binding of the C. lunata allergens over the patients from various populations of the world (as well as differential sensitivity to various allergens) was investigated. In the first study, a total of 171 (160 patients and 11 control) sera from the atopic (asthma or rhinitis) dust-mite sensitive Italian population were tested. As expected from the previous experiment, C. lunata recombinants as well as the crude extract showed positive reactions to IgEs from atopic Italian patients. Out of all the C. lunata recombinants tested, Cur l showed highest IgE binding frequency (44%) whilst Cur l showed least IgE binding (15%). Again, like in the previous (Singaporean) population, C. lunata total extract reacted lower than most of the recombinant C. lunata allergens. Also, P.citrinum as well as A.fumigatus showed higher IgE binding frequencies as compared to that of other C. lunata recombinant allergens or C. lunata total extract. Moreover, the intensity of IgE binding of A.fumigatus as well as P.citrinum was also higher as compared to the other C. lunata allergens. The IgE binding intensities of the C. lunata recombinant allergens ranged from 20-80 units whilst those of Pen/Asp crude extracts ranged from 20-110 units (Figure 3.8). The control sera didn’t showed any binding to the C. lunata recombinants as well as C. lunata extract but showed positive binding to the A.fumigatus as well as P.citrinum crude extracts with the IgE binding frequencies of 9% each. In the second study, a total of 128 (118 asthmatic as well as 10 control) sera from Colombian population were used. For the 118 asthmatic sera; Cur l 3, Cur l 9, Cur l 10, Cur l 11 and Cur l 13 showed high IgE binding frequencies (around 57-68%) whilst 122 Chapter Figure 3.8: IgE binding study of C. lunata recombinant allergens for atopic Italian population (N=160) Reaction above the intensity of 20 units is considered as a positive reaction. Cur: Curvularia lunata, Asp: Aspergillus fumigatus and Pen: Penicillium citrinum total extract 123 Chapter the rest of the C. lunata allergens showed comparatively lower IgE binding frequencies. This data suggests that Cur l 3, Cur l 8, Cur l 10, Cur l 11 and Cur l 13 can be considered as major allergens of C. lunata for Colombian population as per the definition of major allergen. Surprisingly, crude extracts A.fumigatus and P.citrinum also showed lower IgE binding frequencies suggesting that the Colombian population is not that reactive to these two fungal allergens as compared to the Italian population. C. lunata total extract showed the lowest IgE binding frequency (21%) with the Colombian sera (Figure 3.9). The control sera didn’t show any reaction to the tested allergens. In general, Colombian population showed higher IgE binding frequencies for the tested allergens as compared to all the previously tested populations. In the third and final study, IgE binding of the recombinants was tested over a small group of atopic Indian patients` [(3 dust mite/fungi positive, dust mite positive and fungi positive)] sera. C. lunata allergens showed better IgE binding frequencies as compared to the A.fumigatus and P.citrinum extracts. Amongst the recombinant allergens, Cur l and Cur l showed no reaction with the any of the Indian sera. Cur l 9, Cur l 10, Cur l 11, Cur l 12 and Cur l 13 showed IgE binding frequencies of more than 50%, suggesting these allergens to be major reactive allergens over the tested Indian sera. Surprisingly, Cur l showed lower IgE binding as compared to the other populations tested. All the sera which showed positive IgE binding reactions to fungi on the SPT also showed positive IgE binding to one of the tested fungal allergens. This data hence suggests that the Indian sera are more reactive to Curvularia allergens than the other (A.fumigatus/P.citrinum) extracts (Figure 3.10). 124 Chapter Figure 3.9: IgE binding study of C. lunata recombinant allergens for asthmatic Colombian population (N=118) Reaction above the intensity of 20 units is considered as a positive reaction. Cur: Curvularia lunata, Asp: Aspergillus fumigatus and Pen: Penicillium citrinum total extracts 125 Chapter Figure 3.10: IgE binding study of C. lunata recombinant allergens for atopic Indian population (N=17) Reaction above the intensity of 20 units is considered as a positive reaction. Cur: Curvularia lunata, Asp: Aspergillus fumigatus and Pen: Penicillium citrinum total extracts 126 Chapter Overall, after comparing the results from all the four populations tested, many observations were evident. Firstly, C. lunata recombinant proteins were found to be binding the IgEs from the sera of the patients from the various populations tested. Amongst the various C. lunata recombinant allergens tested, Cur l 3, Cur l 4, Cur l 10 and Cur l 13 were considered immunologically important allergens from C. lunata as they consistently showed binding to more than 50% of the patients (Table 3.4) making them major allergens of C. lunata as per allergen nomenclature definition (Marsh et al., 1986). Cur l showed lower IgE binding in majority of the populations tested. This might be due to the fact that Cur l was not a full-length protein (lacking N and C-terminal regions) and hence the IgE binding epitopes formed by the missing regions were not present affecting the IgE binding. One observation evident from the above data was that the patients from various populations react differentially to various allergens, suggesting that the patients` IgEs recognize different epitopes. Also, the atopic Singaporean population (found to be sensitive to Aspergillus fumigatus, Alternaria alternata, Candida albicans and Cladosporium herbarum by SPT) was also found to react with the C. lunata total extract as well as recombinant allergens suggesting that there are some conserved epitopes shared by the proteins of C. lunata and the other fungi which were used for SPT. This conserved epitopes may give rise to possible cross-reactivity. Moreover, recent studies involving comparative genomics of fungal allergens and epitopes showed that fungal allergens have a widespread distribution of closely related allergen and epitope orthologues (orthologues = genes in different species which are evolved from a common ancestral gene) across fungal phylogeny (Bowyer et al., 2006). 127 Chapter Table 3.4: IgE binding frequencies (%) of the allergens for the sera from various populations tested IgE binding frequencies are expressed in percentage which is given by the formula [(number of sera showing positive reactions/total number of sera for a population tested) X 100] N= Total number of sera tested Allergens tested Singaporean Sera (N=76) Italian Sera (N=160) Colombian Sera (N=118) Indian Sera (N=17) Cur l 44.7 44.4 68.6 23.5 Cur l 48.7 35.6 42.4 17.6 Cur l Cur l Cur l Cur l 31.6 28.9 28.9 7.9 35.6 15.0 41.9 30.6 50.0 44.1 50.0 32.2 29.4 0.0 41.2 0.0 Cur l Cur l 10 Cur l 11 Cur l 12 40.8 60.5 38.2 43.4 28.8 25.6 33.1 18.8 66.1 58.5 56.8 50.8 52.9 70.6 82.4 70.6 Cur l 13 C. lunata A.fumigatus P.citrinum 14.5 32.9 55.3 40.8 25.0 35.6 55.6 53.1 59.3 21.2 55.1 34.7 70.6 35.3 17.6 23.5 128 Chapter So, this data suggests that most fungi possess proteins that have allergens which tend to cross-react. To study these aspects, the generated C. lunata recombinant proteins were further cross-compared with other known recombinant fungal as well as nonfungal allergen homologs to understand allergen sequence, structure as well as possible cross-reactivity; the details of which are mentioned in the next chapter. 129 [...]... Cur l 11 Cur l 12 40.8 60.5 38 .2 43. 4 28.8 25.6 33 .1 18.8 66.1 58.5 56.8 50.8 52.9 70.6 82.4 70.6 Cur l 13 C lunata A.fumigatus P.citrinum 14.5 32 .9 55 .3 40.8 25.0 35 .6 55.6 53. 1 59 .3 21.2 55.1 34 .7 70.6 35 .3 17.6 23. 5 128 Chapter 3 So, this data suggests that most fungi possess proteins that have allergens which tend to cross-react To study these aspects, the generated C lunata recombinant proteins... found to be binding the IgEs from the sera of the patients from the various populations tested Amongst the various C lunata recombinant allergens tested, Cur l 3, Cur l 4, Cur l 10 and Cur l 13 were considered immunologically important allergens from C lunata as they consistently showed binding to more than 50% of the patients (Table 3. 4) making them major allergens of C lunata as per allergen nomenclature... reaction intensity of 20 3. 3 RESULTS AND DISCUSSION 3. 3.1 Cloning and Expression of the isolated putative C lunata allergens 3. 3.1.1 RACE amplification of the truncated putative allergen sequences Out of the 14 different allergen types, 7 allergens were already found to be present as full-length in the ESTs For the remaining 7 truncated sequences, RACE amplification 112 Chapter 3 was tried in order... Curvularia allergens than the other (A.fumigatus/P.citrinum) extracts (Figure 3. 10) 124 Chapter 3 Figure 3. 9: IgE binding study of C lunata recombinant allergens for asthmatic Colombian population (N=118) Reaction above the intensity of 20 units is considered as a positive reaction Cur: Curvularia lunata, Asp: Aspergillus fumigatus and Pen: Penicillium citrinum total extracts 125 Chapter 3 Figure 3. 10:... Cur l 14 AY291579 35 7 115 Chapter 3 3 .3. 1 .3 Cloning and expression of the putative allergens pET32/EkLIC vector (Novagen) was used for the cloning/expression of the putative allergens Using the specific forward and reverse primers for each allergen, the amplicon was obtained Figure 3. 5 shows the agarose gels for all the C lunata allergen amplicons after PCR with pET32/EkLIC specific primers As seen... recombinant C lunata allergens Also, P.citrinum as well as A.fumigatus showed higher IgE binding frequencies as compared to that of other C lunata recombinant allergens or C lunata total extract Moreover, the intensity of IgE binding of A.fumigatus as well as P.citrinum was also higher as compared to the other C lunata allergens The IgE binding intensities of the C lunata recombinant allergens ranged from 20-80... frequency to 10% and 8% of the tested sera while C lunata extract showed around 1% Hence, with the help of this experiment, it was established that the putative C lunata 120 Chapter 3 Figure 3. 7: IgE binding study of C lunata recombinant allergens for fungal atopic Singaporean population (N=160) Reaction above the intensity of 20 units is considered as a positive reaction Cur: Curvularia lunata, Asp: Aspergillus... presence of the fusion protein (made up of the thioredoxin, his and S tags with some linking sequences) of approximately 18kDa, the observed protein bands were around 18kDa higher than that of the expected size 119 Chapter 3 3 .3. 2 Confirmation of allergenicity for the generated recombinant allergens Various Curvularia lunata recombinant proteins as well as C lunata total extract were tested on various... Cur l 3, Cur l 9, Cur l 10, Cur l 11 and Cur l 13 showed high IgE binding frequencies (around 57-68%) whilst 122 Chapter 3 Figure 3. 8: IgE binding study of C lunata recombinant allergens for atopic Italian population (N=160) Reaction above the intensity of 20 units is considered as a positive reaction Cur: Curvularia lunata, Asp: Aspergillus fumigatus and Pen: Penicillium citrinum total extract 1 23 Chapter... the start (ATG) and the stop codon (TAA) 114 Chapter 3 Table 3. 2: List of C lunata putative allergens with the NCBI accession numbers as well as allergen name The two allergens not present in the below list are C lunata homologs of Alt a 10 and Mal f 4 which were not submitted to NCBI and were not given any allergen name as the sequence lengths were too small for future immunological characterizations . of 20. 3. 3 RESULTS AND DISCUSSION 3. 3.1 Cloning and Expression of the isolated putative C. lunata allergens 3. 3.1.1 RACE amplification of the truncated putative allergen sequences Out of. understand and establish the allergenicity of the various putative allergens of Curvularia lunata, immunological characterization of the putative allergens was performed. The first and foremost. DQ911618 32 1 Tri r 4 (Serine Protease) [Trichophyton rubrum] Cur l 13 DQ9116 23 564 Par j 3 (Profilin) [Parietaria judaica] Cur l 14 AY291579 35 7 Chapter 3 116 3. 3.1 .3 Cloning and expression