Chapter Materials and Methods 2.1 Materials Table 1. Reagents used in this study. Description Laboratory Chemicals Source BDH Laboratory Supplies (UK) Sigma Chemical Company (USA) Media Components Difco Laboratories (USA) DNA modifying and restriction enzymes New England Biolabs (USA) Amersham (UK) Glusulase DuPont NEN Research Products (USA) Lyticase Sigma-Aldrich (USA) Alpha factor Biotechnology Centre (Singapore) Nocodazole Sigma-Aldrich (USA) MG132 proteasome inhibitor Sigma-Aldrich (USA) Table 2. Antibodies used for immunofluorescence and protein analyses. Antibodies Mouse monoclonal anti-HA Source Roche Diagnostics Mouse monoclonal anti-cmyc Santa Cruz Biotechnology Inc Rabbit polyclonal anti-HA Santa Cruz Biotechnology Inc Rabbit polyclonal anti-cmyc Santa Cruz Biotechnology Inc Rabbit polyclonal anti-G6PDH Sigma-Aldrich Rat monoclonal anti-tubulin YOL 1\34 Serotec Rabbit polyclonal anti-Clb2 Kim Nasmyth (Institute of Molecular Pathology, Vienna) Rabbit polyclonal anti-Cdc5 Santa Cruz Biotechnology Inc Mouse monoclonal anti-Cdc6 Abcam Rabbit polyclonal anti-Cdc28 Kim Nasmyth (Institute of Molecular Pathology, Vienna) Table 3. List of S. cerevisiae strains used in this study. Strain US1363 Genotype Wild type bar- (unmarked). MATa, ade2-1, trp1-1, can1100, leu2-3, 112, his3-11, 15, ura3, GAL. Psi+, bar1:hisG. It is unmarked bar- version of US841. Source This study US1688 MATa, his3, cdc34-1, leu2, trp1, bar1D:hisG-URA3-hisG. cdc34-1 bar- (Ura-) This study US3335 Mat a, ade2-1 trp1-1 can1-100, leu2-3,112, his3-11, 15 GAL, psi +, SCC1 myc18:: TRP1 Halo test shown this strain is bar+ This study US3538 PDS1-HA3 in WT US 1363 Mat a, PDS1-HA3-URA3, trp1,his3,leu2 This study US4122 Wild type with endogenously tagged Cin8 MATa, CIN8-HA3-HIS3 ade2-1, trp1-1, can1-100, leu2-3, ura3, bar1 GAL. Psi+. This study US4262 MATa, ade2-1, can1-100, leu2-3,112, his3-11,15, GAL, cdc6::hisG, trp1-1, ura3::URA3 GAL-ubiR-CDC6. SCC1myc18:TRP, cdc23-1 This study US4275 MATa, ade2-1, can1-100, leu2-3,112, his3-11,15, GAL, cdc6::hisG, trp1-1, ura3::URA3 GAL-ubiR-CDC6. Simonett a Piatti US4344 MATa, ade2-1, can1-100, leu2-3,112, his3-11,15, GAL, cdc6::hisG, trp1-1, ura3::URA3 GAL-ubiR-CDC6. SCC1myc18:TRP This study US4364 MATa, ade2-1, can1-100, leu2-3,112, his3-11,15, GAL, cdc6::hisG, trp1-1, ura3::URA3 GAL-ubiR-CDC6. PDS1HA:URA3 This study US4366 cdc6∆GalCDC6 CIN8-HA Mat a, GalCDC6:URA3, CIN8-HA:HIS3 bar+ (halo test) This study US4423 MAT a ade2-1, cant1-100, leu2-3,112, his3-11,15, ura3,GAL,cdc6::hisGURA3hisG, trp1-1::TRP1 MET-CDC6 hisGURA3hisG looped out on 5-FOA, Ura- This study US4677 Wild type bar- (unmarked). MATa, ade2-1, trp1-1, can1100, leu2-3, 112, his3-11, 15, ura3, GAL. Psi+, bar1:hisG. It is unmarked bar- version of US841. KIP1-HA transplaced into US 1363 WT This study US5239 cdc34-1 carrying endogenously-tagged CIN8-HA (HISmarked) MATa trp- leu- ura- HIS+ bar- ts at 36˚C. This study US5582 cdc7 deletion (Gal CDC7-3HA integrated into CDC7 locus with Kanamycin marker) One step PCR using pUS2112 as template Mat a, ade2-1 trp1-1 can1-100, leu2-3,112, his3-11, 15 GAL, psi +, SCC1 myc18:: TRP1, checked by southern. Halo test shown this strain is bar+ This study US5585 cdc45 deletion (Gal CDC45-3HA integrated into CDC45 locus with Kanamycin marker) One step PCR using pUS2112 as template Mat a, ade2-1 trp1-1 can1-100, leu2-3,112, his3-11, 15 GAL, psi +, SCC1 myc18:: TRP1, checked by southern. Halo test shown this strain is bar+ This study US5677 cdc34-1 HA3-CDH1. MAT a, bar-, cdc34-1 HA3-CDH1-TRP1, leu2, ura3, his3. This study US5722 cdc34-1 sic1∆:URA3 HA3-CDH1 MAT a bar-, cdc34-1 sic1∆:URA3, HA3-CDH1-TRP1, leu2, his3. This study US5690 cdc34-1 cdc6∆ MET-CDC6 sic1∆ Mat a, cdc34-1 cdc6∆:HIS3 MET-CDC6:TRP1 sic1∆:URA3 This study US6005 cdc34-1 mutant with 3X SPC42-GFP-TRP1. MATa, cdc34-1, 3X SPC42-GFP-TRP1, ura3 leu2, his3. This study US6342 cdc34-1 KIP1-HA3 Mat a, bar-, cdc34-1, KIP1-HA3-HIS3, leu2, trp1, ura3. ts at 37 degree. This study US6343 cdc6∆ KIP1-HA3 MATa, ade2-1, can1-100, leu2-3,112, GAL, cdc6::hisG, trp1-1, ura3::URA3 GAL-ubiR-CDC6, KIP1-HA3-HIS3. This study US6527 MAT a ade2-1, cant1-100, leu2-3,112, his3-11,15, ura3,GAL,cdc6::hisGURA3hisG, trp1-1::TRP1 MET-CDC6 hisGURA3hisG looped out on 5-FOA, so it is Ura-, SCC1cmyc12-KAN This study US6537 MAT a ade2-1, cant1-100, leu2-3,112, his3-11,15, ura3,GAL,cdc6::hisGURA3hisG, trp1-1::TRP1 MET-CDC6 hisGURA3hisG looped out on 5-FOA, SCC1-cmyc12-KAN, pGAL-HA3-PDS1 CEN URA3. This study US6936 Mat a, cdc34-1 cdc6∆:HIS3 MET-CDC6:TRP1 cdh1∆:KAN, SPC72-GFP:LEU2, KIP1HA:Hygromycin This study US6938 Mat a, cdc34-1 cdc6∆:HIS3 MET-CDC6:TRP1 cdh1∆:KAN, SPC72-GFP:LEU2, ASE1HA:Hygromycin This study US7007 MAT a ade2-1, cant1-100, leu2-3,112, his3-11,15, ura3,GAL,cdc6::hisGURA3hisG, trp1-1::TRP1 MET-CDC6 hisGURA3hisG looped out on 5-FOA so it is Ura- Dicentric plasmid URA3 + This study US7008 MAT a ade2-1, cant1-100, leu2-3,112, his3-11,15, ura3,GAL,cdc6::hisGURA3hisG, trp1-1::TRP1 MET-CDC6 hisGURA3hisG looped out on 5-FOA so it is Ura-, Ycplac 33 (5.6 kb)- a URA3 selectable CEN4 plasmid (#1955). This study US7009 Wild type bar- (unmarked). MATa, ade2-1, trp1-1, can1-100, leu2-3, 112, his3-11, 15, ura3, GAL. Psi+, bar1:hisG. It is unmarked bar- version of US841. ASE1-HA in pRS303 at its own locus This study US7010 MAT a ade2-1, cant1-100, leu2-3,112, his3-11,15, ura3,GAL,cdc6::hisGURA3hisG, trp1-1::TRP1 MET-CDC6 hisGURA3hisG looped out on 5-FOA, so it is UraASE1-HA in pRS303 at its own locus This study US7011 cdc34-1 bar- (Ura-) ASE1-HA in pRS303 at its own locus, 3' end tagged with HA; digest with EcoRV for integration at the endogenous locus and select for HIS This study US7012 cdc34-1 cdc6∆ MET-CDC6 Mat a, cdc34-1 cdc6∆:HIS3 MET-CDC6:TRP1 SPC72GFP:LEU2 This study US7013 MAT a ade2-1, cant1-100, leu2-3,112, his3-11,15, ura3,GAL,cdc6::hisGURA3hisG, trp1-1::TRP1 MET-CDC6 hisGURA3hisG looped out on 5-FOA GALndSIC1:URA3 This study US7014 cdc34-1 cdc6∆ MET-CDC6 This Mat a, cdc34-1 cdc6∆:HIS3 MET-CDC6:TRP1 study US7015 Mat a, cdc34-1 CDH1∆:KanMX US7016 cdc34-1 cdc6∆ MET-CDC6 CDH1∆:KanMX Mat a, cdc34-1 cdc6∆:HIS3 MET-CDC6:TRP1 SPC72GFP:LEU2 This study This study US7018 cdc34-1 bar- (Ura-) HA-tagged CIN8 non-degradable version in pUS20 (Ura3 Integrative vector) This study US7019 cdc34-1 bar- (Ura-) ASE1 non-degradable version This study US7020 cdc34-1 CDH1∆:KanMX HA-tagged CIN8 non-degradable version in pUS20 (Ura3 Integrative vector) This study US7021 cdc34-1 CDH1∆:KanMX ASE1 non-degradable version This study US7022 MAT a ade2-1, cant1-100, leu2-3,112, his3-11,15, ura3,GAL,cdc6::hisGURA3hisG, trp1-1::TRP1 MET-CDC6 hisGURA3hisG looped out on 5-FOA, so it is UraGAL-HA-HCT1 on Kan/CEN plasmid, CIN8HA3: HIS This study US7023 MATa, cdc34-1, 3X SPC42-GFP-TRP1, ura3 leu2, his3. Non-degradable version of CIN8 under GAL1-promoter in URA3, CEN plasmid (pUS18) This study US7024 cdc34-1 cdc6∆ MET-CDC6 CDH1∆:KanMX Non-degradable version of Cin8 under GAL1-promoter in URA3, CEN plasmid (pUS18) This study US7025 MATa, cdc34-1, 3X SPC42-GFP-TRP1, ura3 leu2, his3. GAL-KIP1 nd-HA no degradable version in micron URA plasmid. This study US7026 cdc34-1 cdc6∆ MET-CDC6 CDH1∆:KanMX GAL-KIP1 nd-HA no degradable version in micron URA plasmid. MATa, cdc34-1, 3X SPC42-GFP-TRP1, ura3 leu2, his3. GAL-ASE1-cmyc on HIS3, 2µ plasmid. cdc34-1 cdc6∆ MET-CDC6 CDH1∆:KanMX GAL-ASE1-cmyc on HIS3 This study cdc34-1 cdc6∆ MET-CDC6 Mat a, cdc34-1 cdc6∆:HIS3 MET-CDC6:TRP1 This study US7027 US7028 US7029 This study This study SIC1 (p40) c-myc tag under its own promoter in pUS15 (LEU2) US7031 MAT a ade2-1, cant1-100, leu2-3,112, his3-11,15, ura3,GAL,cdc6::hisGURA3hisG, MET-CDC6 trp1-1::TRP1 hisGURA3hisG looped out on 5-FOA so it is Ura-, cin8∆:KanmX This study US7032 MAT a ade2-1, cant1-100, leu2-3,112, his3-11,15, ura3,GAL,cdc6::hisGURA3hisG, trp1-1::TRP1 MET-CDC6 hisGURA3hisG looped out on 5-FOA ase1∆:KanmX, so it is Ura- This study US7033 Mat a, cdc34-1 cdc6∆:HIS3 MET-CDC6:TRP1 cdh1∆:KAN, CIN8-HA on URA3, CEN plasmid. This study US7034 cdc34-1 cdc6∆ MET-CDC6 sic1∆ Mat a, cdc34-1 cdc6∆:HIS3 MET-CDC6:TRP1 sic1∆:URA3 erg6∆::KANMX plasmid. This study US7036 cdc34-1 bar- (Ura-) GAL-ASE1-cmyc on HIS3, 2u plasmid This study US7037 cdc34-1 bar- (Ura-) Gal-Cin8-myc on URA3 CEN plasmid. This study US7038 Mat a, cdc34-1cdh1∆:KAN, GAL-ASE1-cmyc on HIS3, 2u plasmid This study US7039 Mat a, cdc34-1 cdh1∆:KAN, Gal-CIN8-myc on URA3 CEN plasmid. This study US7040 MAT a ade2-1, cant1-100, leu2-3,112, his3-11,15, ura3,GAL,cdc6::hisGURA3hisG, trp1-1::TRP1 MET-CDC6 hisGURA3hisG looped out on 5-FOA so it is Ura-, GAL-ASE1-cmyc on HIS3, 2u plasmid This study US7041 MAT a ade2-1, cant1-100, leu2-3,112, his3-11,15, ura3,GAL,cdc6::hisGURA3hisG, trp1-1::TRP1 MET-CDC6 hisGURA3hisG looped out on 5-FOA so it is Ura-, Gal-CIN8-myc on URA3 CEN plasmid. This study US7042 MAT a ade2-1, cant1-100, leu2-3,112, his3-11,15, ura3,GAL,cdc6::hisGURA3hisG, trp1-1::TRP1 MET-CDC6 hisGURA3hisG looped out on 5-FOA so it is Ura-, cdh1∆:KAN GAL-ASE1-cmyc on HIS3, 2u plasmid MAT a ade2-1, cant1-100, leu2-3,112, his3-11,15, ura3,GAL,cdc6::hisGURA3hisG, This study US7043 This study trp1-1::TRP1 MET-CDC6 hisGURA3hisG looped out on 5FOA, so it is Ura-, cdh1∆:KAN Gal-CIN8-myc on URA3 CEN plasmid. US7044 cdc34-1 bar- (Ura-) GAL-cmyc6-CDC5 on YIPlac 211 (3.79 kb) - a URA3 selectable integrative vector cdc34-1 bar- (Ura-) GAL-cmyc6-CDC5 (N209A) on URA3, integrative plasmid. This study US7046 Mat a, cdc34-1cdh1∆:KAN, GAL-cmyc6-CDC5 on YIPlac 211 (3.79 kb) - a URA3 selectable integrative vector. This study US7047 Mat a, cdc34-1cdh1∆:KAN, GAL-cmyc6-CDC5 (N209A) on URA3, integrative plasmid. This study US7048 Mat a, cdc34-1 cdc6∆:HIS3 MET-CDC6:TRP1 lys1∆:KANMX. This study US7049 MAT a ade2-1, cant1-100, leu2-3,112, his3-11,15, ura3,GAL,cdc6::hisGURA3hisG, trp1-1::TRP1 MET-CDC6 hisGURA3hisG looped out on 5-FOA so it is Ura-, YIPlac211-GAL-cmyc6-CDC5 -URA3 This study US7050 MAT a ade2-1, cant1-100, leu2-3,112, his3-11,15, ura3,GAL,cdc6::hisGURA3hisG, trp1-1::TRP1 MET-CDC6 hisGURA3hisG looped out on 5-FOA so it is Ura-, cdh1∆:KAN YIPlac211-GAL-cmyc6-CDC5 -URA3 This study US7045 This study Table 4. List of plasmids used in this study. Name Description Source pUS18 Ycplac 33 (5.6 kb)- a URA3 selectable CEN4 plasmid US Lab (#1955). pUS639 CIN8-HA on URA3, CEN plasmid. pUS654 SIC1 (p40) c-myc tag under its own promoter in pUS15 US Lab (LEU2, 2µ) pUS785 SIC1 (p40) c-myc triple tag in pUS20 intergrative vector US Lab (URA3, CEN). pUS875 GAL-ASE1-cmyc on HIS3, 2µ plasmid. pUS2700 Dicentric minichromosome pT431 (from Tomo tanaka's Tomo lab) centromere is normal and centromere is under the Tanaka control of Gal-promoter, Tet-operater sequence is inserted inbetween the two centromere. ARS is surrounded by recombinase site, upon expression of recombinase (under Met promoter), the ARS will be looped out. This plasmid is marked by Ura and the selection is by ampicillin-resistence. pUS2170 ASE1-HA in pRS303 at its own locus US Lab US Lab US Lab 3' end tagged with HA; digest with EcoRV for integration at the endogenous locus and select for HIS pUS2199 HA-tagged CIN8 non-degradable version in pUS20 (Ura3 US Lab Integrative vector) pUS2201 ASE1 non-degradable version US Lab pUS1383 GAL-HA-HCT1 on Kan/CEN plasmid US Lab pUS2433 YIPlac211-GAL-cmyc6-CDC5 -URA3 US Lab pUS2216 Non-degradable version of CIN8 under GAL1-promoter US Lab in URA3, CEN plasmid (pUS18) pUS2259 Gal-CIN8-myc on URA3 CEN plasmid. US Lab pUS2560 erg6∆::KANMX plasmid. US Lab pUS2581 GAL-KIP1 nd-HA no degradable version in micron US Lab URA plasmid. pUS2433 GAL-cmyc6-CDC5 on YIPlac 211 (3.79 kb) - a URA3 US Lab selectable integrative vector. pUS2718 GAL-cmyc6-CDC5 plasmid. (N209A) on URA3, integrative US Lab Table 5. List of the main oligonucleotides used in this study. Primer Description OUS2814 5’GGATTTGATGATACCAGTAT3’ Source US Lab to be used with OUS2815 to check 3' tagging of Ase1 by plasmid pUS2170 OUS2815 5’ATTGATGAAGAAGCTGATGA3’ US Lab to be used OUS2814 to check 3' tagging of Ase1 by plasmid pUS2170 OUS1545 5’GGA AAA ATG AGC AAG TTT CGA AAT TGA ATG US Lab GAT TCT CCT TTA CAG ATA TTC GGA TCC CCG GGT TAA TTA A3’ Sequences not underlined belong to top strand of Ase1, just before STOP codon. The underlined sequences correspond to F2 sequences from Yeast 14: 953-961 (1998). To be used with OUS 1546 to generate a 2325 bp PCR product (template pUS 2098, pFA6a-13Myc-KANMX6) for one step tagging of ASE1-cmyc13 at the endogenous locus. OUS1546 5’AAA ATA AAT AAG AGA TCA GAG GGT TAA ATG US Lab AAT GCG CTT TTA AGA AAT GAA TTC GAG CTC GTT TAA AC3’ Sequences not underlined belong to bottom strand of Ase1, just after but not including STOP codon. The underlined sequences correspond to R1 sequences from Yeast 14: 953961 (1998). To be used with OUS 1545 to generate a 2325 bp PCR product (template pUS 2098, pFA6a-13MycKANMX6) for one step tagging of ASE1-cmyc13 at the endogenous locus. OUS1490 5' GCG GGA TCC GAA TGG ATT CTC CTT TAC AG3’ Forward oligo disruption OUS1491 US Lab at 3' end of Ase1 gene for making a 5' GCG GAA TTC CTG GTA TCT AAG GGA ACG G3’ REVERSE oligo at 3' end of Ase1 gene for making a disruption US Lab OUS1165 5’CCAGTGAAAATGTGGACAATGAGGGCTCGAGAA AAATGTTAAAGATTGAATTTCATCTCCGGTTCTGCT GCTAGT 3' US Lab Forward oligo to tag the endogenous copy of cin8 with HA/ myc by one step PCR 50 bp before the stop codon UNDERLINED SEQUENCES ARE THOSE OF THE HA PLASMID OUS1166 5’TACTTTGTTTTTATTAACCACTAGTTTGAATAT3’ US Lab ATATTCGACTGAAAGGCAATATCAA CGTCGACCTCGAGGCCAGAAGACTAAGAGG 3' UNDERLINED SEQUENCES ARE THOSE OF THE HA PLASMID OUS1183 Forward oligo to tag the endogenous kip1 by one step PCR: US Lab 50 BP JUST BEFORE THE STOP CODON 5'AGAAGAAACTGAAAATAATGACATACTGCAAAA TAAAAAACTTCATCAATTTCATCTCCGGTTCTGCTG CTAGT 3' UNDERLINED SEQUENCES ARE THOSE OF THE HA PLASMID OUS1184 Reverse oligo to tag the endogenous kip1 by one step PCR : US Lab 50 BP JUST AFTER THE STOP CODON 5'ACACTCAATGCATATAGTGATACAAATATTTTAC AATGGCTATATCCCCCGTCGACCTCGAGGCCAGAA GACTAAGAGG 3' UNDERLINED SEQUENCES ARE THOSE OF THE HA PLASMID OUS2107 5’GTCACCGGAAGGAGAGCCCTGT3’ PCR with ous2107 and ous2108 to obtain a 2.8kb fragment in wild type CDH1 strain. Designed to test for cdh1 deletion. Primers anneal to 597bp upstream of START and 420bp downstream of STOP. US Lab OUS2108 5’TCGCCCATCCTGACGCCTGTAA3’ US Lab PCR with ous2107 and ous2108 to obtain a 2.8kb fragment in wild type CDH1 strain. Designed to test for cdh1 deletion. Primers anneal to 597bp upstream of START and 420bp downstream of STOP. OUS1540 5’TAG AGG TAT ATT CTC TGG AAG AAC AAT TTT US Lab GG AAT ATT CAG AAC AGA ATT CGA GCT CGT TTA AAC3’ Underlined sequences are identical to F4 primer sequences in Table (yeast 14: 953-961, 1998). The other sequences are identical to cdc6 sequences (-80 to -40 bp). To be used with OUS OUS 1542 and template pUS 2112 (pFA4a- KanMX6- PGAL1-3HA) to generate a ~ 2kb PCR product for one step tagging of GAL-HA3-CDC6 in WT strain. OUS1542 5’ATT TCT TCT GAT ACG CTT AGT TGG AGT TAT US Lab TGG TAT AGC TGA CAT GCA CTG AGC AGC GTA ATC TG3’ Underlined sequences are identical to R3 primer sequences in Table (yeast 14: 953-961, 1998). The other sequences are identical to cdc6 sequences (40 bp downstream of START, including the START codon). To be used with OUS OUS 1540 and template pUS 2112 (pFA4a- KanMX6- PGAL1-3HA) to generate a ~ 2kb PCR product for one step tagging of GAL-HA3-CDC6 in WT strain. OUS2295 Forward oligo to confirm cdc6 disruption US Lab 5' GGCTTGCGATTTGTTGTGTTTTGA 3' 200bp before start, using with ous 2296 to confirm cdc6 disruption. OUS2296 Reverse oligo to confirm cdc6 disruption 5' ATTACGTTTTATTGTGTCTT3' 200bp after stop, using with ous 2295 to confirm cdc6 disruption. US Lab OUS1972 Forward oligo for confirm sic1 disruption. US Lab 5' TCCAGAGGGACTAGGTA 3' used with ous 1973 OUS1973 Reverse oligo for confirm sic1 disruption. US Lab 5' ATATAATCGTTCCAGAAACT 3' used with ous 1972 2.2 Methods 2.2.1 Escherichia coli strains and culture conditions For cloning purposes and plasmid DNA amplification, E. coli DH5α or XL1 Blue cells (Stratagene) were used as bacterial hosts. The E. coli cells were cultured in either 2X TY liquid medium (1.6% bacto- tryptone, 1% bacto- yeast extract, 0.5% NaCl) or on 2X TY plates containing 2% bacto agar at 37oC. 100µg/ml Ampicillin (Sigma) was added to the medium or plates for selection of cells carrying recombinant plasmids. 2.2.2 Yeast strains and culture conditions All Saccharomyces cerevisiae strains were congenic to the background W303 and listed in 3. Mutant strains from other genetic background were made isogenic by backcrossing three times to the parental wild-type strain (W303 background). Yeast cells were grown in YEP medium (1.1% yeast extract, 2.2% peptone and 50mg/l adenine) supplemented with 2% raffinose/ 0.5% glucose, 2% glucose or 2% galactose/2% raffinose depending on the objectives of the experiments. Since deletion of CDC6 is lethal, cdc6Δ cells were kept alive with a methionine-repressible MET-CDC6 or galactose-inducible GAL-CDC6 construct. cdc6Δ MET-CDC6 cells were grown in methionine free synthetic media (0.67% yeast nitrogen base from Difco, amino acid drop out mix) with 2% raffinose/ 0.5% glucose, 2% glucose or 2% galactose/2% raffinose. Whereas, methionine was added to media (at a final concentration of 200 µg/ml) in experiments requiring repression of the MET3 promoter (e.g. shut of CDC6 transcription). Yeast cells were grown in a water bath at 24oC with constant shaking for good aeration at 200rpm. Temperature sensitive mutants were cultured at the permissive temperature of 24oC, but filtered and transferred to various restrictive temperatures (33˚C or 35˚C or 36˚C) depending on strains. Cells treated with proteasome inhibitor MG132 carried an ERG6 disruption to facilitate permeability of the inhibitor. For sporulation, diploid strains were patched onto sporulation plates containing 0.22% yeast extract, 2% potassium acetate and 2% glucose or 2% galactose and 2% raffinose. Recombinant strains were obtained by tetrad analysis. 2.2.3 Cell cycle synchronization For synchronization at G1, S. cerevisiae cells were grown to exponential phase at 24˚C, diluted to OD600 of 0.2 and α-factor was added at a final concentration of µg/ml (for BAR1) cells and µg/ml (for bar1Δ) cells. For synchronization at the pre-nuclear division stage, nocodazole (US Biologicals) was added at a final concentration of 15 µg/ml. The cells were incubated with the drug for about 3-3.5 hours till more than 90% of the cells had arrested with an undivided nucleus and no detectable spindle. 2.2.4 Yeast transformation Yeast transformation was performed by the lithium acetate method. Yeast cultures were grown overnight. Cells were collected and spun down at 3500 rpm for minutes. Subsequently, the pellets were washed once with Li-TE buffer (0.1M lithium acetate, 10mM Tris-HCl pH 7.5, 1mM EDTA) and then resuspended in 2ml of Li-TE buffer. The cells were incubated on a roller at room temperature for hr. For each transformation, 10µl of 1mg/ml salmon sperm DNA, linearized DNA of interest or plasmid DNA, 100µl of cells in Li-TE buffer and 140µl of 70% PEG 6000 were mixed and incubated at 24oC for hrs. This was followed by a heat shock (15mins) at 42oC. Finally, cells were spun down at low speed (1.2K for min), resuspended in 50µl sterile H20 and spread onto the appropriate selective plates. 2.2.5 Isolation of plasmid DNA from yeast S. cerevisiae cultures were grown overnight in ml YEPD medium and cells were harvested by centrifugation. The cells were then resuspended in 0.3 ml of lysis buffer (2% Triton X-100, 1% SDS, 0.1 M NaCl, 10 mM Tris pH8.0 and mM EDTA); 0.3 ml of phenol:chloroform (1:1) and 0.2 ml acid-washed glass beads were subsequently added to the cell suspension before vortexing vigorously for on a IKA Vibrax shaker. After centrifugation, the supernatant was transferred to a fresh tube and extracted twice with phenol:chloroform:isoamylalcohol (25:24:1) before precipitating the plasmid with ethanol. The plasmid DNA was pelleted by centrifugation for 10 min, washed with 70% ethanol, dried and dissolved in 40 µl TE. For amplification of the DNA, µl of the plasmid DNA was used to transform into 20 µl of E. coli XL1Blue cells. 2.2.6 Yeast chromosomal DNA extraction Yeast cells were harvested from ml cultures, washed with ddH20 and resuspended in 0.2 ml of spheroplasting mix containing 80% SCE (1M Sorbitol, 0.1 M sodium citrate, 0.06 M EDTA, pH 7.0), 10% lyticase and 10% β-mercaptoethanol. The mixture was incubated at 37oC with occasional shaking for hr or more when required (cells were checked under microscope for complete digestion of cell). After verifying that spheroplasting was complete, 0.2ml SDS solution (2% SDS, 0.1M TrisHCl, 0.05M EDTA) was added to the mixture and the mixture was heated at 65oC for 5mins to allow lysis. This was followed by addition of 0.2ml 5M KOAc and the mixture incubated on ice for 20mins. The mixture was centrifuged at 13000rpm for 5mins. The supernatant was transferred to a fresh tube containing 0.2ml 5M NH4OAc and 1ml isopropanol and the DNA precipitated in dry ice for 5mins. The tubes were mixed by inverting and chromosomal DNA was pelleted by centrifugation for a few seconds at low speed centrifugation, washed once in 70% ethanol, and dissolved in 50µl TE or ddH20 after removing all traces of isopropanol. To confirm proper integration by PCR methods, µl of the chromosomal DNA was diluted in µl with distilled water. 2.2.7 Southern blot analysis Chromosomal DNA was digested at 37oC (> 12 hrs) in a total volume of 100µl. The restriction enzyme digest was set up as follows: 10µl DNA, 10µl 10X restriction buffer, 1µl EcoR1, 1µl 10mg/ml RNAse and 78µl sterile water. The digested DNA was precipitated by addition of 10µl 3M sodium acetate (pH 5.2), 1µl 0.5M EDTA (pH 8) and 200µl cold ethanol in dry ice for a minimum of 10mins. The samples were centrifuged at 13000rpm for 10mins. The supernatant was discarded and the pellets rinsed in 80% ethanol. The DNA pellet was dried and dissolved in 15µl 1X gel loading buffer (6X gel loading buffer: 0.25% bromophenol blue, 0.25% xylene cyanol FF, 15% Ficoll [Type 400; Pharmacia] in water). The restriction enzyme digested yeast chromosomal DNA samples were size fractionated on a 1% agarose gel in 1X TBE (Tris-borate/ EDTA; 0.09M Tris-borate, 0.002M EDTA) running buffer. A few µl of ethidium bromide (10mg/ml) was added to the gel to stain the DNA fragments. The DNA fragments were imaged using a UVIdoc gel documentation system (Uvitec, Cambridge). Subsequently, the gel was denatured with 0.5N NaOH, 1.5M NaCl for hr and neutralized with 1M TrisHCl (pH 7.4), 1.5M NaCl for hr. The DNA was then transferred onto nylon membrane (Amersham Hybond N, GE Healthcare) using 20X SSC as the transfer buffer as described by Sambrook et al 1989 (Sambrook et al. 1989). After the 18 h transfer, the membrane was baked for h at 80˚C and this was followed by a UV cross-linking step in order to immobilize DNA onto the membrane. The membrane was then prehybridized in a Hybaid rotary oven in a 20 ml prehybridization solution for a minimum of hr and hybridized overnight at 65oC with purified radioactive α-32P dATP labeled probe (prepared using random priming kit from Roche Boehringer Mannheim and radioactive label from NEN) in hybridization solution. The membrane was washed in 2X SSC containing 0.1% SDS at 65˚C. This was followed by several washes in 0.1X SSC containing 0.1% SDS at 55˚C until the background count was negligible. Finally, the membrane was exposed to X-ray film at -80˚C. 2.2.8 Immunofluorescent staining (IF) Indirect immunofluorescence analysis was performed with synchronized yeast cells. Yeast samples were immediately fixed with 3.7% formaldehyde, collected by centrifugation and, resuspended in 1ml KPF buffer (0.1M KH2PO4 pH6.4, 3.7% formaldehyde). After 1-2 hours at room temperature or overnight fixation at 4˚C, the cells were harvested and washed times with 0.1 M KH2PO4 pH 6.4 to remove all traces of formaldehyde. Subsequently the cells were washed once in 1ml sorbitol phosphor-citrate buffer (1.2 M sorbitol, 0.1M K2HPO4 pH5.9) and stored in the same buffer at 4˚C. The yeast cells were suspended in 0.2ml 1.2 M sorbitol phosphorcitrate buffer and spheroplasted by treatment with 20 µl glusulase and µl 10mg/ml lyticase in the sorbitol phosphor-citrate buffer at 37oC for 15-90 mins. Following complete spheroplasting, cells were washed once in sorbitol-citrate solution and resuspended in 20µl of the same buffer. 5µl of cells were immobilized for in situ immunofluorescence by transferring them onto a multi-well slide previously coated with 0.1% polylysine (Sigma). After aspirating excess cells, the slide was immersed into methanol at -20oC for mins, followed by immersion in acetone at -20oC for 30 secs. Next, the slide was air-dried and the cells were first preincubated with BSAPBS (PBS containing mg/ml BSA) solution for min. Subsequently, the cells were incubated with primary antibody diluted in BSA-PBS either overnight at 4oC or for h at 30˚C. Cells were then washed times with PBS-BSA (1% BSA, 0.04M K2HPO4, 0.01M-KH2PO4, 0.15M-NaCl, 0.1% NaN3) and incubated with appropriate secondary antibodies for hrs at 30 oC. All incubations with antibodies were carried out in dark moist chambers. Cells were again washed three times in BSA-PBS before mounting in antifade solution Vectashield (Vector Laboratories) containing DAPI (4’,6 diamidino-2-phenylindole ) for visualizing DNA. Cover slips were added to protect the samples and the cover slips sealed in place with nail polish. For visualization of tubulin, rat monoclonal anti-tubulin YOL1/34 was the primary antibody (Serotec) and Alexa Fluor 594 goat anti- rat IgG (Invitrogen, Molecular Probes) the secondary antibody. All cells were observed and photographed using the Leica DMRX Microscope connected to a Hamamatsu charge-coupled device camera driven by the Metamorph software (Universal Imaging Corporation). 2.2.9 Microscopy Cells collected at various time points were frozen immediately in dry ice without fixation and stored until further use. Cells were later thawed and mounted on slides with Vectashield containing DAPI (Molecular Probes). The images were captured using a Zeiss AxioImager upright motorized microscope with Plan Apochromat 100X objective equipped with EXFO 120W metal halide illuminator and attached to a Photometrics CoolSNAP HQ2 high sensitivity monochrome camera driven by the Metamorph software (Universal Imaging Corporation) or Zeiss Axiovert 200M Microscope connected to a Photometrics COOLSNAP HQ digital camera driven by Metamorph software. For time-lapse imaging, cells were placed between a cover slip and a thin slab of 2% agarose containing 2% glucose in low immunofluorescence yeast nitrogen base with complete drop-out medium supplemented with adenine. Microscopy was performed in an enclosed chamber maintained at 25˚C or 35˚C with a Zeiss Axio inverted microscope equipped with a Plan-Apochromat 100X objective and a Yokogawa CSU22 spinning disk confocal system with dual line argon krypton ion laser (wavelength 488 nm / 568 nm). Stack images were taken at 30 s intervals (7 planes spaced 0.5 µm apart) with a Cascade:512B camera (Roper Scientific, Trenton, NJ), acquired and analyzed with Metamorph software (Universal Imaging Downington, PA). Spindle lengths were measured as pole-to-pole distances using the Caliper function in Metamorph software. 2.2.10 Flow cytometry analysis (FACS) Cell samples were collected from liquid cultures for analyzing the distribution and content of DNA by fixing cells in 1ml 70% ethanol and incubated at room temperature for hr or overnight at 4oC. After fixation, cells were washed with 0.2M Tris-HCl pH7.5, 20mM EDTA, and resuspended in 100µl 0.2M Tris-HCl pH7.5, 20mM EDTA, 0.1% RNase A (1mg/ml), before incubating at 37oC for hrs. The samples were washed 1X in PBS and incubated in 0.1ml PI solution (50mg/ml propidium iodide in PBS) at 4oC overnight. The samples were diluted by addition of 900µl PBS and samples were sonicated for secs. The DNA content was determined using the FAC Scan flow cytometer (Becton Dickinson Immunocytometry Systems, USA). The data was analyzed using WinMDI program. 2.2.11 Preparation of cell extracts for Protein analysis 2.2.11.1 Protein extraction using Tri-Chloroacetic Acid (TCA) Cells harvested at various time-points were resuspended in ml ice-cold ddH20. Next, the samples are normalized to absorbance of 2.0 at OD600 (1 ml final volume). To each normalized sample, 150µl YEX lysis buffer (1.85 M NaOH, 7.5% βmercaptoethanol) was added. After 10 mins’ incubation on ice, 150µl 50% TCA was subsequently added and the mixture again incubated on ice for 10mins. The precipitate was collected by centrifugation at 4oC for 10mins at 13000rpm and resuspended in 50µl of 1X gel loading buffer and 10µl 1M Tris-HCl (pH 8.0). The samples were boiled for 5mins, and 8µl were loaded onto SDS-PAGE gels for Western blot analysis. 2.2.11.2 Protein extraction using acid-washed glass beads For immunoprecipitation, protein was extracted using acid washed glass beads. Cells were spun down and washed once with Stop Mix buffer (0.9%NaCl, 1mM NaN3, 10mM EDTA, and 50mM NaF). Cell pellets were immediately frozen by liquid nitrogen, and stored in -20oC for later use. Cell pellets were later thawed on ice. 0.2 ml of ice cold lysis buffer with protease inhibitors (1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 50mM Tris- HCl pH 7.2, 1mM PMSF, 20µg/ml leupeptin, 40µg/ml aprotinin, 0.1mM Na-orthovanadate, 15mM p-nitrophenylphosphate) and 150-200µl of acid-washed glass beads (Biospec) were added. The cells were lysed by vigorous vortexing at 4oC (IKA-Vibrax shaker). After centrifugation at 4oC for 15 mins at 13000 rpm, the supernatant was transferred to a fresh Eppendorf tube, quick frozen in liquid nitrogen and stored at -80oC for later use. Protein concentration was determined by using the Bradford Protein Assay (Bio-Rad) according to manufacturer’s instructions. 2.2.12 Western blot analysis Protein samples were resolved by sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) using 10% acrylamide:bis-acrylamide (29:1) gels. The proteins resolved on SDS-PAGE were then transferred onto Hybond-C nitrocellulose membrane (Amersham) using the Biorad Wet Transfer system in transfer buffer (48 mM Tris, 39 mM glycine, 10% methanol). The membrane was then incubated 3X 10 in blocking buffer (PBS containing 0.1% Tween-20 and 3% skimmed milk) at room temperature. It was then incubated overnight at 4˚C or h at room temperature with the primary antibody in PBS-Tween containing 3% skimmed milk. It was then washed with three changes of PBS-Tween for 10 mins and subsequently incubated in PBS containing 3% skimmed milk and the horseradish peroxidase-conjugated secondary antibody (Amersham; 1:5000 or 1:10000 dilution) for h at room temperature. The membrane was then washed with three changes of PBS-Tween for 10 mins and subsequently in PBS for mins. Antibody-antigen complexes were visualized using the Enhanced Chemiluminescence (ECL) system (Santa Cruz biotechnology). 2.2.13 Immunoprecipitation Collected samples were lysed using the glass bead method as described above; the lysis buffer was modified: NP40 buffer (20mM Tris HCl pH 8, 150mM NaCl, 10% glycerol (Fresh), 1% Nonidet P-40 or NP-40, 2mM EDTA, 1mM DTT) supplemented with protease inhibitors (1mM PMSF, 20µg/ml leupeptin, 40µg/ml aprotinin, 0.1mM Na-orthovanadate, 15mM p-nitrophenylphosphate). Next, 1mg of cell lysate was transferred to an Eppendorf tube containing 40µl of antibody-conjugated beads (Santa Cruz). The final volume was adjusted to 1ml with lysis buffer containing protease inhibitors so that the cell lysate can interact with the antibody-conjugated beads completely. This was followed by 3-4 hrs of incubation in a roller at 4oC. The beads were then washed 4-6 times with either RIPA buffer (1% Triton X-100, 1% Nadeoxycholate, 0.1%SDS, 150 mM NaCl and 50 mM Tris-HCl pH 7.2) or low salt buffer (50 mM Tris-HCl pH7.5 and 50 mM NaCl). After removing all the remaining supernatant, 5µl of 5× gel loading buffer was added to the beads. The samples were heat inactivated by boiling for 5mins and loaded for SDS- PAGE electrophoresis and subsequent Western blot analysis. 2.2.14 PCR-based strategy for fluorescent protein and epitope tagging of yeast genes Long template PCR system (Roche) was used to amplify the cassettes for fluorescent protein and epitope tagging following the manufacturer’s instructions. These amplified cassettes are 5’-(gene specific sequence)- GGTGACGGTGCTGGTTTA-3’ F5 and 5’-(gene specific sequence)- TCGATGAATTCGAGCTCG-3’ R3 for fluorescent protein tagging; ATCGATGAATTCGAGCTCG-3’ and 5’-(gene specific sequence)- and 5’-(gene specific sequence)- CGTACGCTGCAGGTCGAC-3’ for epitope protein tagging. The forward primer consisted of the 60 3’ nucleotides of the gene to be tagged (excluding the stop codon) fused to F5 or S2; the reverse primer consisted of the reverse complement of the 60 nucleotides 3’ of the stop codon fused to R3 or S3. After PCR purification (Qiagen PCR kit), all purified PCR product was transformed into yeast cells plated on selective drop-out plates. Tagging of the targeted gene was confirmed by Southern blot and colony PCR to confirm integration of gene at its own locus (Janke et al. 2004; Sheff and Thorn 2004). 2.2.15 Pulse-chase assay For investigating the stability of proteins, G1-sunchronized cells were released into galactose medium at the appropriate temperatures for 30-60 mins to induce GAL1driven expression. For monitoring of the fate of the pulse, cells were then transferred to medium containing 2% glucose and cycloheximide (1 mg/ml) to repress transcription and translation respectively. Proteins were extracted from whole-cell lysates and results were analyzed by Western blotting. 2.2.16 Sample preparation for SILAC mass spectrometry Samples for mass spectrometry were prepared as described in (de Godoy et al. 2008; Gruhler and Kratchmarova 2008). To prepare samples for SILAC (Ong et al. 2002), the yeast strains must be defective in endogenous lysine or arginine production, thus facilitating the incorporation of exogenous amino acids. Therefore, we only deleted LYS1 as the strain we used is not viable in both ARG4 and LYS1 deletion. Control yeast strain was grown overnight in liquid labeling medium (6.7% Yeast nitrogen base and 30mg/L [13C6/15N2] H-lysine, Cambridge Isotope Laboratories, and other normal amino acid mix), while the other strain was grown in non-labeling medium (6.7% Yeast nitrogen base supplemented with complete normal amino acid mix including 30mg/L unlabeled lysine). Both cultures were supplemented with the desired carbon source. Samples were collected and frozen in liquid nitrogen immediately. The samples were thawed on ice, and the total proteins were extracted using the glass bead method (refer to Section 2.2.11.2). Prior to boiling, the beads were resuspended in sample buffer (NuPAGE LDS Sample Buffer, Invitrogen). Finally, the protein samples were sent to our collaborator (Dr Gunraratne from Walter Blackstock’ Lab) for subsequent 1D gel electrophoresis, in-gel trypsin digestion and mass spectrometric analysis. [...]... 5’CCAGTGAAAATGTGGACAATGAGGGCTCGAGAA AAATGTTAAAGATTGAATTTCATCTCCGGTTCTGCT GCTAGT 3' US Lab Forward oligo to tag the endogenous copy of cin8 with HA/ myc by one step PCR 50 bp before the stop codon UNDERLINED SEQUENCES ARE THOSE OF THE HA PLASMID OUS1166 5’TACTTTGTTTTTATTAACCACTAGTTTGAATAT3’ US Lab ATATTCGACTGAAAGGCAATATCAA CGTCGACCTCGAGGCCAGAAGACTAAGAGG 3' UNDERLINED SEQUENCES ARE THOSE OF THE HA PLASMID... Forward oligo to tag the endogenous kip1 by one step PCR: US Lab 50 BP JUST BEFORE THE STOP CODON 5'AGAAGAAACTGAAAATAATGACATACTGCAAAA TAAAAAACTTCATCAATTTCATCTCCGGTTCTGCTG CTAGT 3' UNDERLINED SEQUENCES ARE THOSE OF THE HA PLASMID OUS1184 Reverse oligo to tag the endogenous kip1 by one step PCR : US Lab 50 BP JUST AFTER THE STOP CODON 5'ACACTCAATGCATATAGTGATACAAATATTTTAC AATGGCTATATCCCCCGTCGACCTCGAGGCCAGAA... synchronization For synchronization at G1, S cerevisiae cells were grown to exponential phase at 24 ˚C, diluted to OD600 of 0 .2 and α-factor was added at a final concentration of 5 µg/ml (for BAR1) cells and 1 µg/ml (for bar1Δ) cells For synchronization at the pre-nuclear division stage, nocodazole (US Biologicals) was added at a final concentration of 15 µg/ml The cells were incubated with the drug for about... AATGGCTATATCCCCCGTCGACCTCGAGGCCAGAA GACTAAGAGG 3' UNDERLINED SEQUENCES ARE THOSE OF THE HA PLASMID OUS2107 5’GTCACCGGAAGGAGAGCCCTGT3’ PCR with ous2107 and ous2108 to obtain a 2. 8kb fragment in wild type CDH1 strain Designed to test for cdh1 deletion Primers anneal to 597bp upstream of START and 420 bp downstream of STOP US Lab OUS2108 5’TCGCCCATCCTGACGCCTGTAA3’ US Lab PCR with ous2107 and ous2108 to obtain a 2. 8kb fragment in... temperatures (33˚C or 35˚C or 36˚C) depending on strains Cells treated with proteasome inhibitor MG1 32 carried an ERG6 disruption to facilitate permeability of the inhibitor For sporulation, diploid strains were patched onto sporulation plates containing 0 .22 % yeast extract, 2% potassium acetate and 2% glucose or 2% galactose and 2% raffinose Recombinant strains were obtained by tetrad analysis 2. 2.3... 5' ATTACGTTTTATTGTGTCTT3' 20 0bp after stop, using with ous 22 95 to confirm cdc6 disruption US Lab OUS19 72 Forward oligo for confirm sic1 disruption US Lab 5' TCCAGAGGGACTAGGTA 3' used with ous 1973 OUS1973 Reverse oligo for confirm sic1 disruption US Lab 5' ATATAATCGTTCCAGAAACT 3' used with ous 19 72 2 .2 Methods 2. 2.1 Escherichia coli strains and culture conditions For cloning purposes and plasmid DNA... confocal system with dual line argon krypton ion laser (wavelength 488 nm / 568 nm) Stack images were taken at 30 s intervals (7 planes spaced 0.5 µm apart) with a Cascade:512B camera (Roper Scientific, Trenton, NJ), acquired and analyzed with Metamorph software (Universal Imaging Downington, PA) Spindle lengths were measured as pole-to-pole distances using the Caliper function in Metamorph software... used with OUS OUS 15 42 and template pUS 21 12 (pFA 4a- KanMX6- PGAL1-3HA) to generate a ~ 2kb PCR product for one step tagging of GAL-HA3-CDC6 in WT strain OUS15 42 5’ATT TCT TCT GAT ACG CTT AGT TGG AGT TAT US Lab TGG TAT AGC TGA CAT GCA CTG AGC AGC GTA ATC TG3’ Underlined sequences are identical to R3 primer sequences in Table 1 (yeast 14: 953-961, 1998) The other sequences are identical to cdc6 sequences... raffinose Whereas, methionine was added to media (at a final concentration of 20 0 µg/ml) in experiments requiring repression of the MET3 promoter (e.g shut of CDC6 transcription) Yeast cells were grown in a water bath at 24 oC with constant shaking for good aeration at 20 0rpm Temperature sensitive mutants were cultured at the permissive temperature of 24 oC, but filtered and transferred to various restrictive... downstream of START, including the START codon) To be used with OUS OUS 1540 and template pUS 21 12 (pFA 4a- KanMX6- PGAL1-3HA) to generate a ~ 2kb PCR product for one step tagging of GAL-HA3-CDC6 in WT strain OUS 229 5 Forward oligo to confirm cdc6 disruption US Lab 5' GGCTTGCGATTTGTTGTGTTTTGA 3' 20 0bp before start, using with ous 22 96 to confirm cdc6 disruption OUS 229 6 Reverse oligo to confirm cdc6 disruption . by one step PCR: 50 BP JUST BEFORE THE STOP CODON 5'AGAAGAAACTGAAAATAATGACATACTGCAAAA TAAAAAACTTCATCAATTTCATCTCCGGTTCTGCTG CTAGT 3' UNDERLINED SEQUENCES ARE THOSE OF THE HA PLASMID. 5’TACTTTGTTTTTATTAACCACTAGTTTGAATAT3’ ATATTCGACTGAAAGGCAATATCAA CGTCGACCTCGAGGCCAGAAGACTAAGAGG 3' UNDERLINED SEQUENCES ARE THOSE OF THE HA PLASMID US Lab OUS1183 Forward oligo to tag the. pFA 6a- 13Myc-KANMX6) for one step tagging of ASE1-cmyc 13 at the endogenous locus. US Lab OUS1546 5’AAA ATA AAT AAG AGA TCA GAG GGT TAA ATG AAT GCG CTT TTA AGA AAT GAA TTC GAG CTC GTT TAA AC3’ Sequences