PHÂN LẬP GEN LTP Ở HAI GIỐNG ĐẬU XANH CÓ KHẢ NĂNG CHỊU HẠN KHÁC NHAU

20 183 0
  • Loading ...
1/20 trang

Thông tin tài liệu

Ngày đăng: 01/03/2015, 08:45

Tài liệu chia sẻ tại: wWw.SinhHoc.edu.vn TRƯỜNG ĐẠI HỌC KHOA HỌC TRƯỜNG ĐẠI HỌC KHOA HỌC KHOA KHOA HỌC SỰ SỐNG KHOA KHOA HỌC SỰ SỐNG ĐỀ TÀI SINH VIÊN NGHIÊN CỨU KHOA HỌC ĐỀ TÀI SINH VIÊN NGHIÊN CỨU KHOA HỌC PHÂN LẬP GEN LTP Ở HAI GIỐNG ĐẬU XANH CÓ KHẢ NĂNG CHỊU HẠN KHÁC NHAU Sinh viên thực hiện: Nguyễn Thị Lệ Người hướng dẫn khoa học: TS. Nguyễn Vũ Thanh Thanh Thái Nguyên, tháng 5 năm 2012 Tài liệu chia sẻ tại: wWw.SinhHoc.edu.vn NỘI DUNG BÁO CÁO NỘI DUNG BÁO CÁO 1. MỞ ĐẦU 2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 3. KẾT QUẢ VÀ THẢO LUẬN 4. KẾT LUẬN VÀ KIẾN NGHỊ Tài liệu chia sẻ tại: wWw.SinhHoc.edu.vn M Đ UỞ Ầ M Đ UỞ Ầ 1.1. ĐẶT VẤN ĐỀ - Đậu xanh (Vigna radiata (L.) Wilczek): kinh tế và dinh dưỡng - Cải tạo đất - Hạn hán ảnh hưởng đến năng suất, chất lượng cây đậu xanh. - Việc chọn các giống chịu hạn và nâng cao tính chịu hạn của cây đậu xanh là vấn đề cần thiết. - Các nghiên cứu đều thống nhất rằng đặc tính chịu hạn của cây trồng rất phức tạp do nhiều gen quy định, trong đó có gen LTP (Lipid Transfer Protein) Tài liệu chia sẻ tại: wWw.SinhHoc.edu.vn M Đ UỞ Ầ M Đ UỞ Ầ - LTP tham gia vào quá trình sinh tổng hợp biểu bì ở thực vật giúp hạn chế sự mất nước trong điều kiện khô hạn. - Gen LTP điều khiển và tổng hợp nên protein tương ứng tham gia xúc tác sự vận chuyển phospholipid giữa các lớp màng tế bào, hỗ trợ việc tạo ra các lớp sáp hoặc lớp biểu bì giúp cây hạn chế mất nước. - Nhằm xác định chỉ thị phân tử liên quan đến khả năng chịu hạn ở gen LTP nên chúng tôi tiến hành đề tài “Phân lập gen LTP ở hai giống đậu xanh có khả năng chịu hạn khác nhau”. Tài liệu chia sẻ tại: wWw.SinhHoc.edu.vn MỞ ĐẦU MỞ ĐẦU 1.2. MỤC TIÊU NGHIÊN CỨU - Phân lập gen LTP ở hai giống đậu xanh địa phương có khả chịu hạn khác nhau từ genome. 1.3. NỘI DUNG NGHIÊN CỨU - Tách DNA tổng số từ lá non của hai giống đậu xanh TS (Tân Sơn) và BK (Bắc Kạn). - Khuếch đại gen LTP bằng phản ứng PCR với cặp mồi đặc hiệu. - Tách plasmid tái tổ hợp mang gen LTP ở hai giống đậu xanh TS và BK. Tài liệu chia sẻ tại: wWw.SinhHoc.edu.vn 2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 2.1. VẬT LIỆU NGHIÊN CỨU - Hai giống đậu xanh địa phương Tân Sơn (TS) và Bắc Kạn (BK) TS BK Hình 2.1. Hình ảnh hai giống đậu xanh TS va BK Tài liệu chia sẻ tại: wWw.SinhHoc.edu.vn 2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN 2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU CỨU 2.2. PHƯƠNG PHÁP NGHIÊN CỨU 2.2.1. Phương pháp tách DNA trực tiếp từ lá non đậu xanh (theo Gawel và Jarret, 1991) 2.2.2. Khuếch đại gen LTP đặc hiệu bằng phản ứng PCR (theo Mullis và cs, 1985) Bảng 2.1. Trình tự cặp mồi khuếch đại gen LTP Gen Cặp mồi Trình tự mồi Kích thước sản phẩm PCR (bp) LTP LTP – F LTP – R ATGGCTAGCCTGAATGTTGC TTACTTGATGTTAGCGCAGTT 350 Tài liệu chia sẻ tại: wWw.SinhHoc.edu.vn 2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN 2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU CỨU STT Thành phần Thể tích (µl) 1 Nước khử ion 11 2 PCR Buffer (10X) 2,5 3 MgCl 2 (25 mM) 2,5 4 DNTP S (25 mM) 2 5 Mồi xuôi (10 pM/µl) 2 6 Mồi ngược (10 pM/µl) 2 7 DNA khuôn (50 ng/µl) 2 8 Taq polymerase (unit/µl) 1 9 Tổng thể tích 25 Bảng 2.2. Thành phần phản ứng PCR 2.2. PHƯƠNG PHÁP NGHIÊN CỨU Tài liệu chia sẻ tại: wWw.SinhHoc.edu.vn 2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN 2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU CỨU Các bước Nhiệt độ Thời gian Số chu kỳ Tác dụng 1 94 0 C 3 phút 1 Biến tính 2 94 0 C 52 0 C 72 0 C 30 giây 1 phút 1 phút 30 Biến tính Gắn mồi Tổng hợp chuỗi 3 72 o C 10 phút 1 Tổng hợp chuỗi 4 4 0 C ∞ Ổn định mẫu Bảng 2.3. Chu trình nhiệt phản ứng PCR 2.2. PHƯƠNG PHÁP NGHIÊN CỨU Tài liệu chia sẻ tại: wWw.SinhHoc.edu.vn 2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN 2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU CỨU 2.2. PHƯƠNG PHÁP NGHIÊN CỨU 2.2.3. Thôi gel bằng bộ kit của hãng Bioneer 2.2.4. Tách dòng gen LTP Quy trình tách dòng gen được thực hiện như sau: Gắn gen LTP vào vector tạo dòng pBT Biến nạp vector tái tổ hợp vào tế bào khả biến chủng E.coli DH5α Kiểm tra sản phẩm chọn dòng bằng phản ứng PCR Hình 2.2. Sơ đồ tách dòng gen LTP ở đậu xanh [...]... của hai giống đậu xan TS và BK - Khuếch đại thành công gen LTP ở hai giống đậu xanh TS và BK bằng phản PCR với kích thước khoảng 350 bp - Chọn được dòng vi khuẩn E.coli DH5α mang vector tái tổ hợp (pBT LTP) và tách được plasmid mang đoạn gen LTP ở hai giống đậu xanh TS và BK Tài liệu chia sẻ tại: wWw.SinhHoc.edu.vn 4 KẾT LUẬN VÀ KIẾN NGHỊ 4.2 KIẾN NGHỊ Xác định trình tự gen LTP của các giống đậu xanh. .. KẾT QUẢ VÀ THẢO LUẬN 3.4 KẾT QUẢ TÁCH DÒNG GEN LTP Ở ĐẬU XANH M 1 2 ← 350 bp Hình 3.4 Hình ảnh điện di kết quả tách dòng gen LTP của hai giống đậu xanh TS và BK Marker 1kb; 1.TS; 2 BK Tài liệu chiaKẾT QUẢ VÀ THẢO LUẬN sẻ tại: wWw.SinhHoc.edu.vn 3 3.5 KẾT QUẢ TÁCH PLASMID TÁI TỔ HỢP 1 2 Hình 3.5 Hình ảnh điện di plasmid tái tổ hợp mang gen LTP ở hai giống đậu xanh TS và BK 1 TS, 2 BK Tài liệu chiaKẾT... QUẢ VÀ THẢO LUẬN 3.2 KẾT QUẢ KHUẾCH ĐẠI GEN LTP BẰNG PHẢN ỨNG PCR M 1 2 ←350 bp Hình 3.2 Hình ảnh điện di sản phẩm PCR nhân gen LTP của hai giống đậu xanh TS và BK M Marker 1kb; 1 TS; 2 BK Tài liệu chia sẻ tại: wWw.SinhHoc.edu.vn 3 KẾT QUẢ VÀ THẢO LUẬN 3.3 KẾT QUẢ TINH SẠCH SẢN PHẨM PCR M 1 2 ← 350 bp Hình 3.3 Hình ảnh điện di kết quả thôi gel của hai giống đậu xanh TS và BK Marker 1kb; 1 TS; 2 BK Tài... biến nạp ở 420C đúng 1 phút - Nuôi khuẩn: Chọn khuẩn lạc có màu trắng nuôi trong môi trường LB lỏng, có bổ sung ampicilin, qua đêm Kiểm tra sản phẩm chọn dòng 2.2.5 Tách plasmid tái tổ hợp bằng bộ kít của hãng Bioneer Tài liệu chia sẻ tại: wWw.SinhHoc.edu.vn 3 KẾT QUẢ VÀ THẢO LUẬN 3.1 KẾT QUẢ TÁCH DNA TRỰC TIẾP TỪ LÁ NON ĐẬU XANH 1 2 Hình 3.1 Hình ảnh điện di DNA tổng số của hai giống đậu xanh TS và... chia sẻ tại: wWw.SinhHoc.edu.vn 4 KẾT LUẬN VÀ KIẾN NGHỊ 4.2 KIẾN NGHỊ Xác định trình tự gen LTP của các giống đậu xanh đã tách dòng để tìm kiếm chỉ thị phân tử liên quan đến tính chịu hạn của cây đậu xanh nhằm phục vụ công tác chọn tạo giống đậu xanh chống chịu tốt Tài liệu chia sẻ tại: wWw.SinhHoc.edu.vn ... phần phản ứng gắn gen vào vector tách dòng pBT STT Thành phần Thể tích (µl) 1 Buffer T4 ligase (10X) 2 2 DNA 6 3 Vector pBT 1 4 Enzyme T4 ligase (2 unit/ µl) 1 5 Nước khử ion 10 Tổng thể tích 20,0 Lai ở 220C trong 1,5 giờ tạo vector tái tổ hợp Tài2 VẬT LIỆU tại: PHƯƠNG PHÁP NGHIÊN liệu chia sẻ VÀ wWw.SinhHoc.edu.vn CỨU 2.2 PH ƯƠNG PHÁP NGHIÊN C ỨU - Biến nạp vector tái tổ hợp vào tế bào khả biến chủng
- Xem thêm -

Xem thêm: PHÂN LẬP GEN LTP Ở HAI GIỐNG ĐẬU XANH CÓ KHẢ NĂNG CHỊU HẠN KHÁC NHAU, PHÂN LẬP GEN LTP Ở HAI GIỐNG ĐẬU XANH CÓ KHẢ NĂNG CHỊU HẠN KHÁC NHAU, PHÂN LẬP GEN LTP Ở HAI GIỐNG ĐẬU XANH CÓ KHẢ NĂNG CHỊU HẠN KHÁC NHAU, VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU, KẾT QUẢ VÀ THẢO LUẬN

Từ khóa liên quan

Gợi ý tài liệu liên quan cho bạn

Nhận lời giải ngay chưa đến 10 phút Đăng bài tập ngay