Luận văn : XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV-1 GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR part 7 doc

6 333 0
  • Loading ...
1/6 trang

Thông tin tài liệu

Ngày đăng: 28/07/2014, 04:20

61 24. Sether D.M., Hu J.S., 2002. Closterovirus infection and mealybug exposure are necessary for the development of mealybug wilt of pineapple disease. Phytopathology 92: 928 – 935. 25. Ullman D.E., German T.L., Gunashinge U.B., and Ebesu R.H., 1989. Serology of a closteroviruslike particle associated with mealybug wilt of pineapple. Phytopathology 79: 1341 - 1345. 26. Wakman W., Teakle D., Thomas J.E., and Dietzgen R.G., 1995. Presence of closterolike – virus and a bacilliform virus in pineapple plants in Queensland. Aust. J. Agric. Sci. 46: 947 – 958. CÁC TRANG WEB http://www2.ctahr.hawaii.edu/ t-star/mealybug.htm http://www.bromeliadbiota.ifas.ufl.edu http://www.ncbi.nlm.nih.gov/BLAST/ http://www.scitools.idtdna.com/scitools/Applications/OligoAnalyzer/ 62 PHỤ LỤC 1 Các cấu trúc thứ cấp của cặp primer 225, 226 kiểm tra bằng phần mềm Oligo Analyzer 1. Các cấu trúc kẹp tóc (hairpin) Primer Delta G (kcal/mole) Base pair Cấu trúc hairpin 225 -0,14 2 ACAGGAAGG || :A CACTCACAAC 226 -0,21 2 CGCACAAA || ::C CTAACGAACTT 2. Các cấu trúc hetero dimer Delta G (kcal/mole) Base pair Cấu trúc hetero dimer -5.12 -1,94 -1,6 -1,6 -1,57 -1,57 -1,57 4 2 2 2 2 2 2 5' ACAGGAAGGACAACACTCAC : |||| 3' CTAACGAACTTCAAACACGC 5' ACAGGAAGGACAACACTCAC || : 3' CTAACGAACTTCAAACACGC 5' ACAGGAAGGACAACACTCAC || : : 3' CTAACGAACTTCAAACACGC 5' ACAGGAAGGACAACACTCAC : || 3' CTAACGAACTTCAAACACGC 5' ACAGGAAGGACAACACTCAC : || : 3' CTAACGAACTTCAAACACGC 5' ACAGGAAGGACAACACTCAC || : : : 3' CTAACGAACTTCAAACACGC 5' ACAGGAAGGACAACACTCAC || : : 3' CTAACGAACTTCAAACACGC 63 3. Các cấu trúc homo dimer Primer Delta G (kcal/mole) Base pair Cấu trúc homo dimer 225 -1.6 -1.6 -1,57 -1,57 2 2 2 2 5' ACAGGAAGGACAACACTCAC || : : :: 3' CACTCACAACAGGAAGGACA 5' ACAGGAAGGACAACACTCAC : || :: : 3' CACTCACAACAGGAAGGACA 5' ACAGGAAGGACAACACTCAC || : : :: 3' CACTCACAACAGGAAGGACA 5' ACAGGAAGGACAACACTCAC || :: 3' CACTCACAACAGGAAGGACA 226 -3.54 -3.54 -3.14 -3.14 -3,14 -1,94 2 2 2 2 2 2 5' CGCACAAACTTCAAGCAATC || 3' CTAACGAACTTCAAACACGC 5' CGCACAAACTTCAAGCAATC ||| ::: 3' CTAACGAACTTCAAACACGC 5' CGCACAAACTTCAAGCAATC || 3' CTAACGAACTTCAAACACGC 5' CGCACAAACTTCAAGCAATC || :: :: :: 3' CTAACGAACTTCAAACACGC 5' CGCACAAACTTCAAGCAATC || 3' CTAACGAACTTCAAACACGC 5' CGCACAAACTTCAAGCAATC || :: 3' CTAACGAACTTCAAACACGC 64 -1,94 -1,47 2 2 5' CGCACAAACTTCAAGCAATC || :: 3' CTAACGAACTTCAAACACGC 5' CGCACAAACTTCAAGCAATC || 3' CTAACGAACTTCAAACACGC PHỤ LỤC 2 Kết quả BLAST của cặp primer 225, 226 Score E Sequences producing significant alignments: (Bits) Value gi|18253957|gb|AF414119.1|AF414119 Pineapple mealybug wilt-as 40.1 0.48 gi|22227|emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorop 36.2 7.5 gi|62630081|gb|AC122311.6| Mus musculus BAC clone RP23-298B23 36.2 7.5 > gi|18253957|gb|AF414119.1|AF414119 Pineapple mealybug wilt-associated virus- 1 methyltransferase/helicase protein gene, partial sequence; RNA-dependent RNA polymerase (RdRp), small hydrophobic protein, heat shock protein 70 (hsp70), p46, and putative coat protein genes, complete cds. Length=10038 Score = 40.1 bits (20), Expect = 0.48 Identities = 20/20 (100%), Gaps = 0/20 (0%) Strand=Plus/Plus Primer 225 ACAGGAAGGACAACACTCAC 20 |||||||||||||||||||| Sbjct 5958 ACAGGAAGGACAACACTCAC 5977 Score = 40.1 bits (20), Expect = 0.48 Identities = 20/20 (100%), Gaps = 0/20 (0%) Strand=Plus/Minus Primer 226 CGCACAAACTTCAAGCAATC 59 |||||||||||||||||||| Sbjct 6547 CGCACAAACTTCAAGCAATC 6528 > gi|22227|emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor. Length=2780 Score = 36.2 bits (18), Expect = 7.5 Identities = 18/18 (100%), Gaps = 0/18 (0%) Strand=Plus/Plus Primer 225 ACAGGAAGGACAACACTC 18 |||||||||||||||||| Sbjct 781 ACAGGAAGGACAACACTC 798 65 > gi|62630081|gb|AC122311.6| Mus musculus BAC clone RP23-298B23 from chromosome 6, complete sequence. Length=209435 Score = 36.2 bits (18), Expect = 7.5 Identities = 18/18 (100%), Gaps = 0/18 (0%) Strand=Plus/Minus Primer 226 CACAAACTTCAAGCAATC 59 |||||||||||||||||| Sbjct 49897 CACAAACTTCAAGCAATC 49880 PHỤ LỤC 3 Kết quả BLAST của trình tự D1, D2. Score E Sequences producing significant alignments: (Bits) Value gi|18253957|gb|AF414119.1|AF414119 Pineapple mealybug wilt-as 969 0.0 gi|8977608|emb|AL137017.9| Human DNA sequence from clone RP11 44.1 0.41 gi|34495171|gb|AC140307.3| Mus musculus BAC clone RP23-389D15 40.1 6.4 gi|62659432|ref|XM_579802.1| PREDICTED: Rattus norvegicus LOC498 40.1 6.4 gi|15487179|emb|AL589706.13| Human DNA sequence from clone RP 40.1 6.4 gi|19068404|emb|AL391737.2|CNS06C8G chromosome I of strain GB 40.1 6.4 gi|61656697|emb|BX088713.8| Zebrafish DNA sequence from clone 40.1 6.4 gi|52627220|gb|AC097087.13| Rattus norvegicus BAC CH230-140P 40.1 6.4 gi|20334517|gb|AC106726.3| Homo sapiens 3 BAC RP11-450I19 (Ro 40.1 6.4 gi|26108544|gb|AE016762.1| Escherichia coli CFT073 section 8 of 40.1 6.4 gi|146881|gb|J01652.1|ECOMOTAB E. coli mocha promoter, motA a 40.1 6.4 gi|48994873|gb|U00096.2| Escherichia coli K-12 MG1655 complete g 40.1 6.4 gi|47118301|dbj|BA000007.2| Escherichia coli O157:H7 DNA, comple 40.1 6.4 gi|1736542|dbj|D90831.1| E.coli genomic DNA, Kohara clone #339(4 40.1 6.4 > gi|18253957|gb|AF414119.1|AF414119 Pineapple mealybug wilt-associated virus-1 methyltransferase/helicase protein gene, partial sequence; RNA- dependent RNA polymerase (RdRp), small hydrophobic protein, heat shock protein 70 (hsp70), p46, and putative coat protein genes, omplete cds. Length=10038 Score = 969 bits (489), Expect = 0.0 Identities = 510/517 (98%), Gaps = 0/517 (0%) Strand=Plus/Plus Query 31 TTATCGTGATATAAAAAGGTATTTCGGACTCAACAAGTTCAACAAAGATGTGTATCTCGA 90 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 6019 TTATCGTGATATAAAAAGGTATTTCGGACTCAACAAGTTCAACAAAGATGTGTATCTCGA 6078 Query 91 TAAATTGAAACCCACAATCGAGGTAGTGGTTGACGACTGGGGTTGTTCTATAGGACCAGT 150 |||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| Sbjct 6079 TAAATTGAAACCCACAATCGAGGTAGTGATTGACGACTGGGGTTGTCCTATAGGACCAGT 6138 Query 151 AGACGGTGCGAGAGGGAAAGCCAAATCAGTTCTCACTTTAGCCTCTGATTTTATAACGGG 210 |||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 6139 AGACGGTGCGCGCGGGAAAGCCAAATCAGTTCTCACTTTAGCCTCTGATTTTATAACGGG 6198 Query 211 ATTGGTACAACTAGCGATCAAGATGACGAATCAACAAGTATCTGTGTCTGTTTGTTCAGT 270 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 6199 ATTGGTACAACTAGCGATCAAGATGACGAATCAACAAGTATCTGTGTCTGTTTGTTCAGT 6258 Query 271 ACCAGCAGCTTACAATTCTTATCAAAGGGGTTTTATTTTTGAAAGTTGTAAGTTGAGCTC 330 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 6259 ACCAGCAGCTTACAATTCTTATCAAAGGGGTTTTATTTTTGAAAGTTGTAAGTTGAGCTC 6318 66 Query 331 TATAAATGTGCAGGCGGTAGTAAACGAACCGACCGCAGCTGGATTGAGTGCTTTCATAAC 390 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 6319 TATAGATGTGCAGGCGGTAGTAAACGAACCGACCGCAGCTGGATTGAGTGCTTTCATAAC 6378 Query 391 TACCCCGAAAGCTTCTGTGAATTATTTGTTAGTCTACGATTTCGGAGGAGGCACTTTTGA 450 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 6379 TACCCCGAAAGCTTCTGTGAATTATTTGTTAGTCTACGATTTCGGAGGAGGCACTTTTGA 6438 Query 451 TAGTTCCTTACTCGTGGTTGGGCCTGCGTACGTGGGAGTACTGGATTCGATGGGAGATAA 510 |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct 6439 TAGTTCCTTACTCGTGGTTGGGGGTGCGTACGTGGGAGTACTGGATTCGATGGGAGATAA 6498 Query 511 CTATCTGGGAGGCAGGGACGTAGATAACAGATTGCTT 547 ||||||||||||||||||||||||||||||||||||| Sbjct 6499 CTATCTGGGAGGCAGGGACGTAGATAACAGATTGCTT 6535 > gi|8977608|emb|AL137017.9| Human DNA sequence from clone RP11-120J1 on chromosome 9 Contains the 3' end of a novel gene and a CpG island, complete sequence. Length=167585 Score = 44.1 bits (22), Expect = 0.41 Identities = 28/30 (93%), Gaps = 0/30 (0%) Strand=Plus/Plus Query 250 ATCTGTGTCTGTTTGTTCAGTACCAGCAGC 279 ||||||||||||| ||||||||||||||| Sbjct 31275 ATCTGTGTCTGTTACTTCAGTACCAGCAGC 31304 > gi|34495171|gb|AC140307.3| Mus musculus BAC clone RP23-389D15 from chromosome 19, complete sequence. Length=187731 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%), Gaps = 0/20 (0%) Strand=Plus/Plus Query 511 CTATCTGGGAGGCAGGGACG 530 |||||||||||||||||||| Sbjct 120588 CTATCTGGGAGGCAGGGACG 120607 …………… …………… …………… . ACAGGAAGGACAACACTCAC || : : :: 3' CACTCACAACAGGAAGGACA 5' ACAGGAAGGACAACACTCAC : || :: : 3' CACTCACAACAGGAAGGACA 5' ACAGGAAGGACAACACTCAC || : : :: 3' CACTCACAACAGGAAGGACA. CGCACAAACTTCAAGCAATC ||| :: : 3' CTAACGAACTTCAAACACGC 5' CGCACAAACTTCAAGCAATC || 3' CTAACGAACTTCAAACACGC 5' CGCACAAACTTCAAGCAATC || :: :: :: 3' CTAACGAACTTCAAACACGC. gi|8 977 608|emb|AL1 370 17. 9| Human DNA sequence from clone RP11 44.1 0.41 gi|34495 171 |gb|AC1403 07. 3| Mus musculus BAC clone RP23-389D15 40.1 6.4 gi|62659432|ref|XM_ 579 802.1| PREDICTED: Rattus
- Xem thêm -

Xem thêm: Luận văn : XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV-1 GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR part 7 doc, Luận văn : XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV-1 GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR part 7 doc, Luận văn : XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV-1 GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR part 7 doc

Từ khóa liên quan

Gợi ý tài liệu liên quan cho bạn