Luận văn : XÂY DỰNG QUY TRÌNH ĐỊNH DANH VI KHUẨN GÂY BỆNH LOÉT TRÊN CÂY BƯỞI BẰNG PHƯƠNG PHÁP SINH HỌC PHÂN TỬ part 2 pptx

17 441 0
  • Loading ...
1/17 trang

Thông tin tài liệu

Ngày đăng: 28/07/2014, 02:20

6 nhiều nƣớc và đã phát triển thành dịch ở khắp vùng châu Á nhiệt đới-Thái Bình Dƣơng. Bệnh còn thấy ở các nƣớc châu Mỹ, châu Phi. Ở nƣớc ta bệnh hầu nhƣ phá hại ở tất cả các vùng trồng cam quýt, gây thiệt hại đáng kể làm ảnh hƣởng tới nguồn hàng xuất khẩu và tiêu dùng trong nƣớc. Bệnh thƣờng bắt đầu xuất hiện ở lá non. Ban đầu vết bệnh là những chấm nhỏ có đƣờng kính dƣới 1mm màu trắng vàng thƣờng thấy ở mặt dƣới lá. Sau đó vết bệnh mở rộng hơn phá vỡ biểu bì mặt dƣới lá. Xung quanh vết bệnh có vầng tròn dạng giọt dầu màu nâu hoặc xanh tối. Sau 2-3 tuần vết bệnh phát triển thành loét hình tròn màu nâu xám. Khi vết loét già hóa gỗ rắn lại hình dạng vẫn còn hoặc không định hình. Trên cây bƣởi vết bệnh khoảng 8mm. Ở quả vết bệnh cũng tƣơng tự nhƣ ở lá.Vết bệnh rắn xù xì màu nâu ở giữa lõm, mép ngoài nổi gờ lên, ở giữa vết bệnh mô chết rạn nứt. Toàn thể chiều dày của vỏ quả có thể bị loét nhƣng không bao giờ vết loét ăn sâu vào ruột quả, bệnh nặng có thể làm cho quả biến dạng ít nhiều. Hình 2.1 Triệu chứng bệnh loét trên lá bƣởi Da Láng Hình 2.2 Triệu chứng bệnh loét trên trái bƣởi Da Láng 7 Ở cành vết bệnh cũng tƣơng tự nhƣ ở lá nhƣng sùi lên tƣơng đối rõ ràng, ở giữa vết bệnh không lõm xuống hoặc lõm xuống không rõ rệt. Vết bệnh còn xuất hiện ở gai cũng giống nhƣ ở cành cây. . 2.2.2. Đặc điểm gây bệnh của chủng vi sinh vật gây bệnh (X. a. pv. citri) Vi khuẩn có hình gậy ngắn, kích thƣớc khoảng 1,5-2 x 0,5-0,75µm, hai đầu tròn có một lông roi ở đầu, có thể nối liền thành chuỗi, có vỏ nhờn nhuộm gram âm, háo khí. Độ dài genome khoảng 5 Mbp. Sinh trƣởng dễ dàng trên môi trƣờng agar – glucose –peptone, khuẩn lạc hình tròn, sáng, bóng, màu vàng sáp. Đặc trƣng để phân biệt vi khuẩn Xanthomonas sp. với loại vi khuẩn màu vàng khác là nó có thể sinh trƣởng thành khuẩn lạc màu vàng sáp trên miếng lát cắt củ khoai tây. Phạm vi nhiệt độ phát triển là 5-35 o C, thích hợp 20-30 o C. Ở nhiệt độ 52 o C trong10 phút vi khuẩn chết. Vi khuẩn phát triển và hoạt động trong phạm vi pH 6,1- 8,8, thích hợp ở pH 6,6. Vi khuẩn có khả năng chịu hạn ở nhiệt cao, trong điều kiện phòng thí nghiệm có thể tồn tại 130 ngày. Bệnh loét cam, bƣởi là bệnh hại có tính nhiệt đới, vi khuẩn gây bệnh phát triển thích hợp trong điều kiện nhiệt độ cao, ẩm ƣớt, sức chống hạn và lạnh cao. Vi khuẩn tồn tại trong vết lá, cành bệnh từ năm này qua năm khác. Theo Wolf (1916) vi khuẩn bệnh loét cam có thể tồn tại qua đông trong đất, nhƣng Pltier và Frederich lại cho rằng vi khuẩn không thể tồn tại qua đông ở trong đất hoặc trong lá rụng. Lee (1920) và Fulton (1925) cho rằng vi khuẩn bệnh loét cam không đấu tranh đƣợc với tập đoàn vi khuẩn khác nên dễ dàng chết trong đất. Loucks Hình 2.3 Triệu chứng bệnh loét trên cành bƣởi Da Láng 8 (1930) đã chứng minh rằng vi khuẩn ở trong đất không vô trùng chỉ sống đƣợc 6-13 ngày nhƣng trong đất vô trùng có thể tồn tại đƣợc 150 ngày. Theo Rao và Hingorant ở đất vô trùng, vi khuẩn sống đƣợc 52 ngày còn ở đất không vô trùng chỉ sống đƣợc 17 ngày. Cũng từ hai tác giả trên thời gian sống của vi khuẩn ở những lá cây chết rụng xuống đất khoảng 6 tháng. (Lê Lƣơng Tề và Vũ Triệu Mân, 1999). Vào mùa mƣa trời ẩm ƣớt vi khuẩn từ trong vết bệnh cũ hoạt động, truyền lan đi trong mƣa, gió hoặc côn trùng, chim. Vi khuẩn cũng có thể truyền dễ dàng qua quần áo, nông cụ. Vi khuẩn rơi trên quả, lá, cành sẽ xâm nhập qua vết thƣơng, khí khổng. Đặc điểm xâm nhiễm gây bệnh: bệnh phát sinh do 3 yếu tố cơ bản tác động lẫn nhau quyết định là “cây ký chủ- vi khuẩn gây bệnh-điều kiện ngoại cảnh môi trƣờng” (Lê Lƣơng Tề và Vũ Triệu Mân, 1999). Dựa triệu chứng bệnh và sự biến chủng của vi khuẩn có các loại bệnh loét sau: - Loại Asiatic (Canker A), do Xanthomonas axonopodis pv.citri, bắt nguồn từ châu Á, phân bố rộng, khả năng gây bệnh rất mạnh. - Loại B, do Xanthomonas axonopodis pv. aurantifolii , bắt nguồn từ Nam Mỹ, gây bệnh chủ yếu trên chanh nhỏ, cam chua, bƣởi. - Loại C, cũng do Xanthomonasdis axonopodis pv. aurantifolii nhƣng gây bệnh trên chanh nhỏ và cam chua. - Loại A* đƣợc phát hiện ở Oman, Saudi Arabia, Iran và Idian chỉ gây bệnh trên chanh. (http://en.wikipedia.org/wiki/Citrus_canker). 2.3. Sơ lƣợc vùng rDNA-ITS 2.3.1. Giới thiệu vùng rDNA Những gen mã hóa rRNA đƣợc tìm thấy trong vùng rDNA. Sản phẩm của những gen này (rRNA) kết hợp với những phân tử protein hình thành những ribosom có chức năng tổng hợp protein. Gen rDNA 16S mã hóa một phân tử RNA hình thành tiểu đơn vị ribosom nhỏ của vi khuẩn điển hình (thành phần protein của tế bào). Trình tự của gen này thích hợp là một mô hình phổ biến để nghiên cứu sự tiến hóa và phân loại vi khuẩn. Gene rDNA đƣợc tìm thấy ở hầu hết các dạng sống (ngoại trừ virus và 9 prion). Các thành phần của trình tự rDNA từ những sinh vật có quan hệ với nhau đƣợc đánh dấu giống nhau. Điều này có nghĩa, trình tự của những sinh vật thân cận đã đƣợc sắp xếp chính xác, làm cho những khác biệt dễ dàng để đánh giá. Điều đó cũng có nghĩa là chỉ một vài nhóm primer PCR là cần thiết để khuếch đại gene rDNA từ bất cứ loài vi khuẩn nào. Trình tự của rDNA 16S đã đƣợc xác định cho nhiều loài. Sự thật, không có bất kỳ gen nào khác đặc trƣng cho nhiều loài nhƣ vậy. Chiều dài và trình tự của những vùng ITS của rDNA đƣợc cho rằng là vùng tiến hóa nhanh nhất và vì vậy có thể rất biến đổi. Những universal primer đƣợc thiết kế từ những vùng bảo tồn nằm hai đầu vùng ITS và vùng ITS có kích thƣớc nhỏ (600 – 700 bp) dễ dàng đƣợc khuếch đại bởi vì số bản sao lớn (lên tới 30000 bản trong mỗi tế bào (Dubouzet and Shinoda, 1999) của vùng lặp lại trên rDNA. Điều này làm cho vùng ITS trở thành một đề tài đƣợc quan tâm cho việc nghiên cứu về sự tiến hóa và phát sinh loài (Baldwin và ctv., 1995; Hershkovitz và ctv., 1996, 1999) cũng nhƣ các nghiên cứu về địa lý sinh vật (biogeographic) (Baldwin, 1993; Suh và ctv., 1993; Hsiao và ctv., 1994; Dubouzet và Shinoda, 1999). (Nguyễn Thị Tiến Sỹ, 2005). 2.3.2. Vùng rDNA-ITS trên Xanthomonas ssp. Phân tích mối quan hệ loài dựa trên vùng 16s-23s rDNA bằng cách thiết kế cặp primer Xan1330 và Xan332 dựa trên vùng gen 16s-23s rDNA ở Xanthomonas sp. Sản phẩm PCR thu đƣợc là đoạn có kích thƣớc 1,1 kb và đƣợc xác định là Xanthomonas sp. (Edmilson R Gonealves và Yoko. B. Rosato, 2002). (Hình 2.3, Hình 2.4) 2.4. Sơ lƣợc về hrpW gen Sự tƣơng tác giữa ký sinh với ký chủ phụ thuộc vào hệ thống protein . Đặc biệt đối với tƣơng tác vi khuẩn gram âm gây bệnh thực vật với cây ký chủ. Loại protein này đƣợc mã hóa bởi hrp gen. Trên Xanthomonas axonopodis pv.citri ngƣời ta xác định các loại hrp gen: hrpG, hpaA, hpaB, hrcV, hrpB1, hrpD6, hrpB2, hrcU, hrcW, hrpB4, hrcN. Trên X. a. pv.citri các hrp gen này nằm thành cụm trừ hrpW. (Marcos C. Alergria và ctv, 2004). Dựa vào đặc tính của hrp gen là đặc trƣng cho từng loài gây bệnh nên ngƣời ta thiết kế primer chuyên biệt cho phản ứng PCR phát hiện nhanh, 10 chính xác loài gây bệnh. Phƣơng pháp phát hiện nhanh bằng primer chuyên biệt này nhanh, chính xác hơn các phƣơng pháp nuôi cấy. Hình 2.5 Sơ đồ hình cây thể hiện mối tƣơng quan giữa các dòng Xanthomonas sp. dựa trên vùng 16s-23s rDNA ITS (Edmilson R Gonealves và ctv, 2002). Hình 2.4. Cấu trúc vùng 16s-23s rDNA ITS của Xanthomonas sp. Trình tự primer Xan1330 và Xan332 đƣợc thiết kế trên vùng 16s-23s (Edmilson R Gonealves và ctv, 2002). Xan 1330 5’GTTCCCGGGCCTTGTACACAC 3’ Xan 322 5’ GGTTCTTTTCACCTTTCCCTC 3’ 11 Ngƣời ta dựa vào trình tự hrpW gen của X. a. pv. citri (Genbank Accession No. AE008923) thiết kế cặp primer XACR, XACF chuyên biệt phát hiện nhanh chính nó. Sản phẩm PCR thu đƣợc là đoạn có kích thƣớc 561 bp (Dong Suk Park và ctv, 2006) XACR 5’CGTCGCAATACGATTGGAAC 3’ XACF 5’CGGAGGCATTGTCGAAGGAA 3’ 2.5. Những cứu về bệnh loét cam quýt trên Thế Giới và Việt Nam 2.5.1. Trên Thế Giới Năm 2002, Edmilson R.Goncalves và ctv đã tiến hành phân tích mối quan hệ di truyền giữa 17 loài Xanthomonas sp. bằng thực hiên phản ứng PCR và đọc trình tự sản phẩm PCR.Phản ứng đƣợc thực hiện với cặp mồi Xan1330 và Xan332 đƣợc thiết kế trên đoạn 16s-23s rDNA ITS. Năm 2003, C. J. Vernière và ctv đã nghiên cứu sự phát triển và biểu hiện triệu chứng bệnh của X. a. pv. citri trên cây có múi. C. J. Vernière và cộng sự đã kết luận rằng để giảm bệnh loét nhà nông phải hạn chế tạo vết thƣơng cho cây, sự tăng trƣởng quá nhiều chồi non và sự tăng trƣởng của quần thể X. a. pv. citri. Hệ thống chắn gió là biện pháp hạn chế sự lan tràn bệnh hiệu quả nhất. Các tác nhân sinh học khác nhƣ ấu trùng của côn trùng chít hút cũng là phƣơng tiện truyền bệnh nguy hiểm. Khả năng nhiễm bệnh của ký chủ có liên quan đến giai đoạn phát triển của cây. Năm 2003, Jung-Gun- Kim và ctv, đã mô tả đặc tính của vùng gây bệnh hrp của X. a. pv. glycines Vùng này gồm vùng hrp gen, vùng hcr gen và vùng hca gen.Trong đó vùng hrp và hcr mã hóa cho loại protein đóng vai trò quan trọng trong quá trình xâm nhiễm của vi khuẩn X. a. pv. glycine. Đặc tính của vùng hrp gen này là chứa nhiều gen độc, thành phần G+C thấp. Năm 2006, Dong Suk Park và ctv, đã thực hiện thành công phƣơng pháp PCR với mồi chuyên biệt trên hrpW gen để phát hiện nhanh và chính xác X. a. pv.citri, là loài gây bệnh loét trên cây có múi tại châu Á. 2.5.2. Tại Việt Nam Năm 2002, Nguyễn Thị Thu Cúc -Phạm Thị Hoàng Oanh, trƣờng Đại Học Cần Thơ, có nghiên cứu về dịch hại trên cam, quít, chanh, bƣởi. Nghiên cứu này tập hợp 12 hầu hết các thông tin về dịch hại phổ biến tại Việt Nam. Trong nghiên cứu này, tổng cộng có trên 30 loài côn trùng và 15 loại bệnh phổ biến trên nhóm cam, quít, chanh, bƣởi đã đƣợc trình bày và mô tả qua các phần nhƣ đặc điểm hình thái, sinh học, sinh thái, sự gây hại, triệu chứng và các biện pháp đối phó. Năm 2005, Vi Thị Thanh Hƣờng, trƣờng Đại Học Nông Lâm Thành Phố Hồ Chí Minh đã nghiên cứu các tác nhân và biện pháp phòng trừ biện pháp phòng trừ bệnh loét trên bƣởi ở xã Tân Bình - huyện Vĩnh Cửu - tỉnh Đồng Nai. Tác giả đã phân lập đƣợc một số dòng vi khuẩn gây bệnh nhƣng chƣa định danh đƣợc. Đồng thời, tác giả cũng xác định một số loại thuốc hóa học phòng trừ bệnh loét. 2.6. Quy trình định danh Xanthomona sp. . 2.6.1. Quy trình định danh Xanthomonas sp. theo phƣơng pháp nuôi cấy, thực hiện phản ứng sinh hóa 1. Sử dụng môi trường chọn lọc để phân lập dòng gây bệnh (Bảng 2.1) 2. Xác định dựa vào sắc tố vàng Xanthomonadin. (Phƣơng pháp thực hiện sẽ nêu ở phần 3.4.3 phƣơng pháp và vật liệu) 3. Thực hiện thí nghiệm sinh hóa và quan sát hình thái (Bảng 2.2) a) Khả năng phát triển trong môi trƣờng YS ở 35 o C trong 10-12 ngày. b) Kiểm tra sự tạo nhầy, màu sắc của khuẩn lạc trên môi trƣờng GYCA hoặc YDC trong 2-3 ngày. c) Kiểm tra khả năng phân hủy protein: là thử nghiệm khả năng phân hủy casein trong dịch sữa có chứa chất chỉ thị bromcresol purple đã khử trùng. Dịch sữa và khuẩn đƣợc ủ 27 o C quan sát phản ứng phân hủy. d) Kiểm tra thủy phân asculin: phản ứng dƣơng tính khi dịch đổi màu nâu tối (môi trƣờngYS lỏng + ferric ammonium citrate 0,05% và asculin 0,1%, pH 6,8). e) Kiểm tra khả năng thủy phân gelatin. f) Kiểm tra khả năng tạo urease. g) Kiểm tra tạo axit từ carbohydrates. 13 4. Kiểm tra tính gây bệnh Khẳng định độc tính dòng phân lập đƣợc bằng cách chủng nhân tạo. Ký chủ đƣợc chủng hoàn toàn là cây sạch bệnh. Tạo vết thƣơng trên cây ký chủ. Sau đó nhỏ dòng vi khuẩn đã kiểm tra các bƣớc trên lên vết thƣơng. Đặt cây ký chủ đã chủng vào điều kiện tối ƣu cho bệnh phát triển. Thông thƣờng thì ở nhiệt độ 27 o C-30 o C, trong vòng 7 ngày sau khi chủng thì thấy triệu chứng bệnh. 2.6.2 Quy trình định danh theo phƣơng pháp phân tử Dựa trên quy trình định danh bằng phƣơng pháp nuôi cấy và kiểm tra sinh hóa nhƣng bổ sung thêm một số phƣơng pháp sinh học phân tử để định danh chính xác ở mức loài. Quy trình gồm các bƣớc sau: 1. Phân lập và kiểm tra hình thái, sinh hoá trên các môi trƣờng khác nhau nhƣ NA, YGA, YDC, KB. 2. Tiến hành kiểm tra dòng phân lập đƣợc bằng phản ứng ELISA để kiểm tra và phân loại dựa trên độc tính gây bệnh. 3. Kiểm tra sự oxy hóa nguồn cacbon (khả năng tạo axit từ đƣờng cacbon). 4. Kiểm tra khả năng gây bệnh của dòng phân lập bằng phƣơng pháp chủng nhân tạo. 5. Thực hiên phản ứng PCR với cặp primer đƣợc thiết kế trên vùng 16s-23s rDNA ITS. 6. Tiến hành cắt bằng enzyme giới hạn nghiên cứu sự đa dạng di truyền. 7. Đọc trình tự sản phẩm PCR trên vùng 16s-23s sẽ định danh đƣợc dòng vi khuẩn gây bệnh ở mức loài. (M. H. R Khoodoo và ctv, 2005). 14 Bảng 2.1. Môi trƣờng sử dụng phân lập một số loài X. campestris Bảng 2.2. Đặc tính sinh hóa của Xanthomonas sp. Loài Môi trƣờng campestris carotae translucens phaseoli vesicatoria fragaria SX, SM, NSCAA* XCS* XTS MXP Tween, XCS, XTS SX, SM Phản ứng kiểm tra X. cam _pestris X.raga_ riae X.albili _neans X.axono _podis X. ampelina Tạo nhầy trên GYCA/YDC + + _ _ _ Sinh trƣởng ở 35 o C + _ + + _ Thủy phân asculin + _ + + _ Phân hủy gelatin V + v _ _ Phân hủy protein + _ _ _ _ Khả năng tạo Urease _ _ _ _ + Tạo axit từ: Arabinose Glucose Mannose + + + _ + + _ + + _ + _ + _ _ Ghi chú: * thƣờng sử dụng phân lập từ hạt 15 2.7 Phƣơng pháp PCR Phƣơng pháp PCR ( Polymerase Chain Reaction) là một công cụ khá mới trong sinh học phân học phân tử, do Karl Mullis và những cộng sự phát minh năm 1985 và đã liên tục hoàn thiện và phát triển trong thời gian gần đây. Kỹ thuật PCR cho phép khuếch đại một đoạn DNA mong muốn lên nhiều lần để phục vụ cho nhiều mục đích khác nhau. Nguyên tắc cơ bản của phƣơng pháp PCR chủ yếu dựa vào khả năng tự nhân đôi, biến tính và hồi tính của DNA. *Nguyên tắc của phƣơng pháp PCR Dựa trên khả năng biến tính và hồi tính của DNA cùng với sự phát hiện ra enzyme Taq- polymerase (1 loại DNA polymerase chịu nhiệt), ngƣời ta thiết lập đƣợc hàng loạt các phản ứng nhân đôi DNA in vitro trong một thời gian ngắn. Khi ta làm biến tính (đun nóng) để đoạn DNA tách ra thành 2 mạch đơn và cung cấp 2 mồi chuyên biệt gồm mồi xuôi và mồi ngƣợc bắt cặp bổ sung với 2 đầu đoạn DNA cần nhân lên thì Taq-polymerase sẽ tổng hợp nên 2 sợi DNA mới. Nhƣ vậy nếu phản ứng nhân đôi DNA đƣợc lập lại liên tục nhiều lần thì ta sẽ thu đƣợc một lƣợng khuếch đại rất lớn DNA cần nghiên cứu. Phản ứng PCR gồm nhiều chu kỳ, mỗi chu kỳ có 3 giai đoạn: - Giai đoạn 1: là giai đoạn biến tính (denaturation), nhiệt độ đƣợc nâng lên 93- 100 o C. Ở nhiệt độ này tất cả các mạch xoắn kép của DNA đều đƣợc tách ra. - Giai đoạn 2: là giai đoạn bắt cặp (hybridization), nhiệt độ của phản ứng đƣợc hạ xuống thấp hơn nhiệt độ nóng chảy-Tm của các mồi (là nhiệt độ mà tại đó 2 mạch của sợi đôi DNA tách ra hoàn toàn) cho phép các mồi bắt cặp với DNA khuôn mẫu. Mức nhiệt độ dao động khoảng 40- 70 o C, tuỳ thuộc vào Tm của các mồi mà thời gian từ 30 -60 giây. - Giai đoạn 3: là giai đoạn kéo dài (extension), nhiệt độ đƣợc nhân lên 68-72 o C. Ở nhiệt độ này Taq-polymerase hoạt động tốt nhất để kéo dài các mạch DNA. Đoạn DNA nằm giữa 2 mồi đƣợc tổng hợp. Cứ sau 1 chu kỳ gồm 3 giai đoạn trên, từ 1 DNA khuôn mẫu sẽ tạo ra 2 DNA mới. Và sau mỗi lần lập lại sẽ làm tăng gấp đôi lƣợng DNA mẫu của lần trƣớc (theo cấp số nhân). Tổng số DNA đƣợc khuếch đại sau phản ứng PCR đƣợc tính theo công thức: Tổng số DNA khuếch đại = m x 2 n Với m là số bản sao ban đầu của DNA mẫu, n là số chu kỳ. [...]... xác định dòng vi khuẩn phân lập đƣợc là dòng vi khuẩn có khả năng gây bệnh trên ký chủ là cây bƣởi Dựa trên kết quả chủng bệnh khẳng định đặc tính gây bệnh của dòng vi khuẩn phân lập 3 Thực hiện sắc ký bản mỏng để định danh Xanthomonas.sp (dựa vào sắc tố vàng Xanthomodin đặc trƣng) 4 Nhân sinh khối, ly trích DNA tổng số các dòng vi khuẩn phân lập đƣợc 5 Dùng phản ứng PCR trên 16s -23 s rDNA ITS với cặp... PHƢƠNG PHÁP 3.1 Thời gian và địa điểm nghiên cứu Thời gian: Đề tài đƣợc tiến hành từ 06/ 02/ 06 đến 06/08/06 Địa điểm: Tại Trung Tâm Phân Tích Hóa Sinh và Bộ Môn Bảo Vệ Thực VậtTrƣờng Đại Học Nông Lâm T.P Hồ Chí Minh 3 .2 Nội dung nghiên cứu 1 Phân lập, nuôi cấy, xác định dòng vi khuẩn gây bệnh là gram âm hay gram dƣơng, quan sát hình thái trên môi trƣờng PGA, YDC 2 Chủng bệnh nhân tạo xác định dòng vi khuẩn. .. - Giấy thấm - Tủ 4oC và - 20 oC  Quy trình ly trích DNA tổng số 1 Thu sinh khối vi khuẩn bằng cách ly tâm 10 000 vòng/ 5 phút/ 4oC Rửa sinh khối vi khuẩn đƣợc với 1ml nƣớc cất 2 lần vô trùng, đánh tan bằng vortex 21 2 Hòa tan sinh khối vi khuẩn thu đƣợc trong 567µl dung dịch TE, đánh tan bằng vortex, thêm 30µl dung dịch SDS10%, đánh tan bằng vortex Sau đó ủ ở 37oC khoảng 1 -2 h 3 Cho thêm vào 100µl... Phƣơng pháp ly trích DNA tổng số của vi khuẩn  Hóa chất và vật liệu - Hỗn hợp phenol: chloroform: isoamyl alcohol (2 5 :2 4:1 ) - Hỗn hợp chloroform: izoamyl alcohol (2 4:1 ) - Isopropanol 20 - Ethanol 100 % và 70 % - Dung dịch đệm ly trích DNA Tris (trisma bazơ ): chất đệm, giữ ổn định pH tránh tổn hại DNA EDTA (Ethylenediamine tetraacetate) : tạo phức Mg++, gây bất hoạt enzyme phân hủy DNA trong quá trình. .. Dựa trên cây ký chủ thu thập mẫu lá và trái Ví d : dòng vi khuẩn XBDL1 đƣợc hiểu là dòng Xanthomonas sp., BDL là tên ký chủ bƣởi Da Láng, số 1 là dòng vi khuẩn trên lá, số 2 là dòng trên cành, số 3 là dòng vi khuẩn trên trái 3.4 .2 Chủng bệnh nhân tạo Chủng bệnh nhân tạo trong phòng: hái lá, quả bƣởi không bị nhiễm bệnh, rữa thật sạch dƣới vòi nƣớc chảy Khi lá, quả bƣởi ráo nƣớc ta tiến hành chủng bệnh. .. đại vùng 16s -23 s rDNA ITS dòng vi khuẩn phân lập với cặp mồi Xan1330 và Xan3 32 (M.H.R Khoodoo và ctv, 20 05) Xan 1330 5’GTTCCCGGGCCTTGTACACAC 3’ Xan 322 5’ GGTTCTTTTCACCTTTCCCTC 3’ Bảng 3 .2 Hỗn hợp thực hiện phản ứng PCR Thành phần Nồng độ ban đầu Nồng độ sau phản ứng Thể tích (µl) PCR buffer 10X 1X 2, 5 dNTPs 25 mM 0,2mM 0 ,2 MgCl2 25 mM 0,75mM 0,75 Primer 20 pmol/µl 1 ,25 pmol/µl 1 5unit/1µl 2unit/1µl 0,4... phân lập 3.4 Phƣơng pháp tiến hành 3.4.1 Phân lập, nuôi cấy trên 2 môi trƣờng PGA và YDC, xác định Gram âm hay Gram dƣơng các dòng vi khuẩn gây bệnh loét trên cây bƣởi  Dụng cụ và thiết bị  Hóa chất và vật liệu - Autoclave - Đƣờng glucose - Bếp điện - CaCO3 17 - Tủ cấy vô trùng - Yeast extract - Đĩa peitri - Khoai tây - Becher 100ml - Agar - Cồn 96%, và cồn 70% - Que cấy - Đèn cồn  Phân lập vi khuẩn. .. khuẩn gây bệnh, nuôi cấy trên 2 môi trƣờng PGA và YDC, xác định Gram âm hay Gram dƣơng 1 Thu thập mẫu bệnh, lá, trái bị bệnh 2 Cắt nhỏ thành mẫu hay đoạn ngắn 3 Khử trùng bề mặt bằng cách nhúng mô bệnh trong nƣớc cất vô trùng 1 phút, tiếp tục rửa bằng cồn 70% trong 15- 30 giây, sau đó rửa sạch trong nƣớc cất vô trùng 4 Để khô mẫu sau đó cấy lên môi trƣờng PGA 5 Nuôi cấy thuần khiết dòng vi khuẩn: từ... petri phân lập vi khuẩn, chọn một khuẩn lạc, dùng que cấy khử trùng trên ngọn lửa đèn cồn cấy truyền vi khuẩn sang đĩa petri mới Đặt đĩa Petri đã cấy truyền ở nhiệt độ thích hợp (28 oC) từ 1-3 ngày cho đến khi các khuẩn lạc mới mọc ra Từ đó cấy truyền lại lần thứ 2 khi các khuẩn lạc đều đồng nhất về hình dạng, kích thƣớc, độ nhờn, cuối cùng khuẩn lạc đồng nhất nói trên đƣợc trữ trong LB tăng sinh (Lê... Máy ly tâm  Phƣơng pháp sắc ký bản mỏng Nhiều vi khuẩn có sắc tố vàng thƣờng đƣợc phân lập từ cây hoặc đất Xanthomonas cũng có sắc tố vàng Do đó, vi c dựa vào màu khuẩn lạc trên môi trƣờng để xác định đó là Xanthomonas thì khó Tuy nhiên, ngƣời ta vẫn có thể xác định đƣợc Xanthomonas dựa vào phƣơng pháp sắc ký bản mỏng Các bƣớc tiến hành: 1 Cấy khuẩn lạc trên môi trƣờng nutrient agar (môi trƣờng không . ở nhiệt độ 27 o C-30 o C, trong vòng 7 ngày sau khi chủng thì thấy triệu chứng bệnh. 2. 6 .2 Quy trình định danh theo phƣơng pháp phân tử Dựa trên quy trình định danh bằng phƣơng pháp nuôi cấy. Tác giả đã phân lập đƣợc một số dòng vi khuẩn gây bệnh nhƣng chƣa định danh đƣợc. Đồng thời, tác giả cũng xác định một số loại thuốc hóa học phòng trừ bệnh loét. 2. 6. Quy trình định danh Xanthomona. dòng vi khuẩn gây bệnh là gram âm hay gram dƣơng, quan sát hình thái trên môi trƣờng PGA, YDC. 2. Chủng bệnh nhân tạo xác định dòng vi khuẩn phân lập đƣợc là dòng vi khuẩn có khả năng gây bệnh
- Xem thêm -

Xem thêm: Luận văn : XÂY DỰNG QUY TRÌNH ĐỊNH DANH VI KHUẨN GÂY BỆNH LOÉT TRÊN CÂY BƯỞI BẰNG PHƯƠNG PHÁP SINH HỌC PHÂN TỬ part 2 pptx, Luận văn : XÂY DỰNG QUY TRÌNH ĐỊNH DANH VI KHUẨN GÂY BỆNH LOÉT TRÊN CÂY BƯỞI BẰNG PHƯƠNG PHÁP SINH HỌC PHÂN TỬ part 2 pptx, Luận văn : XÂY DỰNG QUY TRÌNH ĐỊNH DANH VI KHUẨN GÂY BỆNH LOÉT TRÊN CÂY BƯỞI BẰNG PHƯƠNG PHÁP SINH HỌC PHÂN TỬ part 2 pptx

Từ khóa liên quan

Gợi ý tài liệu liên quan cho bạn