Luận văn : XÂY DỰNG QUY TRÌNH ĐỊNH DANH VI KHUẨN GÂY BỆNH LOÉT TRÊN CÂY BƯỞI BẰNG PHƯƠNG PHÁP SINH HỌC PHÂN TỬ part 3 docx

17 488 0

Daniel Gửi tin nhắn Báo tài liệu vi phạm

Tải lên: 111,441 tài liệu

  • Loading ...
1/17 trang

Thông tin tài liệu

Ngày đăng: 28/07/2014, 02:20

23 chính xác 4 dòng phân lập đƣợc là Xanthomonas axonopodis pv.citri . (theo Dong Suk Park và ctv, 2005). XACF 5’ CGTCGCAATACGATTGGAAC 3’ XACR 5’CGGAGGCATTGTCGAAGGAA 3’ Bảng 3.4. Hỗn hợp thực hiện phản ứng PCR. Bảng 3.4. Chu trình nhiệt phản ứng PCR 3.5.6. Điện di kiểm tra sản phẩm ly trích và sản phẩm PCR  Dụng cụ và thiết bị  Hóa chất - Cân kĩ thuật 4 số, ống đong - Agarose - Lò viba - TAE 0,5X - Khay đổ gel - Loading dye 6X - Bồn và máy điện di - Ethidium bromide - Máy chụp hình gel (Gel doc) Thành phần Nồng độ ban đầu Nồng độ sau phản ứng Thể tích (µl) PCR buffer 10X 1X 2,5 dNTPs 25mM 0,2mM 0,2 MgCl 2 25 mM 1,5mM 1,5 Primer 100pM 10pM 0,25 Taq polymera se 5unit/1µl 2unit/1µl 0,4 DNA <=100ng <=50ng 1 H 2 O 19,25 Tổng cộng 25 Các bƣớc phản ứng Nhiệt độ Thời gian Giai đoạn khởi động Chạy chu kỳ (25 chu kỳ) Tách DNA khuôn Ủ và bắt cặp Kéo dài Giai đoạn kết thúc 94 o C 94 o C 60 o C 72 o C 72 o C 5 phút 15giây 30giây 30giây 7phút 24 Bảng 3.6. Thành phần dung dịch TAE 50X Thành phần Thể tích 1 lít Tris base 2M 242 g Glacial acetic acid 57,1 ml EDTA 0,5 M, pH 8.0 100 ml  Quy trình thực hiện 1. Chuẩn bị gel agarose để điện di DNA - Chuẩn bị dung dịch TAE 1X, cho dung dịch TAE 1X vào hộp điện di. - Pha dung dịch agarose 0,8 %, gồm agarose và dung dịch TAE 1X. - Đun sôi dung dịch agarose trên lò viba đến khi agarose tan hoàn toàn. Nếu quá trình đun mất nhiều nƣớc thì cần bổ dung thêm dung dịch TAE 1X cho đủ nồng độ yêu cầu. - Để lên máy lắc cho dung dịch tan đều. Đợi đến khi nhiệt độ dung dịch agarose xuống còn 55 0 C thì đổ vào khai điện di có cài sẳn lƣợc. Chiều dày gel khoảng 5 mm là thích hợp. - Sau khi gel cứng, di chuyển lƣợc ra khỏi gel và đặt khai vào bể điện di chứa TAE 1X sau cho gel ngập trong dung dịch. Chú ý nhẹ tay tránh bọt khí. 2. Tiến hành chạy điện di -Lấy một mẫu giấy parafilm, nhỏ những giọt loading buffer lên (mỗi giọt có thể tích khoảng 2 l). Cho thêm 5 l DNA lên mỗi giọt loading buffer và trộn đều. Dùng pipetman hút hỗn hợp DNA cho vào giếng của khai điện di. -Đậy nắp gel và cho chạy điện di, dòng điện cung cấp: 100 vol, 250 mA, định thời gian cho gel chạy (tùy vào sự duy chuyển của băng). -Tắt điện, đem gel nhuộm Ethidium bromide và mang gel đi chụp ảnh với tia UV thông qua phần mềm Quantity on. 25 XBDL1 XBDL2 XBDL3 XBĐ C3 PHẦN 4. KẾT QUẢ VÀ THẢO LUẬN 4.1. Phân lập, xác định gram vi khuẩn gây bệnh loét ở cây bƣởi da láng và bƣởi đƣờng cam Chúng tôi đã tiến hành phân lập đƣợc 4 dòng vi khuẩn trên các cây ký chủ khác nhau và bằng dung dịch KOH 3% đã xác định đƣợc tât cả là gram âm. Bảng 4.1. Kết quả phân lập và xác đinh gram Địa điểm thu mẫu Cây ký chủ Dòng vi khuẩn Đặc tính Tỉnh Đồng Nai Bƣởi Da Láng XBDL1 XBDL2 XBDL3 Gram âm Gram âm Gram âm Bƣởi đƣờng Cam XBĐC3 Gram âm 4.2 Kết quả nuôi cấy vi khuẩn gây bệnh loét trên môi trƣờng PGA và YDC Bảng 4.2. Hình thái vi khuẩn phân lập đƣợc từ bƣởi Da Láng và Đƣờng Cam Dòng vi khuẩn PGA YDC XBDL1 Vàng, sáp, tròn vun Vàng sữa, sáp, tròn vun XBDL2 Vàng lợt, sáp, tròn vun Vàng sữa, sáp, tròn vun XBDL3 Vàng, sáp, tròn vun Vàng sữa, sáp, tròn vun XBĐC3 Vàng đậm, sáp, tròn vun Vàng chanh, sáp, tròn vun 26 XBDL1 XBDL2 XBDL3 XBĐ C3 Hình 4.1. Sự phát triển của các dòng vi khuẩn phân lập đƣợc trên môi trƣờng PGA ở nhiệt độ 28 o C sau 48 giờ. Hình 4.2. Sự phát triển của các dòng vi khuẩn phân lập đƣợc trên môi trƣờng YDC ở nhiệt độ 28 o C sau 48 giờ. Dựa vào hình thái của khuẩn lạc có thể thấy rõ 4 dòng vi khuẩn có thể chia 2 nhóm: nhóm XBDL1, XBDL2, XBDL3 có màu sữa trên môi trƣờng YDC và nhóm có màu vàng chanh là XBĐC3. Trên môi trƣờng PGA cũng có sự phân biệt về màu sắc tƣơng tự nhƣng chƣa rõ rệt. 4.2. Chủng bệnh bệnh nhân tạo Tiến hành chủng bốn dòng vi khuẩn trên lá Da Láng. Kết quả là cả bốn dòng đều tạo vết bệnh. (Bảng 4.3) Dựa trên kết quả chủng bệnh, có thể kết luận: -Dòng XBDL1, XBDL2, XBDL3, XBĐC3 khi chủng trên lá Da Láng tạo vết bệnh rõ chứng tỏ dòng vi khuẩn phân lập đƣợc là dòng có khả năng gây bệnh. -Dòng vi khuẩn phân lập trên trái bƣởi Đƣờng Cam khi chủng trên lá Da Láng vẫn có khả năng gây bệnh. Nhƣ vậy, ký sinh và ký chủ chƣa có tính chuyên biệt cao. Để khẳng định chính xác đặc tính này cần phải tiến hành chủng nhân tạo trên nhiều ký chủ khác nhau. - Khi so sánh vết bệnh chủng trên lá Da Láng giữa hai dòng XBDL2 và XBDL3 dƣới kính hiển vi, độ phóng đại 40 lần nhận thấy có sự khác biệt rõ rệt. Dòng XBDL2 gây vết bệnh phồng, mọng nƣớc, viền xanh (hình 4.3.(c)) trong khi dòng XBDL3 không phồng, hơi lõm, viền xanh đậm lan ra, gờ nhẹ (hình 4.3.(d)). Điều này chứng tỏ tính độc khi gây bệnh của hai dòng này khác nhau. Để xác định rõ đặc tính này, tiến hành tiếp các thí nghiệm mức sinh học phân tử để tìm ra sự khác biệt này. (hình 4.3) 27 Bảng 4.3. Khả năng nhiễm bệnh của 4 dòng vi khuẩn: XBDL1, XBDL2, XBDL3, XBĐC3 trên lá da láng. Giống Thời gian xuất hiện bệnh Tổng số đốm bệnh/ Tổng số vết thƣơng Mô tả triệu chứng bằng mắt thƣờng Triệu chứng bệnh qua kính hiển vi (độ phóng đại 4x10) XBDL1 3 ngày 96% Gờ nhẹ Viền màu xanh, mọng nƣớc, bên trong sùi nhẹ. XBDL2 2 ngày 95% Gờ nhẹ Viền màu xanh đậm, mọng nƣớc, bên trong vết bệnh sùi lên cao. XBDL3 3 ngày 98% Gờ nhẹ Vết bệnh lan rộng, xung quanh viền màu xanh đậm, bên trong không sùi. XBĐC3 3 ngày 90% Gờ nhẹ Vết bệnh phồng nhẹ, viền màu xanh, bên trong không sùi. Hình.4.3. Các triệu chứng bệnh sau khi chủng vi khuẩn lên lá non bƣởi Da Láng (a) không chủng vi khuẩn; (b) chủng dòng XBDL1, (c) chủng dòng (e) (d) (c) (a) (b) 28 XBDL2; (d) chủng dòng XBDL3; (e) chủng dòng XBĐC3. Tổng số vết thương là 50 ix 4.3. Sắc ký định danh vi khuẩn gây bệnh Tiến hành sắc ký bản mỏng trên các dòng: XBDL1, XBDL2, XBDL3, XTĐC3 và một dòng đối chứng âm là Erwinia sp. Mục đích của chạy sắc ký bản mỏng là để khẳng định các dòng phân lập đƣợc là Xanthomonas sp. Kết quả khi chƣa chụp UV: đối chứng âm không ra, dòng XBDL1, XBDL2, XBDL3, XBĐC3 đều có vệt màu vàng. Kết quả khi chụp UV: chỉ có một dòng XBDL1 phát sáng rõ rệt nhất, các dòng XBDL2, XBDL3, XBĐC3 chỉ có vệt mờ nhƣng giá trị Rf >0.45 theo mục 3.4.3 Rf=0.45 mới khẳng định đƣợc đó là Xanthomonas sp. Nhƣ vậy, dựa vào kết quả sắc ký không thể kết luận dòng XBDL1, XBDL2, XBDL3, XBĐC3 là Xanthomonas sp. Để có thể định danh đƣợc bốn dòng XBDL1, XBDL2, XBDL3, XBĐC3 chúng tôi thực hiện khuếch đại vùng 16s-23s rDNA ITS với cặp mồi Xan1330 và Xan332 (M.H.R Khoodoo và ctv, 2005). Hình 4.4. Kết quả sắc ký : (a) không chụp UV ; (b) chụp UV. (-) dòng Erwinia sp;1 dòng XBDL3;2 dòng XBĐC3; 3 dòng XBDL1; 4 dòngXBDL2 4.4 Ly trích DNA tổng số Tiến hành ly trích DNA từ 4 dòng XBDL1, XBDL2, XBDL3, XBĐC3 đã đƣợc nhân sinh khối. Mỗi dòng tiến hành ly trích 2 lần, kết quả thể hiện ở hình 4.5 Rf=0.5 (a) (-) 1 2 3 4 (b) (-) 1 2 3 4 1 2 3 4 1 2 3 4 DNA tổng số x Hình 4.5. DNA tổng số ly trích theo quy trình 3.4.4 (Sambrook và ctv, 2001 đã có cải tiến). Ghi chú: 1 dòng XBDL1, 2 dòng XBDL2, 3 dòng XBDL3, 4 dòng XBĐC. Nhận xét: Qua hình 4.5 cho thấy quy trình ly trích theo mục 3.4.4 (Sambrook và ctv, 2001 đã có cải tiến) đã ổn định, nhƣng kết quả chƣa sạch. Ngoài DNA tổng số còn có DNA bị gãy, phần tạp nhiễm trong quá trình ly trích tạo thành vệt sáng cuối giếng. Các dòng XBDL1, XBDL3 là bị tạp nhiễm nhiều nhất. Để thực hiện phản ứng PCR, DNA tổng số phải đƣợc pha loãng xuống. 4.5. Thực hiện PCR với cặp mồi Xan1330 và Xan 332 trên vùng ITS Tiến hành phản ứng PCR theo 3.4.5.1 thu đƣợc kết quả nhƣ hình 4.6 Hình 4.6.cho thấy sản phẩm PCR của 4 dòng phân lập đƣợc có cùng kích thƣớc với dòng Xanthomonas sp đã đƣợc phân lập và định danh trên cây cải ngọt. Dòng 1.1kb 1 2 3 4 5 Hình 4.6. Sản phẩm PCR đoạn 16s-23s rDNA ITS Ghi chú: 1- sản phẩm PCR của Xanthomonas sp đã được định danh. sử dụng sản phẩm này như đối chứng dương; 2- sản phẩm PCR của dòng XBDL1 3-sản phẩm PCR của dòng XBDL2 4-sản phẩm PCR của dòng XBDL3 5-sản phẩm PCR của dòng XBĐC3 xi Xanthomonas sp này đã đƣợc định danh chính xác là Xanthomonas campestris pv.citri cùng thời gian thực hiện đề tài. Để xác định rõ loài của 4 dòng gây bệnh có 2 phƣơng pháp là giải trình tự hoặc tiếp tục thực hiện phản ứng PCR trên đoạn primer chuyên biệt. Với điều kiện hiện có, chúng tôi tiếp tục thực hiện phản ứng PCR trên hrpW gen với cặp primer chuyên biệt là XACR và XACF ( Dong Suk Park và ctv). 4.6 Thực hiện PCR với cặp mồi XACR và XACF trên hrpW gen Thực hiện phản ứng theo mục 3.4.5.2 nhƣng kết quả không thành công. Tiếp tục thực hiện phản ứng đồng thời thay đổi nồng độ thành phần nhƣng kết quả vẫn không ra. Do đó, chƣa thể khẳng định 4 dòng phân lập đƣợc từ bƣởi Da Láng và bƣởi Đƣờng Cam tại Đồng Nai là Xanthomonas. axonopodis pv. citri. Nhận xét lý do kết quả không thực hiện đƣợc: -Chất lƣợng DNA mẫu chƣa tốt, còn tạp nhiều. -Nguồn vi khuẩn phân lập còn ít.  Dựa vào kết quả đạt đƣợc có thể rút ra thảo luận: phƣơng pháp sinh học phân tử có thể hổ trợ cho phƣơng pháp định danh bằng nuôi cấy, thử nghiệm sinh hóa. Phƣơng pháp sinh học phân tử cụ thể là phƣơng pháp PCR, giải trình tự có thể định danh ở mức loài, tìm ra loài mới, nghiên cứu đƣợc sự đa dạng di truyền: năm 2002, Edmilson R.Goncalves và ctv đã tiến hành phân tích mối quan hệ di truyền giữa 17 loài Xanthomonas.sp bằng thực hiên phản ứng PCR và đọc trình tự sản phẩm PCR.Phản ứng đƣợc thực hiện với cặp mồi Xan1330 và Xan332 đƣợc thiết kế trên đoạn 16s-23s rDNA ITS. Dựa trên kết quả phân tích và thực hiện các thí nghiệm có thể đƣa ra những bƣớc cơ bản để định danh dòng vi khuẩn gây bệnh loét trên cây có múi dựa trên kỹ thuật sinh học phân tử. Các bƣớc cơ bản đó là :(Hình 4.7) xii (5b) (5a) (4) (3b) Phân lập, nuôi cấy, quan sát hình thái đặc trƣng trên các môi trƣờng khác nhau, xác định gram (N.W. Schaad và ctv, không rõ năm ) Chủng bệnh nhân tạo để kiểm tra lại triệu chứng gây bệnh của dòng vi khuẩn phân lập đƣợc ( N.W. Schaad và ctv, không rõ năm ) Kiểm tra sinh hóa (N.W. Schaad và R. E. Stall, không rõ năm ) Thực hiện sắc ký bản mỏng dựa vào sắc tố đặc trƣng để nhận biết dòng Xanthomonas.sp (N.W. Schaad và R. E. Stall, không rõ năm ) Thực hiện phản ứng PCR trên 16s-23s r DNA ITS với cặp primer Xan1330, Xan332 (M. H. R. Khoodoo và ctv, 2005) Giải trình tự sản phẩm PCR, đối chiếu kết quả trên http:// www.ncbi.nlm.nih.gov/BLAST Tiến hành PCR trên vùng hrpW gen với cặp mồi chuyên biệt XACR và XACF cho phép xác định nhanh Xanthomonas axonopodis pv. citri ( Dong Suk Park và ctv, 2006) Hình 4.7. Các bƣớc cơ bản để định danh dòng vi khuẩn gây bệnh loét trên cây có múi dựa trên kỹ thuật sinh học phân tử. (1) (2) (3a) [...]... kết luận đƣợc rằng dòng vi khuẩn gây bệnh loét trên cây bƣởi Da Láng, bƣởi Đƣờng Cam ở huyện Vĩnh Cữu, tỉnh Đồng Nai là do Xanthomonas sp 5.2 Đề nghị - Tiến hành đọc trình tự sản phẩm PCR trên đoạn 16s-23s rDNA để định danh rõ loài vi khuẩn gây bệnh -Tiến hành phân lập nhiều dòng gây bệnh trên nhiều đối tƣợng cây có múi, ở nhiều nơi khác nhau Tiến đến phân tích đa dạng di truyền, tìm và định danh. .. 5 KẾT LUẬN VÀ ĐỀ NGHỊ 5.1 Kết luận - Đã phân lập đƣợc 4 dòng vi khuẩn gây bệnh theo mục 3. 4.1 - Phƣơng pháp chủng bệnh nhân tạo theo mục 3. 4.2 thể hiện tất cả các dòng phân lập đƣợc đều có khả năng gây bệnh, có thể sử dụng trên các đối tƣợng là cây có múi - Thực hiện đƣợc phƣơng pháp sắc ký bản mỏng theo quy trình 3. 4 .3 Tuy nhiên, kết quả không nhƣ mong muốn chƣa thể khẳng định các dòng đƣợc phân lập... PCR trên vùng 16s-23s rDNA ITS với cặp mồi Xan 133 0 và Xan 33 2 (theo M H R Khoodoo và ctv, 2005) cho thấy 4 dòng đều có băng sản phẩm bằng nhau và bằng sản phẩm PCR của dòng Xanthomonas campestrispv.citri đã đƣợc định danh trên cùng cặp mồi - Quy trình ly trích theo mục 3. 4.4 đã ổn định - Quy trình thực hiện phản ứng PCR trên đoạn 16s-23s rDNA ITS theo mục 3. 4.5.1 cho kết quả ổn định * Nhƣ vậy, dựa trên. .. solani phân lập từ nhiều cây ký chủ khác nhau, luận văn tốt nghiệp bộ môn Công Nghệ Sinh Học trƣờng Đại Học Nông Lâm tp.HCM 5 GS.TS Trần Thế Tục, 1998 Giáo trình cây ăn quả, NXB Nông Nghiệp, Hà Nội, Vi t Nam 6 Vi Thị Thanh Hƣờng, 2005 Nghiên cứu tác nhân và biện pháp phòng trừ bệnh loét trên cây bưởi ở xã Tân Bình - huyện Vĩnh Cửu -tỉnh Đồng Nai, luận văn tốt nghiệp khoa Nông Học trƣờng Đại Học Nông... trích trƣớc khi thực hiện phản ứng PCR trên hrp gen xiv Phần 6 TÀI LIỆU THAM KHẢO Tiếng Vi t 1 Bùi Chí Bửu và Nguyễn Thị Lang, 1999 Di truyền phân t : Những nguyên tắc cơ bản trong chọn giống cây trồng NXB Nông Nghiệp, Tp Hồ Chí Minh, Vi t Nam 2 Đƣờng Hồng Dật, 1976 Sổ tay bệnh hại cây trồng tập1 NXB Nông Thôn, Vi t Nam 3 Hồ Huỳnh Thùy Dƣơng, 1998 Sinh học phân tử Nhà xuất bản Giáo Dục 4 Nguyễn Thị... Systematic and Applied Microbiolog 2 8: 36 6 -38 0 12 Jung Gun Kim, Byoung Keun Park, Chang Hyun Yoo, Eun Kyung Jeon, Jonghe e Oh and Ingyu Huang, 20 03 Characterization of the Xanthomonas axon -opodis pv glycines hrp pathogenicity Island American Society for Microbiology 185(10 ) :3 155 -31 66 13 Sambrook Joseph and Rusell W.David, 2001 Molecular Cloning A Laboratory Manual Volume 1 3rd edition, Cold Spring Harbor... 16S-23S r DNA intergenic spacer sequences, International Journal of Systematic and Evolutionary Microbiology, 5 2: 35 5 -36 1 10 Marcos C Alegria, Cassia Docena, Leticia Khater, Carlos H.I Ramos Ana C.R da Silva and Chuck S.Farah, 2004, Identified for the regulatory and structural components and substrates of the Type III secretion system of the phytopathogen Xanthomonas axonopodis pathovar citri, 186(18 ):6 186-6197... và Lê Lƣơng Tề, 1998 Giáo trình bệnh cây nông nghiệp, NXB Nông Nghiệp, Hà Nội, Vi t Nam Tiếng Anh 8 Dong Suk Park, Jae Wook Hyun, Young Jin Park, Jung Sun Kim, Hee Wan Kang, Jang Ho Hahn, Seung Joo Go, 2006, Sensitive and specific detection of Xanthomonas axonopodis pv.citri by PCR using pathovar specific primers based on hrpW gene sequences; Microbiological Research 16 1:1 45-149 xv 9 Elmilson R Goncalves... 67.0ml xvii Glucose 1.0g L-Methionine 0.2g Khoai tây 10g Methyl violet 2B 1.0ml Methyl green 2.0ml Trace element solution 1.0ml Triphenyltetrazolium chloride1.0ml Cycloheximide Agar 50.0 mg 20.0g 5 Môi trƣờng NSCAA Nutrient aga r 23. 0g Tinh bột 15.0g Aga r 15.0g Sau khi hấp tiệt trùng thêm vào: Cycloheximide 5ml Nitrofurantin 1.0ml Vancomycin 1.0ml 6 Môi trƣờng XTS Nutrient aga r Gluco se 23. 0g 5.0g... web "http://en.wikipedia.org/wiki/Citrus_canker" xvi Phần 7 PHỤ LỤC 1 Môi trƣờng PGA (Potato Glucose Agar) Trong 1lit Khoai tây Glucose Agar 200g 20g 18-20g 2 Môi trƣờng YDC (Yeast extract Dextrose Calcium carbonate) Yeast extract 10g Dextrose 20g Calcium carbonate 20g Agar 15g 3 Môi trƣờng SX Tinh bột (khoai tây) 10g Beef extract 1.0g Ammonium chloride 5.0g Dipotassium phosphate 2.0g Methyl violet 2B . dòng vi khuẩn gây bệnh loét trên cây có múi dựa trên kỹ thuật sinh học phân tử. (1) (2) (3a) xiii Phần 5. KẾT LUẬN VÀ ĐỀ NGHỊ 5.1. Kết luận - Đã phân lập đƣợc 4 dòng vi khuẩn gây. 16s-23s rDNA ITS. Dựa trên kết quả phân tích và thực hiện các thí nghiệm có thể đƣa ra những bƣớc cơ bản để định danh dòng vi khuẩn gây bệnh loét trên cây có múi dựa trên kỹ thuật sinh học phân. XBDL3 XBĐ C3 PHẦN 4. KẾT QUẢ VÀ THẢO LUẬN 4.1. Phân lập, xác định gram vi khuẩn gây bệnh loét ở cây bƣởi da láng và bƣởi đƣờng cam Chúng tôi đã tiến hành phân lập đƣợc 4 dòng vi khuẩn trên
- Xem thêm -

Xem thêm: Luận văn : XÂY DỰNG QUY TRÌNH ĐỊNH DANH VI KHUẨN GÂY BỆNH LOÉT TRÊN CÂY BƯỞI BẰNG PHƯƠNG PHÁP SINH HỌC PHÂN TỬ part 3 docx, Luận văn : XÂY DỰNG QUY TRÌNH ĐỊNH DANH VI KHUẨN GÂY BỆNH LOÉT TRÊN CÂY BƯỞI BẰNG PHƯƠNG PHÁP SINH HỌC PHÂN TỬ part 3 docx, Luận văn : XÂY DỰNG QUY TRÌNH ĐỊNH DANH VI KHUẨN GÂY BỆNH LOÉT TRÊN CÂY BƯỞI BẰNG PHƯƠNG PHÁP SINH HỌC PHÂN TỬ part 3 docx

Gợi ý tài liệu liên quan cho bạn