Eur J Biochem 271, 3752–3764 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04317.x Expression in yeast of a novel phospholipase A1 cDNA from Arabidopsis thaliana ´ Alexandre Noiriel1, Pierre Benveniste1, Antoni Banas2, Sten Stymne2 and Pierrette Bouvier-Nave1 Institut de Biologie Mole´culaire des Plantes du CNRS, Departement Isoprenoădes, Institut de Botanique, Strasbourg, France; Department of Crop Science, Swedish University of Agricultural Sciences, Alnarp, Sweden During a search for cDNAs encoding plant sterol acyltransferases, we isolated four full-length cDNAs from Arabidopsis thaliana that encode proteins with substantial identity with animal lecithin : cholesterol acyltransferases (LCATs) The expression of one of these cDNAs, AtLCAT3 (At3g03310), in various yeast strains resulted in the doubling of the triacylglycerol content Furthermore, a complete lipid analysis of the transformed wild-type yeast showed that its phospholipid content was lower than that of the control (void plasmid-transformed) yeast whereas lysophospholipids and free fatty acids increased When microsomes from the AtLCAT3-transformed yeast were incubated with di-[1-14C]oleyl phosphatidylcholine, both the lysophospholipid and free fatty acid fractions were highly and similarly labelled, whereas the same incubation with microsomes from the control yeast produced a negligible labelling of these fractions Moreover when microsomes from AtLCAT3transformed yeast were incubated with either sn-1- or sn-2[1-14C]acyl phosphatidylcholine, the distribution of the labelling between the free fatty acid and the lysophosphatidylcholine fractions strongly suggested a phospholipase A1 activity for AtLCAT3 The sn-1 specificity of this phospholipase was confirmed by gas chromatography analysis of the hydrolysis of 1-myristoyl, 2-oleyl phosphatidylcholine Phosphatidylethanolamine and phosphatidic acid were shown to be also hydrolysed by AtLCAT3, although less efficiently than phosphatidylcholine Lysophospatidylcholine was a weak substrate whereas tripalmitoylglycerol and cholesteryl oleate were not hydrolysed at all This novel A thaliana phospholipase A1 shows optimal activity at pH 6–6.5 and 60–65 °C and appears to be unaffected by Ca2+ Its sequence is unrelated to all other known phospholipases Further studies are in progress to elucidate its physiological role Phospholipases A1 (PLA1) and A2 (PLA2) hydrolyse, respectively, the sn-1 and sn-2 acylester bond of phospholipids, generating free fatty acids (FAs) and lysophospho- lipids Phospholipases B sequencially remove two FA from phospholipids and thus have both phospholipase A and lysophospholipase activities [1] These three types of phospholipase activities (A1, A2 and B) have been described in microsomal preparations from triacylglycerol (TAG)-accumulating tissues of various plants [2] A PLA1 activity has been identified in the tonoplast from Acer pseudoplatanus cells [3] and an Arabidopsis thaliana cDNA encoding a PLA1 was shown to be expressed in the chloroplast [4] But most of the plant PLA papers describe soluble PLA(2) activities [1] Participation of PLAs in plant signal transduction is mentioned for auxin stimulation of growth [5–7] and in response to bacterial and fungal elicitors [8–10], wounding [11] or viral infection [10,12] This involvement of plant PLAs in signal transduction has just been reviewed [13] PLAs are also directly implicated in phospholipid retailoring or degradation during TAG synthesis [2,14] or senescence [15] The participation of PLAs in these various aspects of plant development and response to stress is likely to occur in coordination with phospholipases C and D [16] Several plant cDNAs encoding PLAs have been cloned and characterized They can be classified into three distinct groups according to their sequence The first group includes the small (12–14 kDa) secretory PLA2s [7,17] which contain 12 conserved Cys residues and conserved regions that are likely to represent the active site and Ca2+-binding loop found in animal secretory PLA2s [18] ´ ´ Correspondence to P Bouvier-Nave, Institut de Biologie Moleculaire ´ des Plantes CNRS, Departement Isoprenoă des, Institut de Botanique, 28 rue Goethe, 67083 Strasbourg Cedex, France Fax: +33 90 24 19 21, Tel.: +33 90 24 18 46, E-mail: Pierrette.Nave@bota-ulp.u-strasbg.fr, URL: http://ibmp.u-strasbg.fr/ Abbreviations: DGAT, diacylglycerol:acylCoA acyltransferase; FA, fatty acid; FS, free sterol; FAME, fatty acid methyl ester; G3PAT, glycerol-3-phosphate acyltransferase; LCAT, lecithin : cholesterol acyltransferase; LPAAT, lysophosphatidic acid acyltransferase; LPC, lysophosphatidylcholine; LPE, lysophosphatidylethanolamine; PC, phosphatidylcholine; PDAT, phospholipid:diacylglycerol acyltransferase; PE, phosphatidylethanolamine; PLA1, phospholipase A1; PS, phosphatidylserine; SE, steryl ester; TAG, triacylglycerol Enzymes: DGAT, diacylglycerol:acylCoA acyltransferase (EC 2.3.1.20); LCAT, lecithin:cholesterol acyltransferase (EC 2.3.1.43); PDAT, phospholipid:diacylglycerol acyltransferase (EC 2.3.1.158); PLA1, phospholipase A1 or phosphatidylcholine 1-acylhydrolase (EC 3.1.1.32) Note: Part of this study was presented at the 16th International Plant Lipid Symposium, Budapest, Hungary, 1–4 June 2004 (abstract book pp 33 and 105; http://www.mete.mtesz.hu/pls/) (Received 16 April 2004, revised 27 July 2004, accepted August 2004) Keywords: Arabidopsis thaliana; expression in yeast; phospholipase A1; triacylglycerol increase Ó FEBS 2004 A thaliana cDNA encoding a novel phospholipase A1 (Eur J Biochem 271) 3753 A second group of plant PLAs is formed by soluble, patatin-like (phospho)lipases A(2): an allergen from the latex of Hevea brasiliensis [19], three tobacco leaf soluble proteins induced by virus infection [12], a cowpea galactolipid acylhydrolase stimulated by drought stress [20] and four A thaliana PLAs [6] Patatin is the major storage protein of the potato tuber When cloned and expressed via a baculovirus vector in Sf9 insect cells, it was shown to be an aspecific lipid acyl hydrolase that hydrolyses monoacylglycerols, phosphatidylcholine (PC), monogalactosyldiacylglycerols, di- and triacylglycerols with decreasing efficiency [21] When assayed with PC, purified patatin exhibited a PLA2 activity [22] Recent studies revealed that patatin has a Ser–Asp catalytic dyad and a folding topology related to that of the catalytic domain of animal cytosolic PLA2s Mutagenesis confirmed the critical role of Ser77 and Asp215 in enzymatic activity and of His109 in enzyme stability [23,24] Moreover Rydel et al [24] described the crystal structure of patatin Called either PLA(2)s or lipid acylhydrolases, patatin and related proteins are 40–50-kDa proteins sharing 40–60% identity (mostly in the N-terminal half) and possessing the conserved Gly-X-Ser-X-Gly motif, around the catalytic Ser, found in all the Ser hydrolases [25,26] A third group of plant PLAs has been recently described as lipase-like PLA1 Starting from an A thaliana mutant, defective in anther dehiscence (dad1), the wild-type DAD1 gene was isolated, shown to complement the mutant and to encode a chloroplastic protein of 45 kDa with PLA1 activity [4] Together with 11 homologous genes from the Arabidopsis gene sequence databases, DAD1 presents apparent similarities with some fungal lipases and particularly the characteristic Ôcatalytic triadÕ composed of a Ser, an Asp and a His residue and the Gly-X-Ser-X-Gly consensus motif around the catalytic Ser, both features that are widely conserved in fungal and animal lipases and more generally in Ser hydrolases [25,26] Apart from the Gly-XSer-X-Gly motif common to groups and 3, these three groups of plant PLAs are unrelated Here we wish to introduce a fourth group of plant PLAs, the lecithin : cholesterol acyltransferase (LCAT)-like PLA1, that we discovered in the course of a search for sterol acyltransferases LCAT is the animal serum enzyme that catalyses esterification of lipoprotein-associated cholesterol by the sn-2 acyl group of PC In vitro studies showed that LCAT, when incubated with PC in the absence of cholesterol, also possess PLA2 activity [27] The cloning and characterization of human LCAT [28] and its thorough study by site-directed mutagenesis and molecular modelling [29] showed that LCAT shares the Ser/Asp(Glu)/His catalytic triad and the Gly-X-Ser-X-Gly motif with Ser hydrolases We isolated four A thaliana cDNAs, the deduced amino acid sequences of which share 25–35% identity with human LCAT, including the catalytic triad After expression in yeast, one of these cDNAs was clearly shown to encode a PLA1 Experimental procedures Chemicals All of the lipids and Triton X-100 were 98–99% pure products from Sigma [4-14C]Cholesterol (49 mCiỈmmol)1), [1a,2a(n)-3H] cholesteryl oleate (29 CiỈmmol)1), [1-14C]oleic acid (50 mCiỈmmol)1), [1-14C]oleylCoA (55 mCiỈmmol)1), 1-palmitoyl-2-[1-14C]oleyl phosphatidylcholine (56 mCiỈ mmol)1), 1,2-[1-14C]oleyl phosphatidylcholine (107 mCiỈ mmol)1) and tri-[1-14C]palmitoylglycerol (55 mCiỈmmol)1) were from NEN or Amersham 1-[1-14C]Palmitoyl-2-oleyl phosphatidylcholine (2.2 mCiỈ mmol)1), 1-[1-14C]oleoyl-2-oleyl phosphatidylcholine (2.2 mCiỈmmol)1) and 1-oleoyl-2-[1-14C]oleyl phosphatidylcholine (4.5 mCiỈmmol)1) were synthetized as described previously [2] Strains, media and culture conditions Escherichia coli strain used, XL1 blue recA–[recA1, lac–, endA1, gyrA96, thi, hsdR17, SupE44, relA1 (F’proAB, lac1q, lacZ, DM15, Tn10)] For Saccharomyces cerevisiae, two strains of common genetic background (can1-100, his3-11,15, leu2-3,112, trp1-1, ura3-1): are1are2 (SCY059, MATa, ade2-1, met14D14HpaI-SalI, are1DNA::HIS3, are2D::LEU2) and the corresponding wild-type (SCY062, MATa) were a kind gift of S L Sturley (Columbia University College of Physicians and Surgeons, New York) Two strains were from Euroscarf, Frankfurt: dga1 (BY4742, MATa, his3D1, leu2D0, lys2D0, ura3D0, YOR245c::kanMX4) and lro1 (FY, Mat a, ura3-52, HIS3, leu2D1, LYS2, trp1D63, YNR008w(8, 1768)::kanMX2) Yeast strains transformed with plasmid pYeDP60, harbouring either no insert or the plant cDNA under study, were simultaneously grown for days at 30 °C in minimum medium containing suitable supplements, then transferred into complete medium and grown overnight at 30 °C as previously described [30] The cells were then centrifuged and either freeze-dried for neutral lipid analysis or disrupted for complete lipid analysis or subfractionation Plasmid for yeast transformation The plasmid pYeDP60 [31] was used to transform yeast strains as in [30] Cloning of LCAT-like cDNAs For A thaliana LCAT1 (AtLCAT1), as an EST clone AV4422635 (Kazusa DNA Research Insitute, Chiba, Japan) became available, this latter was sequenced and shown to correspond to a cDNA encompassing the ORF of a gene (At1g27480) called AtLCAT1 Its sequence was shown to encode a polypeptide of 432 amino acids This sequence has been assigned the GenBank accession number AY443040 For Medicago truncatula LCAT1 (MtLCAT1), the cDNA EST clone BE322181 (Samuel Roberts Noble Foundation Medicago truncatula insect herbivory library, USA) presented strong homology with AtLCAT1 After complete sequencing, it was shown to correspond to a cDNA of 1604 bp encoding a polypeptide of 450 amino acids with 57% identity with AtLCAT1 For Lycopersicum esculentum LCAT1 (LeLCAT1), the EST clone BG127829 (Clemson University Genomics Ó FEBS 2004 3754 A Noiriel et al (Eur J Biochem 271) Table Synthetic oligonucleotide primer sequences (5¢ fi 3¢) used for gene cloning and site-directed mutagenesis Bold characters correspond to restriction sites Codons for the changed amino acids are underlined Nucleotides represented in bold characters indicate the point mutations produced For each mutation two oligonucleotides were synthesized: the one shown below and that with the complementary sequence Number Gene cloning ATATATGGATCCATGTCTCTATTACTGG AAGAGATC TATATAGGTACCTTATGCATCAACAGAGACACTTAC ATATATGGATCCATGGGCTGGATTCCGTGTCCGTGCTGGGGAACC AACGACGATGAAAACGCCGGCGAGGTGGCGGATCGTGATCCGGTG CTTCTAGTATCTGGAATTGGAGGCTCTATTCTGCATTCTAAGAAGA AGAATTCAAAGTCTGAAATTCGGGTTTG TATATAGGTACCTTAACCAGAATCAACTACTTTGTG ATATATGGATCCATGGGCTGGATTCCGTGTC TATATAGGTACCTTACTTGTCATCGTCGTCCTTGTAGTCACCAGA ATCAACTACTTTGTGAG TCCATGATATGATTGATATGC GTGGCAATGGTAATCCAC Site-directed mutagenesis GCGTAGGAGTTTCGGGTAGCCTCCGCGGGCTTCTCCGTGATGAAAG GGAGTGTCCTTCTATAACATATTTGGAGTGTCACTTAATACACC GTCACTATCATCTCCCATGCAATGGGAGGACTTATGGTTTC CATATGTAGATGGAGCTGGAACTGTCCCTG GGAGTGTCACTTAATGCACCCTTTGATGTTTG Institute, USA) was sequenced and the resulting polypeptide was shown to have 55% identity with AtLCAT1 For Arabidopsis thaliana LCAT3 (AtLCAT3), the EST cDNA clone BE525177 (ABRC, Ohio State University, USA) was shown by sequencing and comparison with the sequence of the gene At3g03310 to encode a truncated AtLCAT3 polypeptide lacking 43 amino acids A complete ORF was reconstituted by PCR using a direct primer 353 (152 nucleotides) bringing the lacking moiety of the cDNA and a reverse primer 354 complementary to the 3¢ end of the ORF (Table 1) and BE525177 as template Final concentrations of primers were 400 nM, template (20 ng), High Fidelity PCR Master DNA polymerase (Boehringer; 25 lL), total volume 50 lL The PCR was performed using 29 cycles (30 s 94°, 30 s 50°, 72°) This resulted in the amplification of a 1344 bp fragment which after digestion with BamHI and KpnI was subcloned into pBlueScript SK yielding the plasmid AtLCAT3-pSK After checking for the absence of mutations, the insert was subcloned into the yeast shuttle vector pYeDP60, yielding the plasmid AtLCAT3-pYeDP60 AtLCAT3 was deposited in GenBank and assigned the accession number AF421148 The FLAG-tagged A thaliana LCAT3 (FLAGAtLCAT3) was made by PCR so that the C-terminal FLAG epitope (*KDDDDKYD) was fused to the LCAT3 protein To this purpose the reverse primer 359 containing the FLAG sequence was opposed to the direct primer 358 (Table 1) in the presence of AtLCAT3 (20 ng) as template The PCR product was checked for the absence of mutations and subcloned into pYeDP60 as shown above To clone Nicotiana tabacum LCAT3 (NtLCAT3), an orthologue of AtLCAT3 in tobacco, we took advantage of the presence in databases of an mRNA sequence of tobacco (clone q8487, accession number L31415) described as a plant activating sequence encoding a positively charged 337 338 353 354 358 359 362 363 H409L Y346F S177A D384A T352A peptide functioning putatively as a transcriptional activation domain [32] This peptide showed more than 90% identity with a domain of AtLCAT3, therefore this peptide could belong to an orthologue of AtLCAT3 In order to isolate q8487, we designed two primers 362 and 363 (Table 1) corresponding to the 5¢- and 3¢-ends of q8487 and we opposed them in PCR assays containing a tobacco cDNA library (1 lL ¼ 103 pfu), primers (400 nM) and High Fidelity PCR Master DNA polymerase (Boehringer; 25 lL) in a total volume of 50 lL The PCR was performed using 29 cycles (30 s 94°, 30 s 50°, 72°) This resulted in the amplification of a 300-bp fragment The PCR product was subcloned into pGEMT plasmid to allow the sequence to be checked A cDNA library (250 000 pfu) from a 3-week-old N tabacum cv Xanthi line LAB 1-4 calli derived from leaf protoplasts [33] was screened with the 300-bp q8487 sequence Thirteen positive spots were found and the corresponding kZAP phages were recovered, checked to give an amplification product in PCR experiments with primers 362 and 363, and screened a second time with q8487 allowing isolation of positive clones Two of the clones (211 and 314) were selected and sequenced, 314 was shown to be a full-length cDNA of 1691 bp encoding a polypeptide of 451 amino acids sharing 68% identity with AtLCAT3 Therefore it was considered as an orthologue of AtLCAT3 and named NtLCAT3 (GenBank accession number AF468223) For Mesembryanthemum crystallinum LCAT3 (McLCAT3) a search in TIGR databases allowed us to find several orthologues of AtLCAT3 in the ice plant (Mesembryanthemum crystallinum) These clones originated from an ice plant k Uni-Zap XR expression library prepared 48 h after NaCl treatment (J C Cushman, Department of Biochemistry, University of Nevada, Reno, NV) One of Ó FEBS 2004 A thaliana cDNA encoding a novel phospholipase A1 (Eur J Biochem 271) 3755 these clones (BE131533) was sequenced and shown to be a cDNA of 1724 bp with a deletion of 60 bp inside the ORF A complete cDNA of 1793 bp could be reconstituted owing to two other EST cDNAs BE034988 and BE131478 whose sequences encompassed and complemented BE131533 This cDNA encoded a protein of 460 amino acids having 63% identity with AtLCAT3 For Glycine max LCAT3 (GmLCAT3), Glycine max orthologues of AtLCAT3 were found in TIGR databases Superposition of these clones (G max gene index TC reports: TC200937 and TC197463) allowed reconstitution of a putative cDNA of 1551 bp encoding a polypeptide having 63% identity with AtLCAT3 To get Arabidopsis thaliana LCAT4 (AtLCAT4), the EST clone AV549462 (Kazusa DNA Research Insitute, Chiba, Japan) was the starting point After sequencing it was shown that AV549462 was a cDNA of 1802 bp encoding a polypeptide of 536 amino acids In order to determine the function of this cDNA, the ORF was amplified by PCR using primers 337 and 338 (Table 1) at a concentration of 400 nM, AV549462 (20 ng) as template, and High Fidelity PCR Master DNA polymerase (Boehringer; 25 lL) The PCR was performed using 29 cycles (30 s 94°, 30 s 50°, 72°) This resulted in the amplification of a product of 1608 bp which was cloned into pYeDP60 previously opened by BamHI and KpnI The ORF was called AtLCAT4 and was registered in GenBank under accession number AF421149 AtLCAT4 was derived from At4g19860 For Lycopersicum esculentum LCAT4 (LeLCAT4), after sequencing the EST clone BG125533 (Clemson University Genomics Institute, USA), a cDNA of 1853 bp (GenBank accession number AF465780) presenting strong homology with AtLCAT4 was identified This cDNA encoded a polypeptide of 535 amino acids having 66% identity with AtLCAT4 For Medicago truncatula LCAT4 (MtLCAT4), twentyeight EST cDNA clones showing strong homology with AtLCAT4 and coming from the same gene have been reported in TIGR databases A nucleotide sequence (TC86247) originating from the superimposition of these clones has also been given After conceptual translation, a polypeptide sequence of 539 amino acids showing 64% identity with AtLCAT4 has been deduced For Glycine max LCAT4 (GmLCAT4), twentyseven EST cDNA clones showing strong homology with AtLCAT4 and coming from the same gene have been reported in TIGR databases A nucleotide sequence (TC192038) originating from the superimposition of these clones has also been given A polypeptide sequence of 536 amino acids having 65% identity with AtLCAT4 and 79% identity with MtLCAT4 has been deduced after conceptual translation Site-directed mutagenesis on FLAG-tagged AtLCAT3 The mutated alleles of FLAG-AtLCAT3 were obtained by introducing point mutations in the DNA sequence as follows: two separate PCR reactions were performed with  20 ng of the pBluescript vector containing the ORF of AtLCAT3 The first reaction was carried out with the direct primer 358 (Table 1) and a reverse primer introducing the chosen mutation The second PCR was performed with a sense primer, complementary to the antisense primer introducing the mutation, and primer 359 (Table 1) After phenol/chloroform extraction, precipitation of the amplified fragments with M NaCl and purification from agarose (Nucleospin Extract purification kit), the two fragments were hybridized due to the overlapping regions from the direct primer and the one introducing the mutation The hybridization was carried out in a final volume of 20 lL in the presence of PCR buffer (2 lL) (2 at 100°C, 20 at 42°C, and 10 at room temperature) Finally, a PCR on lL of the hybridization mix using primers 358 and 359 allowed the synthesis of the mutated ORF of FLAGAtLCAT3 Amplifications of DNA fragments were performed using High Fidelity PCR Master DNA polymerase (Boehringer) in a final volume of 50 lL Amplification was at 92 °C, followed by 29 cycles of 30 s at 95 °C, 30 s at 52 °C, at 72 °C, and then a 10 elongation at 72 °C Nucleotide sequence determination was performed as described previously [30] Transformation of yeast Transformation was performed according to [30] with some modifications After the heat shock at 42 °C the cells were centrifuged, resuspended in 2% (w/v) glucose (100 lL) and plated on minimum medium containing suitable supplements (50 lgỈmL)1 each) Lipid analysis Steryl esters (SEs), free sterols (FSs) and TAGs (for colorimetric quantification) were extracted from freeze-dried yeast cells and analysed as described previously [30] The complete lipid analysis of control and transformed yeast was performed as described previously [34] except that the chloroform extracts of the fresh cell pellets were shared for separate TLCs of neutral lipids in hexane/diethylether/acetic acid (70 : 30 : 1, v/v/v) and polar lipids in chloroform/ methanol/acetic acid/water (85 : 15 : 10 : 3.5, v/v/v/v) Subcellular fractionation Yeasts were grown for days in 100 mL glucose minimum medium followed by 16 h in 200 mL galactose complete medium (see above) The harvested cells were then disrupted in 0.1 M Tris/HCl pH 7.5 containing 0.6 M sorbitol, mM EDTA and 0.5% (w/v) BSA, in the presence of glass beads (0.45–0.50 mm diameter) by vigorous hand shaking according to Pompon et al [35] The homogenate was centrifuged for 10 at 12 000 g and the supernatant for 60 at 100 000 g The microsomal pellet was resuspended (2–5 mg proteinỈmL)1) in 0.1 M Tris/HCl pH Microsomal suspensions and supernatant samples were kept at )80 °C for several months without significant loss of activity Proteins were quantified as before [30] Western blots of microsomes (50 lg protein) and supernatant (5 lL) from FLAG-AtLCAT3-transformed yeast were achieved after SDS/PAGE, electrotransfer to a nylon membrane (Immobilon-P; Millipore) and immunoblotting with the antiFLAG M2 mAb from Sigma Ó FEBS 2004 3756 A Noiriel et al (Eur J Biochem 271) Enzymatic assays Sterol acyltransferase Sterol acyltransferase assays were carried out with [4-14C]cholesterol according to [36] Lecithin cholesterol acyltransferase LCAT assays included either [4-14C]cholesterol or di-[1-14C]oleylPC under various conditions [36–38] Phospholipid diacylglycerol acyltransferase (PDAT) Assays were performed according to [34] PLA1 assay PLA1 activity was first observed when performing LCAT or PDAT assays The conditions were then adjusted so that the phospholipase activity was proportional to protein concentration and time and optimized with respect to the substrate and detergent concentrations, while the reaction yield was kept below 20%: the microsomal preparation (0.125 mg proteinỈmL)1) was incubated with [1-14C]acyl-labelled PC (250 lM and usually 15 nCi) and Triton X-100 (0.15%) in 0.1 M Tris/HCl pH (final volume, 100 lL) usually for 30 at 30 °C The reaction was stopped by adding a mixture of methylene chloride (400 lL) and methanol (100 lL) containing oleic or palmitic acid, soybean PC and egg lysoPC (50 lg each) as carriers After further addition of 0.03 N HCl (100 lL) and methylene chloride (600 lL), the organic phase was withdrawn and the water phase was extracted twice more with methylene chloride The lipidic extract was separated by TLC in chloroform/methanol/water/acetic acid (65 : 25 : : 1; v/v/v/v) and the radioactive bands of free FA (Rf ¼ 0.9), PC (Rf ¼ 0.4) and lysoPC (Rf ¼ 0.2) were detected with an automatic TLC-linear analyser (Berthold), and scraped from the plate for liquid scintillation counting A large-scale PLA1 assay was set up for GLC and GLC/MS The incubation mixture (1 mL) had the same composition as described above except that unlabelled 1-myristoyl, 2-oleylPC or various dioleylphospholipids was used After purification, the free FA and lysoPC fractions were converted to their fatty acid methyl ester (FAME) derivatives Fatty acids were methylated by 10% boron trifluoride/methanol (Fluka), according to Morrison and Smith [39] whereas LPC was transmethylated by 0.5 M sodium methoxide/methanol (Supelco) Special care was taken to avoid loss of myristoyl methylester as advised by Christie [40] The resulting FAMEs were extracted in hexane then identified and quantified by GLC on a DB-1 capillary column, according to their relative retention time and peak area to the internal standard heptadecanoic acid methylester The GLC temperature program was from 60 °C to 120 °C, 20 °CỈmin)1, from 120 °C to 200 °C, °CỈmin)1 and from 200 °C to 280 °C, 20 °CỈmin)1 Identification of FAMEs was confirmed by their mass spectra AcylCoA synthase The AcylCoA synthase assay was carried out according to [41] Glycerol-3-phosphate acyltransferase The glycerol-3phosphate acyltransferase (G3PAT) assay was carried out as described previously [42] but 0.1 M Tris/HCl, pH 7, was used instead of 0.25 M HEPES, pH Lysophosphatidic acid acyltransferase The lysophosphatidic acid acyltransferase (LPAAT) assay was derived from Bourgis et al [43] with the following modifications: the [1-14C]oleylCoA concentration was 100 lM instead of 10 lM, the lysophosphatidic acid concentration was 100 lM and not 55 lM, the Tris/HCl was pH instead of and phosphatidic acid (20 lM) was added For all of assays mentioned above, the extraction and TLC procedures were as described for PLA1 HMGCoA reductase assay This activity was tested and analysed as described previously [44] Results Cloning of plant homologues of the Homo sapiens lecithin cholesterol acyltransferase During a search for plant genes encoding enzymes involved in sterol esterification by FA, we noticed A thaliana EST clones presenting homology with HsLCAT, the human gene encoding LCAT This enzyme catalyses the transfer of a FA from PC to cholesterol in the blood Our search led to the identification of four genes which were named AtLCAT1, AtLCAT2, AtLCAT3 and AtLCAT4 (At1g27480, At1g04010, At3g03310, At4g19860, respectively) In addition two genes presenting homology with the recently discovered gene of phosphatidylcholine diacylglycerol acyltransferase from Saccharomyces cerevisiae (ScPDAT) [34,45] were found and named AtPDAT1 and AtPDAT2 (At5g13640, At3g44830), the first of which has been recently cloned and shown to encode indeed a PDAT [46,47] These EST cDNA clones allowed the isolation and sequencing of cDNAs corresponding to AtLCAT1, 2, and All these cDNAs encompassed the coding region A more extensive search of orthologues of the A thaliana LCAT genes in various plants has been possible through use of TIGR (The Institute for Genomic Research, http://www.tigr.org) databases (Lactuca sativa LCAT1, Glycine max LCAT3 and LCAT4, Medicago truncatula LCAT2 and LCAT4) and thanks to cloning work performed in our laboratory (Medicago truncatula LCAT1, Nicotiana tabacum and Mesembryanthemum crystallinum LCAT3, Lycopersicum esculentum LCAT4) A phylogenetic tree was constructed for several plant, animal, fungal and bacterial LCAT-like proteins which was rooted with the bacterial Bacillus licheniformis esterase as outgroup (Fig 1) According to this tree the so-named plant LCATs are clearly divided into five subfamilies The LCAT1 subfamily is the closest to mammalian and avian authentic LCATs It is worthy of interest that very close to the mammalian LCATs, one can find proteins such as Bos taurus phospholipid ceramide acyltransferase (PLCAT) or Homo sapiens LCAT-like lysophospholipase (LLPL) which have both been shown recently to possess phospholipase A2 activity and to catalyse in vitro the transfer of a FA group from position of a phospholipid to ceramide [48] The LCAT3 and LCAT4 form two clearly distinct subfamilies which are more distant from the mammalian LCATs than the LCAT1 subfamily, but which are closer to the B licheniformis esterase The plant LCAT2 subfamily Ó FEBS 2004 A thaliana cDNA encoding a novel phospholipase A1 (Eur J Biochem 271) 3757 appears also more distant from the mammalian and avian LCATs than the plant LCAT1 but close to the plant PDAT subfamily which groups with the yeast PDATs The deduced protein sequences of all of these LCAT-like genes were aligned and several highly conserved regions were shown (Fig 2) They include the regions around the three essential amino acids of HsLCAT which form the catalytic triad common with all the Ser hydrolases In order to determine the functions of the products of the AtLCAT genes their expression in yeast was undertaken The cDNA coding regions of AtLCAT1, and were inserted into the yeast expression vector pYeDP60 So far, the expression studies of AtLCAT1 and in yeast has not allowed their function to be determined The functional expression of AtLCAT2 was performed independently in A thaliana The encoded protein was shown to be a phospholipid sterol acyltransferase [48a,48b] We report hereafter the characterization of the AtLCAT3-encoded protein Expression of AtLCAT3 in various yeast strains Fig Phylogenetic tree showing LCAT-like proteins The phylogenic tree was constructed for several plant, animal, fungal and bacterial LCAT-like proteins BlESTER (B licheniformis esterase U35855); AtLCAT4 (Arabidopsis thaliana AF421149, comes from At4g19860); LeLCAT4 (Lycopersicum esculentum AF465780); GmLCAT4 (Glycine max TC192038); MtLCAT4 (Medicago truncatula TC86247); McLCAT3 (Mesembryanthemum crystallinum EST, BE131533); GmLCAT3 (G max EST, TC200937); AtLCAT3 (A thaliana phospholipase A1, AF421148, comes from At3g03310); NtLCAT3 (Nicotiana tabacum phospholipase A1, AF468223); CeLCAT (Caenorhabditis elegans NP_492033); BtPLCAT (Bos taurus phospholipid ceramide acyltransferase NP_776985); HsLLPL (Homo sapiens LCAT-like lysophospholipase NP_036452); GgLCAT (Gallus gallus lecithin cholesterol acyltransferase P53760); MmLCAT (Mus musculus NP_032516); HsLCAT (H sapiens NP_000220); OcLCAT (Oryctophagum communis P53761); AgLCAT (Anopheles gambiae XP_319740); DmLCAT (Drosophila melanogaster AF145599); AtLCAT1 (A thaliana AY443040, comes from At1g27480); LsLCAT1 (Lactuca sativa EST BQ864610); MtLCAT1 (M truncatula AF533771); AtLCAT2 (A thaliana NP_171897, comes from At1g04010); MtLCAT2 (M truncatula AF493159); AtPDAT2 (A thaliana NP_190069, comes from At3g44830); AtPDAT1 (A thaliana AY160110, comes from At5g13640); MtPDAT1 (M truncatula AY210981); ScPDAT (Saccharomyces cerevisiae phospholipid diacylglycerol acyltransferase P40345); SpPDAT (Schizoaccharomyces pombe phospholipid diacylglycerol acyltransferase O94680) Accession numbers beginning by AF and AY correspond to products which have been cloned and/or characterized in our laboratory The phylogenetic tree has been rooted with BlESTER as the outgroup Numbers at the nodes of the phylogenetic tree are bootstraps, indicating the frequencies of occurrence of partitions found in the tree Because AtLCAT3 was potentially encoding a sterol acyltransferase, it was first expressed in the yeast mutant are1are2 defective in sterol acyltransferase genes In this mutant, sterol ester biosynthesis is absent [49] and microsomes from this strain lack sterol acyltransferase activity [50] The neutral lipid content of the transformed yeast was compared to the control (void plasmid-transformed) yeast Surprisingly the expression of AtLCAT3 resulted in the doubling of the yeast TAG (Fig 3) and FS contents whereas the SE content remained unchanged (data not shown) Incubation of di-[1-14C]oleyl PC with microsomes from AtLCAT3- or void plasmid-transformed are1are2, in the presence of cholesterol or dioleylglycerol, did not show any measurable acyltransferase activity but resulted in a high hydrolysis of PC into lysoPC (LPC) and FAs for microsomes from the transformed yeast, whereas the control microsomes produced only a low hydrolysis of PC Considering the increase in TAG content of are1are2 when transformed with AtLCAT3, we wondered whether AtLCAT3 might be involved in plant TAG synthesis Because TAG synthesis in yeast is performed by several enzymes, mainly by diacylglycerol : acylCoA acyltransferase (DGAT), partly by PDAT and a little by ARE1 and ARE2 [51–53], we transformed the corresponding mutants dga1 and lro1 and the wild-type strain with AtLCAT3 Whereas AtLCAT3-transformed wild-type and lro1 strains as well as are1are2 had a doubled TAG content compared to that of the corresponding control strain, transformation of the dga1 mutant did not produce any change (Fig 3) These results clearly show that the yeast DGAT is involved in the observed TAG increase and consequently that AtLCAT3 is not directly implicated Next, microsomes from these three transformed (and control) strains were prepared and tested with di-[1-14C] oleyl PC: for each AtLCAT3-transformed strain including dga1, the PC acylhydrolase activity was much higher (10–100 times according to the assay conditions) than that of the control microsomes 3758 A Noiriel et al (Eur J Biochem 271) Ó FEBS 2004 Fig Alignment of the deduced aminoacid sequences of LCAT-like cDNAs Five highly conserved regions are shown The conserved amino acids are boxed The Ser177, Asp384 and His409 residues of AtLCAT3 corresponding to the catalytic triad of HsLCAT are indicated by a triangle, as well as two other residues (Tyr346 and Thr352) of AtLCAT3 which have been mutated while LPC, lysophosphatidylethanolamine (LPE) and free FA were strongly increased The increase in TAG that we first measured by colorimetry (Fig 3) was clearly confirmed, although to a lesser extent, by this GLC analysis Finally the total FA content was slightly (by 16%) but significantly increased in the AtLCAT3-transformed yeast and the amount of overproduced total FA (24 nmỈmg dry weight)1) corresponds roughly to the overproduced TAG (19.5 nmỈmg dry weight)1) (Fig 4) In the same analysis, steryl esters, diacylglycerol, phosphatidylinositol, cardiolipin and lysophosphatidic acid were shown not to be changed significantly (data not shown) Fig TAG content of various control and AtLCAT3-transformed yeast strains TAGs were extracted from freeze-dried cells (at least two clones per strain), purified by TLC and quantified threefold by the colorimetric assay described in the experimental section Deviation from the mean was less than 12.5% White bars, void-plasmid-transformed strains; black bars, AtLCAT3-transformed strains Expression of AtLCAT3 in wild-type yeast: lipid analysis For a complete study of the effects of AtLCAT3 transformation on the yeast lipid content, the neutral and polar lipid contents of AtLCAT3-transformed wild-type yeast were compared to those of the control yeast by mean of GLC analysis of the FAMEs generated from these fractions (Fig 4) The PC, phosphatidylethanolamine (PE) and phosphatidylserine (PS) contents of the AtLCAT3-transformed yeast were found to be half those of the control yeast Expression of AtLCAT3 in wild-type yeast: enzyme characterization As mentioned above, incubation of di-[1-14C]oleyl PC with microsomes from various AtLCAT3-transformed yeast strains yielded high labelling of the free FA and LPC fractions whereas the control microsomes produced a much weaker hydrolysis of PC After optimization of this PC acylhydrolase assay with microsomes from AtLCAT3transformed and control wild-type yeast (see Experimental procedures), the yields of PC hydrolysis amounted to around 15% and 0.5%, respectively (Table 2), corresponding to PC acylhydrolase specific activities of around 600 and 20 nmolesỈmg protein)1Ỉh)1, respectively When this di-[1-14C]oleyl PC was incubated with microsomes from AtLCAT3-transformed yeast, the free FA and LPC fractions were labelled equally (Table 3) To study the positional specificity of AtLCAT3 towards the two acyl groups of PC, these microsomes were incubated with sn-1or sn-2-specifically labelled dioleylPC or 1-palmitoyl, 2-oleyl Ó FEBS 2004 A thaliana cDNA encoding a novel phospholipase A1 (Eur J Biochem 271) 3759 Table Hydrolase activity towards various lipids of microsomes from control and AtLCAT3-transformed wild-type yeast Microsomal preparations from AtLCAT3-transformed and control wild-type yeast (0.125 mgỈmL)1) were incubated with various lipids (250 lM) in the presence of 0.15% (v/v)Triton X-100 for 30 Lipids were extracted and separated by TLC The radioactivity of the products was measured by liquid scintillation Values are the mean of duplicates and experiments were repeated at least twice Percentage of substrate hydrolysis with microsomes from Substrates Void plasmidtransformed WT yeast AtLCAT3transformed WT yeast Tri-[1-14C]palmitoylglycerola [1a,2a(n)3H]Cholesteryl oleatea [1–14C]Acyl PC b 0.0 0.0 0.5 0.0 0.0 15.0 a Tripamitoylglycerol and cholesteryl oleate were assayed in the presence of either 0.03 or 0.15% Triton X-100 b The values for labelled PC are a mean of the incubations presented in Table and the corresponding controls Table Positional specificity of the phospholipid acylhydrolase activity of AtLCAT3: hydrolysis of specifically labelled PCs Microsomal preparations from AtLCAT3-transformed wild-type yeast (0.125 mgỈmL)1) were incubated with various PCs (250 lM) in the presence of 0.15% (v/v) Triton X-100 for 15 For further details see Table legend Fig Complete lipid analysis of control and AtLCAT3-transformed wild-type yeast FAMEs from individual and total lipids were analysed by GLC The cultures and analyses were carried out in triplicate Standard deviation was less than 2% in analyses of total fatty acids (TFA) content and less than 15% in analyses of individual lipid classes FA, free fatty acids PC (Table 3) The distribution of radioactivity between the free FA and the LPC fractions indicates for AtLCAT3 a selectivity for the sn-1 position of about 90% with dioleylPC and 85% with 1-palmitoyl, 2-oleyl PC The sn-1 specificity of AtLCAT3 was also studied by GLC analysis of the FA and LPC released during the incubation of 1-myristoyl, 2-oleyl PC (Fig 5): myristic acid accumulated almost exclusively in the free FA fraction and oleic acid in the LPC fraction Therefore with 1-myristoyl, 2-oleyl PC, the selectivity of AtLCAT3 for the sn-1 position is almost 100% Dioleyl phosphatidylethanolamine and dioleyl phosphatidic acid as well as 1-oleyl LPC were compared to dioleyl PC as substrates GLC determination of the released oleic acid showed that phosphatidylethanolamine, phosphatidic acid and LPC hydrolysis amounted to 50, 40 and 8%, respectively, that of PC (Fig 6) On the other hand, incubations of tri-[1-14C]palmitoyl glycerol or [2,3-3H] cholesteryl oleate did not produce any labelled palmitic acid or cholesterol, respectively, excluding for AtLCAT3 a TAG lipase or steryl ester hydrolase activity (Table 2) Finally, using the optimized assay conditions for the phospholipid acylhydrolase activity of AtLCAT3, we looked again for a potential acyltransferase activity for this Relative labelling (%) in Substrates Free fatty acid fraction LPC fraction 1,2-Di[1-14C]oleyl PC 1-[1-14C]Oleyl,2-oleyl PC 1-Oleyl,2-[1-14C]oleyl PC 1-[1-14C]Palmitoyl,2-oleyl PC 1-Palmitoyl,2-[1-14C]oleyl PC 52 91 11 86 16 48 89 14 84 protein Sterols and dioleylglycerol were added to the incubation mixture but this did not disclose any LCAT or PDAT activity As AtLCAT3 (a) does not show any acyltransferase activity, (b) does not show any acylhydrolase activity towards TAG or cholesteryl ester, and (c) hydrolyses PC specifically at the sn-1 position and hydrolyses other phospholipids, it is most probably a PLA1 Its pH optimum was carefully determined with either 1,2-di-[1-14C]oleyl PC or 1-palmitoyl, 2-[1-14C]oleyl PC: the activity curve has a maximum at pH 6–6.5 Its optimal incubation temperature was surprisingly shown to be 60–65 °C and its activity was unaffected by 0.1, or 10 mM Ca2+, under our assay conditions The distribution of AtLCAT3 between the microsomal and 100 000 g supernatant subfractions from the transformed yeast was determined by comparing their total activities They were in a ratio of 84 : 16 indicating that most of this protein is associated with the microsomal 3760 A Noiriel et al (Eur J Biochem 271) Ó FEBS 2004 Fig Phospholipid acylhydrolase activity of AtLCAT3 towards 1-myristoyl, 2-oleyl PC After incubation of this PC (250 lM) with AtLCAT3-transformed wild-type yeast microsomes (0.125 mgỈmL)1) in mL for the indicated times, the amounts of myristic and oleic acids in the free FA (FFA) and lysoPC (LPC) fractions were determined by GLC analysis of their FAMEs The values found for the corresponding blanks incubated without exogenous substrate were deduced Results are from duplicate experiments Fig Substrate specificity of AtLCAT3 towards various phospholipids After incubation of dioleylPC (DOPC), dioleylphosphatidylethanolamine (DOPE), dioleylphosphatidic acid (DOPA) and oleyllysoPC (OLPC) for 30 with AtLCAT3-transformed wild-type yeast microsomes, the free FA fraction was analysed by GLC of the FAMEs The values found for the corresponding zero time and the blank incubated without exogenous substrate were deduced Results are from duplicate experiments membranes, in agreement with a Western blot analysis using microsomes and supernatant from the FLAG-AtLCAT3transformed yeast (data not shown) Finally the involvement of Ser177, Asp384 and His409 in the catalysis, by analogy with the conserved catalytic triad of HsLCAT (Fig 2), was checked by directed mutagenesis Indeed the point mutations S177A, D384A or H409L resulted in the disappearance of PLA1 activity and of the associated TAG production, although the mutated proteins were produced in similar amounts as AtLCAT3, as Fig Expression of several FLAG-tagged alleles of AtLCAT3 in wildtype yeast Control, void plasmid-transformed yeast; F-Asp384Ala, F-Tyr346Phe, F-His409Leu, F-Ser177Ala, F-Thr352Ala, yeast strains transformed with FLAG-tagged and mutated alleles of AtLCAT3 AtLCAT3 and F-AtLCAT3, non tagged and FLAG-tagged AtLCAT3-transformed yeast (A) Western analysis Microsomes (50 lg protein) were resolved by SDS/PAGE and proteins were immunoblotted with an anti-FLAG serum The mass of 46 kDa corresponds to the expected mass for AtLCAT3 (B) Microsomal PLA1 activity and (C) TAG content (colorimetric determination) of these strains relative to those from AtLCAT3 Analyses were performed in duplicate on two clones per strain Deviation from the mean was less than 12.5% estimated by Western blots of these FLAG-tagged proteins in the respective microsomes For comparison, Y346F and T352A mutations resulted in a decrease but not the suppression of PLA1 activity and TAG production (Fig 7) although these amino acids are also invariant (Fig 2) Expression of AtLCAT3 in wild-type yeast: consequences on yeast lipid metabolism In an attempt to relate phospholipid hydrolysis and TAG synthesis, [1-14C]oleic acid was incubated with 12 000 g supernatants from AtLCAT3-transformed and control wild-type yeast, under acylCoA synthase assay conditions (see Experimental procedures) In fact the labelling of TAGs in the cell-free extract of the transformed yeast was half that of the control yeast, whereas labelling of PC and other Ó FEBS 2004 A thaliana cDNA encoding a novel phospholipase A1 (Eur J Biochem 271) 3761 Fig Light micrographs of yeast cells after staining with Red Sudan IV Void plasmid-transformed yeast (left) and AtLCAT3-transformed yeast (right) in stationary phase were collected, washed with water, immersed for 30 in the ethanolic staining solution and rinsed with water The arrows indicate oil bodies The scale bar corresponds to 40 lm phospholipids was increased by a factor of three-to-four The labelling of phospholipids was similarly increased when microsomes from these yeasts were incubated with [1-14C]oleylCoA in the presence of either glycerol 3-phosphate (G3PAT assay) or lysophosphatidic acid (LPAAT assay) These results suggest that in AtLCAT3transformed yeast, the FAs and lysophospholipids released by AtLCAT3 are recycled into the phospholipid pool As the FS content was doubled in AtLCAT3-transformed yeast, the HMGCoA reductase activities of microsomes from transformed and control wild-type yeast were compared This early and rate-limiting enzyme of the sterol biosynthesis pathway was indeed stimulated by a factor of 2.8, suggesting a coregulation with the phospholipid biosynthesis to fit the modified phospholipid content and composition (Fig 4) In any case the strong depletion in the phospholipid content of AtLCAT3-transformed yeast as well as the increased level of lysophospholipids and free FAs not seem to be deleterious to this yeast because it grew as well as the control yeast in terms of cell mass However a microscopic observation showed that the transformed cells had a smaller average diameter, a thicker cell wall and contained more oil bodies (Fig 8) Discussion This study describes the characterization of the A thaliana gene AtLCAT3 (At3g03310) which encodes a protein of 46 kDa sharing 25% identity with human LCAT (HsLCAT) and 23% identity with yeast phospholipid diacylglycerol acyltransferase (ScPDAT) Its expression in yeast, followed by various in vitro studies, clearly demonstrated that AtLCAT3 encodes a PLA1 (Tables and 3, Figs 3–6) Subcellular fractionation indicated that AtLCAT3 is mainly associated with the microsomal fraction This result is puzzling as the amino acid sequence of AtLCAT3 does not contain any membrane-spanning domain However no attempts were made to wash the microsomes: the protein might be only adsorbed or weakly bound to the microsomal membranes The comparison of the lipid content of AtLCAT3transformed yeast and that of the void plasmid-transformed yeast showed a decrease (by a factor 2) of the PC, PE and PS contents and a strong increase of the free FAs, LPC and LPE levels (Fig 4), in accordance with the phospholipid acylhydrolase activity shown for AtLCAT3 The decrease in PS suggests that this phospholipid would be another substrate for AtLCAT3, together with PC and PE, whereas phosphatidylinositol, the level of which was not significantly altered, would not be substrate Interestingly, the FA composition of the PC and PE from the AtLCAT3-transformed yeast diverge significantly from those of the control yeast (Fig 4), suggesting for AtLCAT3 a preference for unsatured FAs If such a selectivity for unsatured FAs at the sn-1 position was confirmed in vitro for AtLCAT3, it could indicate a role in phospholipid remodelling for this novel PLA1 Moreover, the lipid analyses showed an increase of the total FA content in the AtLCAT3-transformed yeast together with an increase of the TAG content of the yeast (Fig 4) This last result confirms the role of yeast TAGs in FA storage [54] It is noteworthy that the reverse situation was described in a yeast mutant where the three genes encoding phospholipases B had been deleted: the total cellular phospholipid content was increased by 40% whereas the TAG level was reduced by 50% [55] We performed point mutations on the three conserved amino acids known to be essential for LCATs (catalytic triad common to all Ser hydrolases) and confirmed that AtLCAT3 also requires these three amino acids to be active 3762 A Noiriel et al (Eur J Biochem 271) Hence hydrolysis at its active site certainly follows the well-known mechanism of Ser hydrolases [25,26,29] This directed mutagenesis study included two other conserved amino acids which turned out not to be essential Taken together, these results underline the close relationship between the level of PLA1 activity and the amount of accumulated TAGs (Fig 7) They might therefore constitute clues to engineer yeast strains for higher production of TAGs Finally the decrease in phospholipids, increase in free FAs and TAGs were accompanied by an increase in the FS content of this transformed yeast, probably to compensate for the change in the phospholipid content and/or composition Accordingly the HMGCoA reductase activity was shown to be more than doubled in microsomes from the AtLCAT3-transformed yeast, suggesting a regulation of the sterol metabolism in response to the phospholipid perturbation Another gene from A thaliana was recently shown to encode a PLA1 [4] Starting from the mutant dad1 defective in anther dehiscence, pollen maturation and flower opening, these authors isolated the corresponding DAD1 gene, studied the function of the DAD1 protein by expression in E coli, showed its targeting to the chloroplast and its restricted expression in stamen filaments They suggest that DAD1 might catalyse the initial step of jasmonic acid biosynthesis in the filaments thus regulating the water transport in stamens and petals [4] As the amino acid sequence of AtLCAT3 is not related at all to that of DAD1, it constitutes a new family of plant PLA1, together with its orthologues McLCAT3, GmLCAT3 and NtLCAT3 (Fig 1) The present work has allowed the characterization of AtLCAT3 by heterologous expression in yeast Its current expression in planta should allow disclosure of the physiological role of the encoded protein As most of the plant glycerolipid acylhydrolases cloned and characterized so far (small PLA2s, patatin-like glycerolipid acylhydrolases and the PLA1 DAD1) are involved in signal transduction, the spatio-temporal expression pattern of AtLCAT3 under normal and stress conditions will be studied Acknowledgements We are especially indebted to the following scientists who kindly sent us EST clones: Dr Erika Asamizu and Nobumi Kusuhara (Kazusa DNA Research Institute, Chiba, Japan), Dr Joe A Clouse (The Samuel Roberts Noble Foundation, Inc., Ardmore, USA), Dr Doreen Ware (ABRC, The Ohio State University, Columbus, USA), Dr John C Cushman (Department of Biochemistry, University of Nevada, Reno, USA), Dr Maryvonne Rosseneu (Department of Biochemistry and Molecular Biology, University of Ghent, Belgium) We thank also Dr Steven L Sturley (Columbia University College of Physicians and Surgeons, New York, USA) for yeast strains, Annie Hoeft for assistance in GC-MS and Hubert Schaller for helpful discussions Funding from the Swedish University of Agricultural Science strategic research grants ÔThe Biological Factory/AgriFunGenÕ and Stiftelsen Svensk Oljevaxtforskning (SSO) are gratefully ă acknowledged References Wang, X (2001) Plant phospholipases Annu Rev Plant Physiol Plant Mol Biol 52, 211–231 Ó FEBS 2004 Stahl, U., Banas, A & Stymne, S (1995) Plant microsomal phospholipid acyl hydrolases have selectivities for uncommon fatty acids Plant Physiol 107, 953–962 Tavernier, E & Pugin, A (1995) Phospholipase activities associated with the tonoplast from Acer pseudoplatanus cells: identification of a phospholipase A1 activity Biochim Biophys Acta 15, 118–122 Ishiguro, S., Kawai-Oda, A., Ueda, J., Nishida, I & Okada, K (2001) The defective in anther dehiscence gene encodes a novel phospholipase A1 catalyzing the initial step of jasmonic acid biosynthesis, which synchronizes pollen maturation, anther dehiscence, and flower opening in Arabidopsis Plant Cell 13, 191–209 Paul, R.U., Holk, A & Scherer, G.F.E (1998) Fatty acids and lysophospholipids as potential second messengers in auxin action Rapid activation of phospholipase A2 activity by auxin in suspension-cultured parsley and soybean cells Plant J 16, 601– 611 Holk, A., Rietz, S., Zahn, M., Quader, H & Scherer, G.F.E (2002) Molecular identification of cytosolic, patatinrelated phospholipases A from Arabidopsis with potential functions in plant signal transduction Plant Physiol 130, 90– 101 Lee, H.Y., Bahn, S.C., Kang, Y.-M., Lee, K.H., Kim, H.J., Noh, E.K., Palta, J.P., Shin, J.S & Ryu, S.B (2003) Secretory low molecular weight phospholipase A2 plays important roles in cell elongation and shoot gravitropism in Arabidopsis Plant Cell 15, 1990–2002 Chandra, S., Heinstein, P.F & Low, P.S (1996) Activation of phospholipase A by plant defense elicitors Plant Physiol 110, 979–986 Viehweger, K., Dordschbal, B & Roos, W (2002) Elicitor-activated phospholipase A(2) generates lysophosphatidylcholines that mobilize the vacuolar H+ pool for pH signaling via the activation of Na+-dependent proton fluxes Plant Cell 14, 1509– 1525 10 Dhondt, S., Gouzerh, G., Muller, A., Legrand, M & Heitz, T (2002) Spatio-temporal expression of patatin-like lipid acyl hydrolases and accumulation of jasmonates in elicitor-treated tobacco leaves are not affected by endogenous levels of salicylic acid Plant J 32, 749–762 11 Narvaez-Vasquez, J., Florin-Christensen, J & Ryan, C.A (1999) Positional specificity of a phospholipase A activity induced by wounding, systemin, and oligosaccharide elicitors in tomato leaves Plant Cell 11, 2249–2260 12 Dhondt, S., Geoffroy, P., Stelmach, B.A., Legrand, M & Heitz, T (2000) Soluble phospholipase A2 activity is induced before oxylipin accumulation in tobacco mosaic virus-infected tobacco leaves and is contributed by patatin-like enzymes Plant J 23, 431–440 13 Ryu, S.B (2004) Phospholipid-derived signaling mediated by phospholipase A in plants Trends Plant Sci 9, 229–235 14 Shanklin, J & Cahoon, E.B (1998) Desaturation and related modifications of fatty acids Annu Rev Plant Physiol Plant Mol Biol 49, 611–641 15 Ohlrogge, J & Browse, J (1995) Lipid biosynthesis Plant Cell 7, 957–970 16 Chapman, K.D (1998) Phospholipase activity during plant growth and development and in response to environmental stress Trends Plant Sci 3, 419–426 17 Stahl, U., Lee, M., Sjodahl, S., Archer, D., Cellini, F., Ek, B., ă Iannacone, R., MacKenzie, D., Semeraro, L., Tramontano, E & Stymne, S (1999) Plant low-molecular-weight phospholipase A2s (PLA2s) are structurally related to animal secretory PLA2s and are present as a family of isoforms in rice (Oryza sativa) Plant Mol Biol 41, 481–490 Ó FEBS 2004 A thaliana cDNA encoding a novel phospholipase A1 (Eur J Biochem 271) 3763 18 Dennis, E.A (1997) The growing phospholipase A2 superfamily of signal transduction enzymes Trends Biochem Sci 22, 1–2 19 Sowka, S., Wagner, S., Krebitz, M., Arija-Mad-Arif, S., Yusof, F., Kinaciyan, T., Brehler, R., Scheiner, O & Breiteneder, H (1998) cDNA cloning of the 43-kDa latex allergen Hev b with sequence similarity to patatins and its expression in the yeast Pichia pastoris Eur J Biochem 255, 213–219 20 Matos, A.R., d’Arcy-Lameta, A., Franca, M., Petres, S., Edelman, L., Kader, J., Zuily-Fodil, Y & Pham-Thi, A.T (2001) A novel patatin-like gene stimulated by drought stress encodes a galactolipid acyl hydrolase FEBS Lett 491, 188–192 21 Andrews, D.L., Beames, B., Summers, M.D & Park, W.D (1988) Characterization of the lipid acyl hydrolase activity of the major potato (Solanum tuberosum) tuber protein, patatin, by cloning and abundant expression in a baculovirus vector Biochem J 252, 199–206 22 Senda, K., Yoshioka, H., Doke, N & Kawakita, K (1996) A cytosolic phospholipase A2 from potato tissues appears to be patatin Plant Cell Physiol 37, 347–353 23 Hirschberg, H.J., Simons, J.W., Dekker, N & Egmond, M.R (2001) Cloning, expression, purification and characterization of patatin, a novel phospholipase A Eur J Biochem 268, 5037– 5044 24 Rydel, T.J., Williams, J.M., Krieger, E., Moshiri, F., Stallings, W.C., Brown, S.M., Pershing, J.C., Purcell, J.P & Alibhai, M.F (2003) The crystal structure, mutagenesis, and activity studies reveal that patatin is a lipid acyl hydrolase with a Ser-Asp catalytic dyad Biochemistry 42, 6696–6708 25 Brady, L., Brzozowski, A.M., Derewenda, Z.S., Dodson, E., Dodson, G., Tolley S., Turkenburg, J.P., Christiansen, L., HugeJensen, B., Norskov, L., Thim, L & Menge, U (1990) A serine protease triad forms the catalytic centre of a triacylglycerol lipase Nature 343, 767–770 26 Winkler, F.K., D’Arcy, A & Hunziker, W (1990) Structure of human pancreatic lipase Nature 343, 771–774 27 Kitabatake, K., Piran, U., Kamio, Y., Doi, Y & Nishida, T (1979) Purification of human plasma lecithin: cholesterol acyltransferase and its specificity towards the acyl acceptor Biochim Biophys Acta 573, 145–154 28 McLean, J., Fielding, C., Drayna, D., Dieplinger, H., Baer, B., Kohr, W., Henzel, W., Lawn, R (1998) Cloning and expression of human lecithin-cholesterol acyltransferase cDNA Proc Natl Acad Sci USA 83, 2335–2339 29 Peelman, F., Vinaimont, N., Verhee, A., Vanloo, B., Verschelde, J.L., Labeur, C., Seguret-Mace, S., Duverger, N., Hutchinson, G., Vandekerckhove, J., Tavernier, J & Rosseneu, M A proposed architecture for lecithin cholesterol acyl transferase (LCAT): identification of the catalytic triad and molecular modeling Protein Sci 7, 587–599 ´ 30 Bouvier-Nave, P., Benveniste, P., Oelkers, P., Sturley, S.L & Schaller, H (2000) Expression in yeast and tobacco of plant cDNAs encoding acyl CoA: diacylglycerol acyltransferase Eur J Biochem 267, 85–96 31 Urban, P., Werck-Reichhart, D., Teutsch, H.G., Durst, F., Regnier, S., Kazmaier, M & Pompon, D (1994) Characterization of recombinant plant cinnamate 4-hydroxylase produced in yeast Kinetic and spectral properties of the major plant P450 of the phenylpropanoid pathway Eur J Biochem 222, 843–850 32 Estruch, J.J., Crossland, L & Goff, S.A (1994) Plant activating sequences: positively charged peptides are functional as transcriptional activation domains Nucleic Acids Res 22, 3983–3989 33 Maillot-Vernier, P., Gondet, L., Schaller, H., Benveniste, P & Belliard, G (1991) Genetic study and further biochemical characterization of a tobacco mutant that overproduces sterols Mol Gen Genet 231, 33–40 34 Dahlqvist, A., Stahl, U., Lenman, M., Banas, A., Lee, M., Sandager, L., Ronne, H & Stymne, S (2000) Phospholipid: diacylglycerol acyltransferase: an enzyme that catalyzes the acylCoA-independent formation of triacylglycerol in yeast and plants Proc Natl Acad Sci USA 97, 6487–6492 35 Pompon, D., Louerat, B., Bronine, A & Urban, P (1996) Yeast expression of animal and plant P450s in optimized redox environments Methods Enzymol 272, 51–64 ´ 36 Bouvier-Nave, P & Benveniste, P (1995) Sterol acyl transferase and steryl ester hydrolase activities in a tobacco mutant which overproduces sterols Plant Sci 110, 11–19 37 Aron, L., Jones, S & Fielding, C.J (1978) Human plasma lecithin-cholesterol acyltransferase Characterization of cofactordependent phospholipase activity J Biol Chem 253, 7220– 7226 38 Buckley, J.T (1982) Substrate specificity of bacterial glycerophospholipid: cholesterol acyltransferase Biochemistry 21, 6699– 6703 39 Morrison, W.R & Smith, L.M (1964) Fatty acid methyl esters preparation J Lipid Res 5, 600–608 40 Christie, W.W (1993) Preparation of ester derivatives of fatty acids for chromatographic analysis In Advances in Lipid Methodology – II (Christie, W.W., ed.), pp 69–111 Oily Press, Dundee 41 Faergeman, N.J., Black, P.N., Zhao, X.D., Knusen, J & Di Russo, C.C (2001) The acyl-CoA synthetases encoded within FAA1 and FAA4 in Saccharomyces cerevisiae function as components of the fatty acid transport system linking import, activation, and intracellular utilization J Biol Chem 276, 37051–37059 42 Hayman, M.W., Fawcett, T & Slabas, A.R (2002) Kinetic mechanism and order of substrate binding for sn-glycerol-3phosphate acyltransferase from squash (Cucurbita moschata) FEBS Lett 514, 281–284 43 Bourgis, F., Kader, J.-C., Barret, P., Renard, M., Robinson, D., Robinson, C., Delseny, M & Roscoe, T.J (1999) A plastidial lysophosphatidic acid acyltransferase from oilseed rape Plant Physiol 120, 913–921 44 Bach, T.J., Rogers, D.H & Rudney, H (1986) Detergent-solubilization, purification, and characterization of membranebound 3-hydroxy-3-methylglutaryl-coenzyme A reductase from radish seedlings Eur J Biochem 154, 103–111 45 Oelkers, P., Tinkelenberg, A., Erdeniz, N., Cromley, D., Billheimer, J.T & Sturley, S.L (2000) A lecithin cholesterol acyltransferase-like gene mediates diacylglycerol esterification in yeast J Biol Chem 275, 15609–15612 46 Banas, A., Lenman, M., Dahlqvist, A & Stymne, S (2003) Cloning and characterization of a phospholipid: diacylglycerol acyltransferase from Arabidopsis thaliana In Advanced Research on Plant Lipids (Murata, N., Yamada, M., Nishida, I., Okuyama, H., Sekiya, J & Hajime, W., eds), pp 179–182 Kluwer Academic Publications, Dordrecht 47 Stahl, U., Carlsson, A.S., Lenman, M., Dahlqvist, A., Huang, B., Banas, W., Banas, A & Stymne, S (2004) Cloning and functional characterization of a phospholipid: diacylglycerol acyltransferase from Arabidopsis Plant Physiol 135, 1324– 1335 48 Hiraoka, M., Abe, A & Shayman, J.A (2002) Cloning and characterization of a lysosomal phospholipase A2, 1-O-acylceramide synthase J Biol Chem 277, 10090–10099 48a Banas, A., Carlsson, A., Huang, B., Noiriel, A., Benveniste, P., ´ Schaller, H., Bouvier-Nave, P & Stymne, S (2004) Enzymatic properties of an A thaliana phospholipid: sterol acyltransferase (pp 70) 16th International Plant Lipid Symposium, Budapest, Hungary, 1–4 June 2004 Abstract book at http://www.mete mtesz.hu/pls/ Ó FEBS 2004 3764 A Noiriel et al (Eur J Biochem 271) ´ 48b Noiriel, A., Benveniste, P., Schaller, H., Bouvier-Nave, P., Banas, A., Carlsson, A., Huang, B & Stymne, S (2004) Functional study of an A thaliana LCAT-like cDNA encoding a phospholipid: sterol acyltransferase: steryl ester profiles of A thaliana overexpressers and T-DNA insertion mutants (pp 105) 16th International Plant Lipid Symposium, Budapest, Hungary, 1–4 June 2004 Abstract book at http://www.mete.mtesz.hu/pls/ 49 Yang, H., Bard, M., Bruner, D.A., Gleeson, A., Deckelbaum, R.J., Aljinovic, G., Pohl, T.M., Rothstein, R & Sturley, S.L (1996) Sterol esterification in yeast: a two-gene process Science 272, 1353–1356 50 Yang, H., Cromley, D., Wang, H., Billheimer, J.T & Sturley, S.L (1997) Functional expression of a cDNA to human acylcoenzyme A: cholesterol acyltransferase in yeast Species-dependent substrate specificity and inhibitor sensitivity J Biol Chem 272, 3980–3985 51 Sorger, D & Daum, G (2002) Synthesis of triacylglycerols by the acyl-coenzyme A: diacyl-glycerol acyltransferase Dga1p in lipid 52 53 54 55 particles of the yeast Saccharomyces cerevisiae J Bacteriol 184, 519–524 Sandager, L., Gustavsson, M.H., Stahl, U., Dahlqvist, A., Wiberg, E., Banas, A., Lenman, M., Ronne, H & Stymne, S (2002) Storage lipid synthesis is non-essential in yeast J Biol Chem 277, 6478–6482 Oelkers, P., Cromley, D., Padamsee, M., Billheimer, J.T & Sturley, S.L (2002) The DGA1 gene determines a second triglyceride synthetic pathway in yeast J Biol Chem 277, 8877– 8881 Sorger, D & Daum, G (2003) Triacylglycerol biosynthesis in yeast Appl Microbiol Biotechnol 61, 289–299 Merkel, O., Fido, M., Mayr, J.A., Pruger, H., Raab, F., Zandonella, G., Kohlwein, S.D & Paltauf, F (1999) Characterization and function in vivo of two novel phospholipases B/ lysophospholipases from Saccharomyces cerevisiae J Biol Chem 274, 28121–28127  ... TATATAGGTACCTTATGCATCAACAGAGACACTTAC ATATATGGATCCATGGGCTGGATTCCGTGTCCGTGCTGGGGAACC AACGACGATGAAAACGCCGGCGAGGTGGCGGATCGTGATCCGGTG CTTCTAGTATCTGGAATTGGAGGCTCTATTCTGCATTCTAAGAAGA AGAATTCAAAGTCTGAAATTCGGGTTTG... AGAATTCAAAGTCTGAAATTCGGGTTTG TATATAGGTACCTTAACCAGAATCAACTACTTTGTG ATATATGGATCCATGGGCTGGATTCCGTGTC TATATAGGTACCTTACTTGTCATCGTCGTCCTTGTAGTCACCAGA ATCAACTACTTTGTGAG TCCATGATATGATTGATATGC GTGGCAATGGTAATCCAC Site-directed... mutagenesis GCGTAGGAGTTTCGGGTAGCCTCCGCGGGCTTCTCCGTGATGAAAG GGAGTGTCCTTCTATAACATATTTGGAGTGTCACTTAATACACC GTCACTATCATCTCCCATGCAATGGGAGGACTTATGGTTTC CATATGTAGATGGAGCTGGAACTGTCCCTG GGAGTGTCACTTAATGCACCCTTTGATGTTTG