Engineering and use of 32 P-labeled human recombinant interleukin-11 for receptor binding studies Xiao-Ming Wang 1 , Jean-Marc Wilkin 1 , Olivier Boisteau 2 , Dimitri Harmegnies 1 , Chrystel Blanc 3 , Paul Vandenbussche 1 ,Fe  lix A. Montero-Julian 3 , Yannick Jacques 2 and Jean Content 1 1 Institut Pasteur de Bruxelles, Belgium; 2 Groupe Recherche Cytokines/Re  cepteurs, Unite  , Institut de Biologie, Nantes, France; 3 Immunotech, A Beckman-Coulter Company, Marseille, France Human interleukin-11 (hIL-11) is a pleiotropic cytokine that is involved in numerous biological activities such as hematopoiesis, osteoclastogenesis, neurogenesis and female fertility. IL-11 is o bviously a key reagent to study the IL-11 receptors. However, conventional radio-iodination techni- ques lead to a loss of IL-11 b ioactivity. H ere, we report the construction and the production of a new recombinant human IL-11 (FPDIL-11). I n this molecule, a speci®c phosphorylation site ( RRASVA) h as been intr oduced at the N -terminus of rhIL-11. It can be speci®cally phos- phorylated b y bovine heart protein kinase a nd accordingly, easily radiolabeled with 32 P. A high radiological s peci®c activity (250 000 c.p.m.Áng )1 of protein) was obtained with the retention of full biological activity of the protein. The binding of 32 P-labeled FPDIL-11 to B a/F3 cells stably transfected with plasmids encoding human IL-11 receptors a and b chains (IL-11Ra and gp130) was s peci®c and saturable w ith a high anity as determined from Scatchard plot analysis. Availability of this new ligand should prompt further studies on IL-11R structure, expression and regu- lation. Keywords: interleukin-11; cytokines; phosphorylation; radiolabeling; re ceptor b inding. Interleukin-11 (IL-11) i s a pleiotropic cytokine that has been shown to exhibit multiple effects o n hematopoietic and nonhematopoietic systems, includin g the liver , gastrointest- inal tract, lung, heart, central nervous system, bone, joint, and immune system [1]. IL-11 has hematopoietic and thrombocytopoietic activities: in vivo IL-11 administration stimulates megakaryocyte maturation and increases p eriph- eral plate let counts [2] as well as accelerating recovery f rom chemotherapy-induced or bone-marrow t ransplantation- induced thrombocytopenia [2±6]. Numerous experiments on animal models and clinical trials in patients suffering from acute and chronic i n¯ammatory d iseases, including rheumatoid arthritis [7±9], in¯ammatory liver disease [10], in¯ammatory bowel disease [11±13], mucositis [14], a nd psoriasis [15], have revealed that IL-11 is a lso an anti- in¯ammatory and mucosal protective agent. Another important role of IL-11 played in female fertility h as be en evidenced by the fact that female mice lacking IL-11 receptor are infertile due to a failure of trophoblast implantation [16]. IL-11 belongs to the gp130 family of cytokines that includes interleukin-6 (IL-6), viral I L-6 (vIL-6), ciliary neurotropic factor (CNTF), leukemia inh ibitory factor (LIF), oncostatin M (OSM), cardiotrophin-1 (CT-1), and novel neurotr ophin-1/B cell-stimulating f actor-3 (NNT-1/ BSF-3) [17±20]. These cytokines use the c ommon r eceptor subunit g p130 for signal transduction by which Janus kinases (Jaks) and transcription factors of the STAT family are activated [21]. IL-6 uses a homodimer of gp130 transducer, whereas CNTF, LIF, OSM, CT-1 and NNT- 1/BSF-3 assemble a heterodimer of gp130 and another protein LIFR. OSM can also recruit a heterodimer of gp130 and OSMR [22]. Both LIF and OSM can directly induce heterodimerization of gp130 and L IFR or OSMR, whereas IL-11, IL-6, CNTF a nd CT-1 mu st ®rst bind to their speci®c, nonsignaling receptor (named a chain) before inducing d imerization of signal-transducing receptor sub- units (named b chain). In contrast with IL-6, vIL-6 can directly activate g p130 in the absence of IL-6R [23,24]. T he stoichiometry of t he ligand±receptor complex is still unclear for IL-11. Actually, two models have been described. One i s a tetrameric complex model s uggested by Gro È tzinger et al . [25] in which one molecule of IL-11 b inds to its s peci®c a-receptor via site I of the cytokine and a t l ow con centration of IL-11±IL-11R complexes, IL-11 recruits two molecules of gp130 through i ts sites II and II I. At high IL-11/IL-11R concentrations, it is proposed that the tetramer is able to bind an additional IL-11±IL-11R c omplex, forming a hexameric, but nonsignaling complex [26]. According to in vitro studies based on immunoprecipitation using d ifferen- tially tagged forms of ligand a nd soluble r eceptor compo- nents, a hexameric complex has also been proposed in which two molecule s o f IL-11, two molecules o f I L-11R, e ither o ne molecule of gp130 and another still unidenti®ed gp130-type component are involved [ 27], or two m olecules of gp130 as Correspondence to J. Content, Institut Pasteur de Bruxelles, rue Engeland 642, B-1180, Brussels, Belgium. Fax: + 32 2373 32 91, Tel.: + 32 2373 34 16, E-mail: jcontent@pasteur.be or X M. Wang, Fax: + 3 2 2373 32 91, Tel.: + 32 2373 32 28, E-mail: xmwang@pasteur.be Abbreviations: IL, interleukin; IL-11R, interleukin-11 receptor; vIL-6, viral IL-6; CNTF, c iliary neurotropic factor; LIF, leukem ia inhibitory factor; OSM, oncostatin M; CT-1, cardiotrophin-1; NNT-1/BSF-3, novel neurotrophin-1/B cell-stimulating factor-3; DMEM, Dulbecco's modi®ed Eagle's medium; Jaks, Janus kinase. (Received 19 July 2001, revised 22 October 2001, accepted 22 October 2001) Eur. J. Biochem. 269, 61±68 (2002) Ó FEBS 2002 recently proposed by Barton et al . [28]. Which one is the active signalling receptor c omplex? This question will not be answered until much more infor mation i s available on the situation within intact cells. The effects of IL-11 must be mediated by the IL-11Ra and the latter provides ligand speci®city in a functional multimeric signal transduction complex with gp130. Two isoforms of the human IL-11R a-chain have been identi- ®ed and cloned [29]. They share identical extracellular and transmembrane do mains but differ in their C-terminus. One isoform has a cytoplasmic domain, whereas the second lacks the entire cytoplasmic domain. Both these isoforms [30] and the soluble I L-11Ra, lacking both the transmem- brane and cytoplasmic domains [31], were shown to have similar functional properties, suggesting the dispensability of these two domains for s ignaling. Structurally, the extracellular region of the IL-11Ra could be divided into three domains: an I g-like domain (D1) and two ®bro nectin- type II I-like ( FNIII) domains (D2 and D3). Recently, most of the amino-acid residues in IL-11Ra involved in ligand binding were identi®ed in D3 [32]. In order to provide a convenient IL-11 reagent for the study of IL-11 cell surface receptors, we describe in this paper t he construction and t he production of a new hIL-11 molecule FP DIL-11 and its use to study cell receptor binding as well as other potential applications provided by this new reagent. MATERIALS AND METHODS Bacterial strains, enzymes and chemicals Escherichia coli DH5 a was f rom Life BioTechnologies. BL21(DE3) and pET-22b(+) were from Novagen. The catalytic s ubunit of cAMP-indepentent protein kinas e from bovine heart muscle was obtained from Sigma. Human E. co li re combinant IL-11 was from PeproTech Inc. (London, UK). Mouse monoclonal anti-(human gp130) Ig (B-R3) was f rom Diaclone Research (BesancË on, France). MAB628 and polyclonal anti-(hIL-11) Ig (BAF218) were from R&D S ystems. [c- 32 P]ATP, with a speci®c radio- activity of % 3000 CiÁmmol )1 , w as obtained from Amer- sham; acrylamide a nd N,N¢-methylenebisacrylamide w ere from Bio-Rad; SDS and monoclonal anti-Flag Ig (M2) were from Sigma. RPMI-1640, Dulbecco's modi®e d Eagle's medium (DMEM), glutamine, a nd fetal bovine serum were from Gibco-BRL. Construction of expression plasmids for recombinant human IL-11 EcoRI and NotI s ites were ®rst introduced by P CR at two ends of the hIL-11 gene using two primers G310 (5¢-ATCCGGAATTCCCTGGGCCACCACCTGGCCC CCCT-3¢) and G311 (5¢-ATAGTTTAGCGGCCGCT TACAGCCGAGTCTTCAGC-3¢) and pIL-11/1 as tem- plate plasmid. To generate the Eco RI±NotICPDIL11 fragment, which contains an N-terminal Cys (C) and a bovine heart kinase phosphorylation site ( P) as well as a modi®ed IL-11 lacking the ®rst 10 amino acids (DIL11), another PCR was performed using two oligonucleotides YIL11TAG (5¢-ATCCGGAATTCGGTTGTGGTCGT CGTGCATCTGTTGCATCCCCAG-3¢) and YIL11/Not I(5¢-ATAGTTTAGCGGCCGCTTACAGCCGAGTCTT CAG-3¢). This fragmentwasinserted in the vector YepFlag-1 (Kodak Scienti®c Imaging S ystem) just next to the Flag tag at the restriction site EcoRI to generate plasmid YepFlag- CPDIL11. T he fragment NdeI±No tI(Flag-CPDIL-11) was obtained b y the third PCR using two primers G353 (5¢- GGAATTCCATATGGACTACAAGGATGACGATG ACAAG-3¢) and G354 (5¢-ATAGTTTAGCGGCCGCT CACAGCCGAGTCTTCAG-3¢) and the above plasmid as template. The expression plasmid pET-FCPDIL1 1 was constructed b y insertion in phase of the fragment NdeI± NotI into the vector pET-22b(+) (N ovagen) at the sites NdeI and NotI. Because the recombinant protein FCPDIL-11 forms a dimer via the r esidue Cys a nd loses t he binding activity on cells, another plasmid pET-FPDIL11 was c reat ed by a PCR using two oligonucleotides G390 (5¢- pGGTCGTCGTGCATCTGTTGC-3¢) and G391 ( 5¢- pCTTGTCATCGTCATCCTTGTAG-3¢)asprimersand the template plasmid pET-FCP DIL11. In this last construct, the Cy s re sidue and the EcoRI site have been deleted. All constructs were con®rmed by DNA sequencing. Production and puri®cation of the human recombinant IL-11 The plasmid pET-FPDIL11 was transformed into BL21(DE3) cells. E. coli cells were cultured in Luria± Bertani m edium containing 100 lgÁmL )1 of ampicillin at 37 °C. When the absorbance o f growing cells at 600 nm reache d % 0.6±0.8, the expression of the recombinant protein was induced by addition of 1 m M isopropyl thio- b- D -galactoside for 2 h. E. coli cells were then harvested and lyzed by sonication for 5 min at an intensity of level 5 using a microprobe (Vibra Cell, Sonics Materials Inc. Danburg, Connecticut, USA) in the presence of 0.1% Triton X-100 and 150 lgÁmL )1 of lysozyme in 50 m M Hepes, pH 7.4 buffer. Afte r two centrifugation cycles at 13 000 g for 25 min at 4 °C, the supernatant was precipitated with (NH 4 ) 2 SO 4 at a concentration o f 60% s aturation in order to concentrate crude proteins. Salts were eliminated by dialysis against 5 0 m M Hepes, pH 7.4 buffer b efore the puri®cation of samples by c hromatography. T wo puri®cation protocols were used. In the ®rst one, a small amount of pure FPDIL-11 was obtained after puri®cation on a Mono-S HR5/5 column (Amersham P harmacia Biotech) using a 50 m M Hepes buffer, pH 7.4, and a 0±1 M NaCl gradient. This pure protein was used for labeling and binding assays. Another protocol combining chromatography on an SP-Sepharose column using a 5 0 m M Hepes buffer, pH 7.4, and a 0±1 M NaCl gradient, and af®nity chromatography on an anti- Flag Ig column allowed t he puri®cation of larger amounts of FPDIL-11. We used this preparation to maintain the transfected IL-11-dependent Ba/F3 cells and 7TD1 cells. It was also used as competitor in cell receptor binding studies. SDS/PAGE and Western blot SDS/PAGE with 15% polyacrylamide gels was carried out as described previously [33]. After the transfer of proteins from gels onto nitrocellulose ®lte rs. FPDIL-11 was detected by incubation both w ith polyclonal anti-(hIL-11) Ig BAF218 and w ith m onoclonal a nti-Flag Ig (M2), and ®nally revealed with the alkaline phosphatase system (Sigma). 62 X M. Wang et al. (Eur. J. Biochem. 269) Ó FEBS 2002 Cell culture B13Ra1 and B13Ra2 c ells are a murine pro-B lymphocyte line Ba/F3 stably transfected with plasmids cont aining two genes t hat e ncode t he hIL-11 receptor a and b chains [30]. Cells were maintained in a culture medium RPMI-1640 supplemented with 10% fetal bovine serum, 1% glutamine, 0.8 m gÁmL )1 G418 (Sigma), 5 lgÁmL )1 puromycin (Sigma) and 5 ngÁmL )1 human IL-11 at 37 °Cand5%CO 2 .Murine 7TD1 hybridoma cells were cultivated as described previously [34,35]. THP-1 monocytic leukaemia cells (provided by M. K alai, Ghent University-VIB, B elgium), K562 chronic m yelogenous leukaemia cells (provided by H. Verschueren, Pasteur Institute of Brussels, Belgium), and CESS myelomonocytic leu kaemia cells were maintained in RPMI-1640 (with glutamine) containing 10% (v/v) fetal bovine serum. MG-63 osteosarcoma cells, A375 metastatic melanoma cells, HeLa epithelial carcinoma cells, RD rhabdomyosarcoma cells, and SK-N-MC neuroblastoma cells (provided by H. Verschueren) were maintained in DMEM containing 10% fetal bovine serum and 2 m M glutamine. All cell lines were maintained at 37 °Cand5% CO 2 . IL-11 bioassay IL-11 activity was measured using the IL-11-dependent mouse hybridoma cell line 7 TD1. These cells were cultivated in ¯at-bottom m icrotiter plate that contained 2 ´ 10 3 cells per well in the presence of twofold dilutions of IL-11 (2 lgÁmL )1 ). After 7 days of cultu re, the number o f surviving cells was determined by a c olorimetric assay of hexosaminidase. I n this assay, the absorbance is propor- tional to the number of cells present in each culture [35]. Each sample was tested in triplicate. Labeling of FPDIL-11 with [c- 32 P]ATP FPDIL-11 was labeled through protein phosphorylation with [c- 32 P]ATP in the presence of bovine heart kinase. Brie¯y, 1 lg of puri®ed FPDIL-11 was incubated at 30 °C for 1 h with 0.5 mCi o f [ c- 32 P]ATP (% 3000 CiÁmmol )1 , Amersham Corp.) and 6 U of t he catalytic sub unit of protein kinase from bovine h eart (Sigma) in 80 lLof 20 m M Tris/HCl, p H 7.5, 100 m M NaCl, 1 2 m M MgCl 2 , and 1 m M dithiothreitol. The reaction was stopped by adding 420 lLof1mgÁmL )1 BSA in a buffer (PPE) containing 10 m M sodium phosphate, 10 m M sodium pyrophosphate, and 10 m M EDTA, pH 7.0 at 4 °C. The 32 P-labeled FPDIL-11 was dialyzed against 3 L of PPE overnight at 4 °C and then against 1 L of NaCl/P i buffer for 4 h . Incorporation of radioactivity into FPDIL- 11 was measured with a liquid scintillation spectrometer after precipitation of the p rotein with 10% trichloroacetic acid. SDS/PAGE of [ 32 P]FPDIL-11 w as performed o n a slab gel by the method of Laemmli [33]. The purity of [ 32 P]FPDIL- 11 was c hecked after drying a nd exposi ng t he gel to an X-ray ®lm (Kodak XAR) for autoradiography. Binding of [ 32 P]FPDIL-11 to cells Cells (1 ´ 10 6 ) were preincubated i n culture medium lack- inggrowthfactorfor2handwerewashedthreetimes with NaCl/P i , pH 7 .4. For binding studies, radiolabeled FPDIL-11 at the indicated concentration in NaCl/P i containing 0.5% BSA was added to cells. The mixture was incubated at 4 °C for the appropriate time and bound radiolabeled FP DIL-11 was separated from the free r adio- activity by centrifugation at 3000 g for 1 min through a 0.2- mL layer of a mixture o f 40% dioctyl phthalate and 60% dibutyl phthalate (Janssen Chimica, Beerse, Belgium). After quick freezing, the tip o f each tube containing the cell p ellet was cut-off and r adioactivity was counted with a Beckman b-counter. Nonspeci®c binding was determined by incubat- ing cells with radiolabeled FPDIL-11 in the presence of a 200-fold molar excess o f unlabeled FPDIL-11. The number of receptors on cells and dissociation c onstant (K d )were determined with Scatchard plot analysis a ccording to speci®c binding data. RESULTS AND DISCUSSION Construction and puri®cation of recombinant human IL-11 (FPDIL-11) Radiolabeled hIL-11 is a useful and very sensitive r eagent to study the hIL-11 r eceptors. Human IL-11 labeling with 125 I has been reported [36], but our numerous attempts to iodinate hIL-11 were unsuccessful due to a l oss of bioactivity a fter labeling. As it had been shown that t he incorporation of a phosphorylation site into s everal proteins, such as IFN-a and diphtheria toxin, r esulted in a high speci®c radioactivity after 32 P-labeling and had no signi®cant effect on their biological activity [37±39], we therefore decided to adopt a similar strategy f or IL-11. This strategy is illustrated in Fig. 1. The N-terminal nucleotides encoding the ®rst 10 amino acids of IL-11 w ere deleted and replaced by a s equence encoding a F lag tag (Asp-Tyr-Lys- Asp-Asp-Asp-Asp-Lys) followed by a consensus amino- acid sequence (Arg-Arg-Ala-Ser-Val-Ala) that can be recognized and phosphorylated on the serine residue by the bovine heart kinase [37]. The Flag tag was introduced at the end of the molecule to facilitate its puri®cation by af®nity chromatography and immunological detection [40±42]. The ®rst 10 amino acids of hIL-11 were deleted i n order to keep the size o f the recombinant FPDIL-11 similar to that of hIL-11 and to avoid the p roblem of expression that may arise in E. coli because of the presence of many consecutive p roline r esidues at the N-terminus. This d eletion was made possible because the ®rst 13 N-terminal amino acids a re not necessary for its biological activity and not part of the s ites, a s identi®ed by molecular modelling and site-directed mutagenesis, involved in receptor binding [18,43±45]. Fig. 1. Nucleotide a nd amino acid se quences of the N -terminus of human IL-11 and FP DIL-11. The Flag tag is boxed. The ®rst 10 amino acids of hIL-11 are bold. The phosphorylation site recognized by the bovine heart protein kinase catalytic subunit created in FP DIL-11 is under- lined. Ó FEBS 2002 Creation of a phosphorylatable recombinant hIL-11 (Eur. J. Biochem. 269)63 The puri®cation of FPDIL-11 from bacteria consisted of three main s teps: ( a) ex traction of the recombinant protein, (b) cation-exchange chromatography, and (c) af®nity chromatography with anti-F lag Ig c oupled to Sepharose beads. One liter of bacterial cell culture yielded 1±2 mg of puri®ed FPDIL-11. The protein was stable during puri®ca- tion and no d egradation was observed a fter several months storag e at )20 °C. The FPDIL-11 protein was pure as assessed by S DS/PAGE analysis (Fig. 2) and Western blots using antibodies against hIL-11 and Flag peptide (data not shown). Its apparent molecular mass was % 25 kDa, a value somewhat higher than its real molecular mass (20 kDa) determined by mass spectroscopy (data not shown). This difference could be due to the presence within the Flag tag and t he ph osphorylation s ite o f numerous charged residues (1Glu, 5Asp, 2Arg and 2Ly s) (Fig. 1). Biological activity of FPDIL-11 The availability of the puri®ed recombinant IL-11 protein enabled us to t est i ts biological activities in vitro. The murine hybridoma cell line 7TD1 formed by fusion of the mouse myeloma cell line Sp2/0-Ag14 with spleen cells from a C57BL/6 mouse was used for t his purpose. This cell line is known to respond to picogram amounts of IL-6 [35], b ut has a lso a proliferating r esponse t o nanogram a mounts of IL-11 [31]. As shown in Fig. 3, the recombinant FPDIL-11 had a biological activity very similar to that o f wild-type hIL-11 with an IC 50 of % 0.8 ngÁmL )1 , con®rming that the ®rst 10 amino acids are dispensable for the biolo gical activity of IL-11 a nd in dicating that the presence of the Flag tag as w ell as t he phosphorylation site at the N-terninus have no detectable effect on the IL-11 functionality. Labeling of FPDIL-11 FPDIL-11 was labeled with [c- 32 P]ATP using bovine heart protein kinase. Autoradiography of the labeled ligand con®rmed the success of the phosphorylation. Speci®c radioactivity attained about 250 000 cpmÁng )1 of protein, which corresponds to a nearly complete radiophosphate labeling of the IL-11 molecules. Speci®city of the labeling was demonstrated using both E. coli bacteriophage k protein phosphatase and wild-type hIL-11. Bacteriophage k phosphatase can hydrolyze phosphate groups on serine, threonineor tyrosine-histidine residues.Incubating[ 32 P]inter- leukin with this enzyme resulted i n the complete loss of its radioactive label (Fig. 4A). Human IL-11, which does n ot contain any putative phosphorylation site, could not be radiolabeled under similar conditions (data not shown). Previous observations have shown that t he appar ent molecular masses o f phosphorylated and nonphosphory- lated proteins are slightly different on SDS/PAGE [46]. FPDIL-11 that was phosphorylated with cold ATP in the same conditions as with [c- 32 P]ATP showed an apparent molecular mass s lightly higher than its nonphosphorylated counterpart (Fig. 4 B), con®rming once more its complete phosphorylation. [ 31 P]FPDIL-11 h ad a biological activity similar to that of wild-type hIL-11, indicating that phosphorylation does not affect the IL-11 functional activity (Fig. 3). Binding of [ 32 P]-FPDIL-11 to cells B13Ra1 and B13Ra2 cells were used to test FPDIL-11 binding to human IL-11 receptors. B13Ra1 a nd B13Ra2are Ba/F3 cells stably transfected with human gp130 and, Fig. 2. SDS/PAGE of FPDIL-11. Lane 1, 60 lgoftheextractpro- teins from transformed BL21(D3) cells induced by 1 m M isopropyl thio-b- D -galactoside for 2 h; lane 2, 2 lg of puri®e d F PDIL-11. Pro- teins were s tained with Coomassie blue. Fig. 3. Proliferation assay o f interleukin-11 on 7TD1 cells. IL-11 activity was measured using the mouse hybridoma cell line 7TD1. Brie¯y, 7TD1 cells were cultivated in ¯at-bottom microwell plates containing 2 ´ 10 3 cells per well in the presence of serial dilutions of the cytokine. After 7 days of culture , the num be r of s urviving cells was determined by a colorimetric assay of he xo saminidase. I n t his a ssay, the a bsorbance is proportional t o the number of cells p resent in each well. Each sample was t ested in triplicate. 64 X M. Wang et al. (Eur. J. Biochem. 269) Ó FEBS 2002 respectively, full length hIL-11Ra and hIL-11R a lacking the cytoplasmic domain [30]. All binding experiments were carried out at 4 °C to p revent cell internalization of the ligand. No speci®c binding of [ 32 P]FPDIL-11 could be detected on parental Ba/F3 cells. The kinetics of the association of radiolabeled FP DIL-11 with B13Ra1 cells revealed that the radioligand r eached its maximum association to cells after 1-h i ncubation at 4 °C. In subsequent equilibrium binding studies, [ 32 P]FPDIL-11 was therefore i ncubated with cells for 90 min. The dose±response curve of [ 32 P]FPDIL-11 binding to B13Ra1 cells is shown in Fig. 5. Nonspeci®c binding component, determined b y adding a 200-fo ld molar excess of unlabeled FPDIL-11, was low (less than 5 % of the total association). A nalysis of t he speci®c binding data by the method of Scatchard indicated the existence of a single class of bind ing sites. B 13Ra1cellshave% 10 550 r eceptors per cell with an apparent dissociation constant ( K d ) of 0.372 n M (Fig. 5 , inset), which is consistent with that described previously for o ther cell lines (K d  300±800 p M ) [36,47± 49]. Similar results were obtained for B13Ra2 cells (data not shown). We c ould only detect high af®nity receptors on these cells. This suggests e ither that in these cells gp130 is in excess or that the af®nity of the a subunit is too low to b e detected. The IL-11 receptor a chain is a transmembrane protein, but its membrane-spanning and cytoplasmic domains are unnecessary for I L-11-induced signal transduc- tion [30,31]. As expected, the receptor b inding on B13R a2 cells revealed that the cytoplasmic domain is also dispen- sable for ligand binding. Competition experiments betw een radiolabeled and unlabeled FPDIL-11 gave an experimental K i of 0.377 n M , which is similar to the calculated K d value obtained from Scatchard analysis (Fig. 6). I L-6 was used as a negative control a s this cytokine and IL-11 do not compete for the same receptors [47]. When wild-type hIL-11 and [ 31 P]FPDIL-11 were used as competitors, similar results were obtained, suggesting that addition of the Flag t ag and phosphorylation site, and phosphorylation of this site at the serine residue as well as deletion of the ®rst 10 amino a cids, have no effect on IL-11 binding to the human IL-11Ra and gp130 receptor complex. When 7TD1 cells were used for r eceptor binding assay, Scatchard a nalysis o f the data revealed that these cells have % 550 r eceptors pe r cell with a K d around 0.97 n M .Human IL-11Ra can i nteract with murine gp130 and this provides a speci®c high-af®nity binding site for hIL-11 [49]. The binding of [ 32 P]FPDIL-11±7TD1 cells expressing both murine IL-11R a and murine gp130 demonstrated that the interaction between hIL-11 and murine IL-11Ra and murine gp130 was also of h igh a f®nity. Taken t ogether, these observations suggest that human and murine IL-11 Fig. 5. Binding o f radiolabeled ligand to B13Ra1cells.The b in ding of [ 32 P]FPDIL-11 to B13Ra1 cells was performed as described under Materials and me thod s. Speci®c binding (.) represents the dierence between total binding (r) a nd nonspeci®c binding ( m). Nonspeci®c binding represents the binding in the presence of excess unlabeled FPDIL-11. Values wer e the means of trip licates from two independent experiments. Standard errors of the means were less than 5%. Inset: Scatchard analysis of FPDIL-11 binding according to speci®c binding data (bound molecules of FPDIL-11 w ere p lotted v s. bound FPDIL- 11/free FPDIL-11). B max  10 55 0  200 sites p er cell; K d  0.372  0021 n M . Fig. 4. Phosphorylation of FPDIL-11. (A) [ 32 P]FPDIL-11 (0.8 ng) with 2500 CiÁmmol )1 was treated with or without 5 U of E. coli lambda phosphatase for 75 min at 30 °C were separated on SDS/PAGE (15%). After electrophoresis, the gel was d ried onto a sheet o f W ha tman 3 paper and it was then e xposed for 10 min to a Kodak X-Omat ®lm (Kodak c ompany) for a utoradiography. (B) Lane 1, 100 ng of FPDIL-11 phos- phorylated with c old 31 P; lane 2, 1 lg of unphosphorylated FPDIL-11 were separated on a SDS/PAGE ( 15%). Proteins w ere coloured b y the silver staining method. Ó FEBS 2002 Creation of a phosphorylatable recombinant hIL-11 (Eur. J. Biochem. 269)65 receptors are interchangeable for c ytokine binding. I ndeed, human IL- 11Ra shares 82% i dentity with its murine homolog [29,36]. Although both cytokines display relatively poor homology i n the D1 domain, domains D2 and D3 a re well conserved. The Ig-like domain (D1) i s n ot required for ligand b inding as the presence of IL-11 and IL-11R-D2,3 is suf®cient to induce b iological activity [50]. The residues responsible for the ligand binding are mainly located in the D3, and D2 plays only a minor role [32]. Several human hematopoietic and nonhematopoietic cell lines (THP-1 monocytic leukaemia cells, K562 chronic myelogenous leukaemia cells, CESS myelomonocytic leukaemia cells, MG-63 osteosarcoma cells, A375 meta- static melanoma cells, He La e pithelial carcinoma cells, RD r habdomyosarcoma cells, and SK-N-MC n euroblas- toma cells) h ave been tested using [ 32 P]FPDIL-11 to obtain information about the expression of human IL-11 receptors. S peci®c binding was observed in THP-1 and MG-63 cells and Scatchard plot analysis revealed that they have, % 600 a nd 800 receptors, r espectively, per cell (data not shown). This is t he ®rst time that cell surface expression of human IL-11 receptors is shown directly in human cells by use of a radioligand. We found the presence of IL-11Ra on THP-1 cells. This is consistent with previous observations that IL-11 is involved in the regulation of production of pro-in¯ammatory cytokines such as TNF-a,IL-1b,IFN-c and I L-12 by monocytes [55,56], and that the IL-11 receptor analysis on human cell lines by ¯ow cytometry using monoclonal anti-IL-11Ra Ig has also r evealed t he expression of IL-11Ra on these cells [54]. In contrast with previous reports describing IL-11Ra mRNA dete ction i n K562 cells and skeletal m uscle [ 29], we did not observe th e expression of IL-11Ra on these cells nor on RD cells. MG-63 cells have been shown to have both IL-11Ra mRNA and the expression of this receptor [29,54,57]. Detection of IL-11R on these cells, in this study, is in accordance with the fact t hat IL-11 is able to induce the formation of osteoclasts in bone morrow and able to stimulate bone resorption [58]. Inhibition of ligand binding by monoclonal antibodies Monoclonal anti-(IL-11) Ig, anti-gp130 Ig and anti- (IL-11R) Ig were used for antibody competition experi- ments t o test whether they would affect FPDIL-11 binding. H2 and H56 ar e two neutrali zing anti-(IL-11) Ig that recognize a n epitope localized at s ite II of the cytokine, being the c ontact point with gp130. T hese two mAbs were shown to have an inhibitory effect on IL-11-induced proliferation of B13R a1withanIC 50 around 3 n M for H2 a nd 5 n M for H56 (C. Blanc, I. Tacken, J M. Wilkin, P. Vuzio, G. M uller- Newen, P.C. Heinrich, Y. Jacques, J. Gro È tzinger, J. Content & F.A. Montero-Julian, unpublished results). Similarly, they can a lso inhibit F PDIL-11 receptor binding with an IC 50 of 0.34 n M for H 2 and 0.58 n M for H 56 (Fig. 6 A). It should be noted that H2 and H56 are not competitive inhibitors of cytokine binding but rather interfere w ith the formation of the IL-11±IL-11R±gp130 complex. The IC 50 values of both antibodies that inhibit I L-11-induced proliferation of B13Ra1 cells (3 n M for H2 and 5 n M for H56) were 10-fold higher than the antibodies concentrations that inhibit [ 32 P]FPDIL-11-receptor b inding on the s ame cells (0.34 n M for H2 and 0.58 n M for H56). T hese results a re nevertheless not contradictory because IC 50 values a re not intrinsic constants a s t hey d epend o n th e concentration o f ligand used; the higher c oncentration of l igand used, the larger concentration of inhibitor t o compete for 50% of the activity w ill be needed. B-R3 and MAB628 are two anti-(human gp130) mAbs that interfere with the biological effects o f all known cytokines u sing gp13 0 as transducing element [30,51±53]. Figure 6B shows that B-R3 a nd MAB628 mAbs inhibit the radioligand binding with IC 50 values of 0.47 n M and 0.20 n M , respectively. Several mAbs against the human interleukin-11 receptor a-chain have rece ntly been raised [54]. I7.4, D14.7, B24.3, D16.1, E24.2, C8.7, and A 3.4 recognize the domain III (D3) of I L-11R [54]. N one of these mAbs are inhibitory of IL-11-induced proliferative response. These mAbs were tested in the FPDIL-11-receptor b inding assay. In Fig. 6. Binding of [ 32 P]FPDIL-11 t o B 13Ra1 cells competed with d i erent in terleuk in-11 (A) and inhibited by antihuman IL-11 and a ntihuman gp130 neutralizing antibodies (B). Cells were incubated with t he indicated concentrations of, in panel A, unlabeled rhIL-11 (m), unlabe led FPDIL-11 (j), cold labeled [ 31 P]FPDIL-11 (s), an d I L-6 (r) a s a negative control; in panel B, anti human I L-11 monoclonal antibodies H2 (.)andH56(e)and antihuman gp 130 monoclonal an tibodies MAB628 (h)andB-R3(n). Data points represen t th e m eans of triplicate determination s e xpressed as a percentage of maximum speci®c binding. K i was calculated to be about 0.252 n M for rhIL-11, 0.377 n M for FPDIL-11, and 0.337 n M for [ 31 P]FPDIL-11. These v alues were o btained by the me thod of Ch eng & Pruso [59]. I C 50 wascalculatedtobe% 0.3 4 n M for H2, 0.5 8 n M for H56, 0.20 n M for MAB628, a nd 0.47 n M for B-R3. 66 X M. Wang et al. (Eur. J. Biochem. 269) Ó FEBS 2002 agreement w ith t he proliferation data, none of them had any inhibitory effect on FPDIL-11 binding (data not shown), thus reinforcing t he conclusion that the e pitopes recognized by all these antibodies are distinct from t he ligand binding site. The i ntroduction of a phosphorylation site into IL-11 and other proteins p rovides a convenient and simple m ethod to label the proteins to high speci®c radioactivities. If multiple phosphorylation sites wer e introduced into proteins, much higher spe ci®c radioactivities c ould b e generated and accordingly, this would render the radioligand-detection much more easier. T his is a quite useful tool especially in the case where the expression of certain receptors on the cell surface is lower. T he en zymatic labeling b y phosphorylation is a relatively g entle way to radiolabel ligands as compared to chemical methods that can destroy t he biological activity to some extent. Because of its high radioactivity and biological activity, 32 P-labeled IL-11 should be a useful reagent for the characterization and assay o f the IL-11 r eceptors, pharmacokinetics, diagnostic imaging, a nd many other uses. ACKNOWLEDGEMENTS This work was supported by grants from the European Community (BIO4 CT 972010), the F und f or Medical S cienti®c Research (contract 3.4611.97, Belgiu m), the ÔFondation Rose et Jean HoguetÕ and ÔLes amis de lÕInstitut Pasteur de B ruxel lesÕ. REFERENCES 1. Schwertschlag, U.S., Trepicch io, W.L., D ykstra, K.H., Keith, J.C., Turner, K.J. & Dorner, A.J. (1999) Hematopoietic, immunomodulatory and epithelial eects of interleukin-11. Leu- kemia 13 , 1307±1315. 2. Teramura, M., Kobayashi, S., Yoshinaga, K., Iwabe, K. & Mizoguchi, H. (199 6) Eect of interleukin 11 on normal and pathological t hrombopoiesis. Cancer. Chemother. P harmacol. 38, S99±S102. 3. Leonard, J.P., Q uint o, C.M., Ko zitza, M.K., Neben, T.Y. & Goldman, S.J. (1994 ) Recombinant human i nterleukin-11 s timu- lates multilineage hematopoietic recovery in mice after a myelo- suppressive regimen of sublethal irradiation and carboplatin. Blood 83 , 1499±1506. 4. Schlerman, F.J., Bree, A.G., K aviani, M., N agle, S.L., Donnelly, L.H., Mason, L.E., S ch aub, R.G., Grupp, S.A. & Go ldman, S.J. (1996) Thrombopoieti c activity of recombinant human interleukin 11 (rHuIL-11) in normal and myelosuppressed nonhuman primates. S tem Cells. 14, 517±532. 5.Tepler,I.,Elias,L.,Smith,J.W.,nd,Hussein,M.,Rosen,G., Chang,A.Y.,Moore,J.O.,Gordon,M.S.,Kuca,B.,Beach,K.J., Loewy, J.W., Garnick, M.B. & Kaye, J .A. (1996) A randomized placebo-controlled trial of recombinant human interleukin -11 in cancer patients with severe th romb ocytopenia due to chemother- apy. Blood 87, 3607±3614. 6. Isaacs, C., Robert, N.J., Baile y, F.A., Schuster, M.W., O ver- moyer,B.,Graham,M.,Cai,B.,Beach,K.J.,Loewy,J.W.& Kaye, J.A. (1997) Randomized placebo-controlled study of recombinant human interleukin-11 to prevent chemotherapy- induced thrombocytopenia in patients w ith breast cancer r eceivin g dose-intensive cyclophosphamide and doxorubicin. J. Clin. Oncol. 15, 336 8±3377. 7. Anguita, J., Barthold, S.W., Samanta, S ., Ryan, J. & Fikrig, E. (1999) Selective anti-in¯ammatory action of interleukin-11 in murine Lyme disease: arthritis decreases while carditis persists. J. Infect. Dis. 179, 734±737. 8. Walmsley, M., Butler , D .M., Marinova-Mutafchieva, L. & Feldmann, M. (1998) An anti-in¯ammatory role for interleukin-11 in established murine collagen-induced a rthritis. Imm unolo gy 95 , 31±37. 9. Trontzas, P ., Kamper , E.F., Potamianou, A., Kyriazis, N .C., Kritikos, H. & Stav ridis, J. (1998) Comparative s tudy of serum and synovial ¯uid i nterleukin -11 levels i n patients w ith variou s arthritides. Clin. B iochem. 31 , 673±679. 10. Bozza, M., Bliss, J.L., Maylor, R., Erickson, J., Donnelly, L., Bouchard,P.,Dorner,A.J.&Trepicchio,W.L.(1999)Inter- leukin-11 reduces T-cell-dependent experimental liver injury in mice. Hepatology 30, 1441±1447. 11. Sands, B.E., Bank, S., Sninsky, C.A., Robinson, M., Katz, S., Singleton, J.W., Miner, P.B., Safdi, M.A., Galandiuk, S ., Hanauer, S.B ., et al. (1999) Preliminary e valuation of safety and activity of recombinant human interleukin 11 in patients with active Crohn's disease. Gastroenterology 117 , 58±64. 12. Peterson,R.L.,Wang,L.,Albert,L.,Keith,J.C.&Dorner,A.J. (1998) Molecular e ects of r ecombinant human i nt erleukin-11 in the H LA-B27 rat mod el of in¯ammatory bowel disease. Labora- tory Invest. 78, 1503±1512. 13. Greenwood-Van Meerveld, B., Tyler, K. & Keith, J.C. (2000) Recombinant human interleukin-11 mo du lates ion transport and mucosal in¯ammation in the small intestine a nd colon. Laboratory Invest. 80 , 1269±1280. 14. Sonis, S.T., Van Vugt, A.G., McDonald, J., Dotoli, E., Schwertschlag, U., Szklut, P. & Keith, J. (1997) Mitigating eects of interleukin 11 on consecutive courses of 5-¯uorouracil-induced ulcerative mucositis in hamsters. Cytokine 9, 605 ±612. 15.Trepicchio,W.L.,Ozawa,M.,Walters,I.B.,Kikuchi,T., Gilleaudeau, P., Bliss, J.L., Schwertschlag, U., Dorner, A.J. & Krueger, J.G. (1999) Interleukin-11 therapy selectively down- regulates type I cytokine proin¯ammatory pathways in psoriasis lesions. J. Clin. Invest. 104, 1527±1537. 16. Robb, L., L i, R., Hartley, L ., Nandurkar, H.H., Koentgen, F. & Begley, C.G. (1998) Infertility in female mice lacking the r eceptor for interleukin 11 is due to a defective uterine resp onse to implantation. Nat. M ed. 4, 303±308. 17. Kalai, M., Montero-Julian, F.A., Gro È tzinger, J., Fontaine, V., Vandenbussche, P., Deschuyteneer, R., Wollmer, A., Brailly, H. & Content, J. (1997) A nalysis of t he IL-6/IL-6R bi nding i nterface at the amino acid level: proposed mechanisms of interaction. Blood 89, 1319 ±1333. 18. Jacques, Y ., Minvielle, S., Mul ler-Newen, G., Heinrich, P.C., Gro È tzinger, J., M ontero-Julian, F.A., Brailly, H ., Wilkin, J.M. & Content, J. (1998) T he interleukin-11/receptor complex: rational design of agonists/antagonists and immunoassays potentially useful in h uman therapy. Res. Immunol. 149, 737±740. 19. Senaldi, G ., Varnum, B.C., Sarmiento, U., Starnes, C ., Lile, J., Scully, S., Guo, J., Elliott, G., Mcninch, J., Shaklee, C.L., Free- man,D.,Manu,F.,Simonet,W.S.,Boone,T.&Chang,M.S.(1999) Novel neurotrophin-1/B cell-stimulating factor-3: a cytokine of the IL-6 family. Proc. Natl A cad. Sci. USA 96, 11458±11463. 20. Neipel, F., Albrecht, J.C., Ensser, A., Huang, Y.Q., Li, J.J., Friedmanklein, A.E. & Fleckenstein, B. (1997) Human herpes- virus 8 encodes a homolog of interleukin-6. J. Vir o l. 71, 839±842. 21. Heinrich, P.C., Behrman n, I., Mul ler-Newen , G., Sch aper, F. & Graeve, L. (1998) Interleukin-6-type cytokine signalling through the gp130/Jak/STAT pathway. Biochem. J. 334 , 297±314. 22. Taga, T. & Kishimoto, T. (1997) gp130 and the interleukin-6 family of c ytokines. Annu. Rev . Immunol. 15 , 797±819. 23. Wan, X .Y., Wang, H.L. & Nicholas, J. (1999) Human herpesvirus 8 interleukin-6 (VIL-6) signals through gp 130 but has structural acid receptor-binding properties distinct from those of human IL-6. J. Virol. 73, 826 8±8278. 24. Mullberg, J., Geib, T., Jostock, T ., Ho ische n, S.H ., Vo llmer, P., Voltz, N., Heinz, D., Galle, P.R., Klouche, M. & Rose-John, S. (2000) IL-6 receptor independent s timulation of human gp130 by viral IL-6. J. Immunol. 16 4, 4672±4677. Ó FEBS 2002 Creation of a phosphorylatable recombinant hIL-11 (Eur. J. Biochem. 269)67 25. Gro È tzinger, J., Kurapkat, G., Wollmer, A., Kalai, M. & Rose- John, S. ( 1997) The family of the IL-6-type cytokines: speci®city and promiscuity of th e receptor complexes. Protein 27 , 96±109. 26. Gro È tzinger, J., K ernebeck, T., K allen, K.J. & Rose-John, S. (1999) IL-6 type cytokine receptor co mplexes: hexamer, tetramer or both? Biol. C hem. 380, 803±813. 27. Neddermann, P., Gr aziani, R ., Cil iberto, G . & Paonessa, G. (1996) Functional e xpression of soluble human inte rleukin-11 (IL-11) receptor alpha and s toichio metry of in vitro I L-11 receptor complexes with gp130. J. Biol. C he m. 271, 30986±30991. 28. Barton, V.A., Hall, M.A., Hudson, K.R. & Heath, J.K. (2000) Interleukin-11 signals through the formation of a hexameric receptor complex. J. Biol. Chem. 275, 36197±36203. 29. Cherel, M., So rel, M., Lebeau, B., Dubois, S., Moreau, J.F., Bataille, R., Minvielle, S. & Jacques, Y. (1995) Molecular cloning of two i soforms of a re ceptor for the hu man hematopoietic cyto- kine interleukin-11. Blood 86, 2534±2540. 30. Lebeau, B ., Montero-Julian, F.A., W ijdenes, J., Muller-Newen, G., Dahmen, H., Cherel, M., Heinrich, P.C., Brailly, H., Hallet, M.M., Godard, A., Minvielle, S. & Jacques, Y. (1997) Reconstitution of two isoforms of the human interleukin-11 receptor and com- parison of t heir functional properties. FEBS Lett. 407, 141±147. 31.Karow,J.,Hudson,K.R.,Hall,M.A.,Vernallis,A.B.,Taylor, J.A., G ossler, A. & Heath, J.K. (1996) Media tion of interleukin - 11-dependent biological responses b y a soluble f orm of t h e inter- leukin-11 r eceptor. Biochem. J. 318, 489 ±495. 32. Schleinkofer, K., D ingley, A., T acke n, I., F ederwisc h, M., M uller- Newen, G., H einrich, P.C., V usio, P., Jacques, Y. & Gro È tzinger, J. (2001) Identi®cation of t he domain in the human interleukin-11 receptor that mediates ligand binding. J. Mol. Biol. 306, 263±274. 33. Laemmli, U.K. (1970) Cleavage of structural p roteins during the assembly of the head of bacteriophage T4. Nature 227, 6 80±685. 34. Fontaine, V., Savino, R., Arcone, R., De Wit , L., Brakenho, J.P., Content, J. & Ciliberto, G. ( 1993) Involvement of the Arg179 in theactivesiteofhumanIL-6.Eur. J. Biochem. 211, 749±755. 35. Van Snick, J., Cayphas, S., Vink, A., Uyttenhove, C., Coulie, P.G., Rubira, M .R. & Simpson, R.J. (1986) Puri®cation a nd NH 2 - terminal amino acid sequence of a T -cell- derived lymphokine with growth factor activity for B -cell hybridomas. Proc . Natl Acad. Sci. USA 83, 9679±9683. 36. Hilton, D.J., Hilton, A.A., Raicevic, A., Rakar, S., Harrison- Smith, M., Gough, N.M., Begley, C.G., Metcalf, D., Nicola, N.A. & Willson, T .A. (1994) Cloning of a murine IL-11 receptor a lpha- chain; re qu irement for gp130 for high anity bin ding and signal transduction. EMBO J. 13, 4765±4775. 37. Li, B .L., Langer, J .A., Schwartz, B. & Pestka, S. (1989) Creation of p ho sphorylation sites i n proteins: construction of a phosphor- ylatable human interferon a lpha. Proc.NatlAcad.Sci.USA 86, 558±562. 38. Mohanraj, D., W ahlsten, J.L. & Ramakrishnan, S. (1996) Expression and r adiolabeling of recombinant p roteins containing a phosphorylation motif. Protein Expr. Purif. 8, 175±182. 39. Pestka, S ., Lin, L ., Wu, W. & Izotova, L. (1999) Introduction of protein kinase recognition sites into proteins: a review of their preparation, advantages, and applications. Pr otein Expr. Purif. 17, 203±214. 40. Prickett, K.S., Amberg, D.C. & Hopp, T.P. (1989) A calcium- dependent a ntibody f or identi®cation and puri®cation of recom- binant proteins. Bi otechniques 7, 580±589. 41. Blanar, M.A. & Rutter, W.J. (1992) Interaction cloning: identi®- cation of a helix-loop-helix zipper pro tein that i nteracts with c-Fos. Science 25 6 , 1014±1018. 42. Zhang, X.K., Homann, B., Tran, P.B., Graupner, G. & Pfahl, M. (1992) Retinoid X receptor is a n auxiliary p rotein for thyroid hormone and retinoic acid r ece ptors. Nature 355 , 441±446. 43. Czupryn, M., Bennett, F., Dube, J., Grant, K., Scoble, H., Sookdeo, H. & Mc Coy, J.M. (199 5) Alanine-scanning mutagen- esis of human interleukin-11: identi®c ation of regions impo rtant for biological a ctivity. Ann. NY Acad. Sci. 762, 152±164. 44. Tacken, I., Dahmen, H., Boisteau, O ., Minvielle, S., Jacques, Y., Gro È tzinger,J.,Kuster,A.,Horsten,U.,Blanc,C.,Montero-Ju- lian, F .A., Heinrich, P.C. & Muller-Newen, G. (1999) De®nition of receptor bin ding sites on human interleukin-11 by mole cular modeling-guided mutagenesis. Eur. J. Biochem. 265, 645±655. 45. Barton, V.A., H udson, K.R. & Heath, J.K. (1999) Ide nti®cation of three distinct receptor binding site s of m urine interleukin-11. J. Biol. Chem. 274, 5 755±5761. 46. Schaper, F., Gen do, C., E ck, M., Schmitz, J., G rimm, C., Anhuf, D., K err, I.M. & Heinrich, P.C. (1998) Activation of the protein tyrosine phosphatase SHP2 via the interleukin-6 signal transducing receptor protein gp130 requires tyrosine kinase Jak1 and limits acute-phase proteine xpression. Biochem. J. 335, 557±565. 47. Yang, Y .C. & Yin, T.G. (1992) Interleukin-11 and its receptor. Biofactors 4, 15±21. 48. Yin, T.G., Miyazawa, K. & Y ang, Y.C. (1992) Characterization of interleukin-11 receptor and protein tyrosine phosphorylation induced by interleuk in-11 in mouse 3T3-L1 cells. J. Biol. Chem. 267, 8347±8351. 49. Nandurkar, H.H., H ilton, D.J., Nathan, P., Willson, T., Nicola, N. & Begley, C.G. (1996) The human IL-11 receptor requires gp130 for signalling: demonstration by molecular cloning of the receptor. Oncogene 12 , 585±593. 50. P¯anz, S., Tacken, I., G rotzinger, J., J acques, Y., Minvielle, S., Dahmen, H., Heinrich, P .C. & Muller-Newen, G . ( 1999) A fusion protein of in terleukin-11 a nd soluble interleukin-11 receptor acts as a superagonist on cells expressing gp130. FEBS Lett. 450, 117±122. 51. Wijdenes, J., Heinrich, P .C.M., Mu È ller-Newen, G., Roche, C., Gu, Z.J., Clement, C . & Klein, B. (1995) Interleukin-6 signal t rans- ducer gp130 has speci®c binding sites for dierent c ytokines as determined by a ntagonistic and agonistic anti-gp130 monoclonal antibodies. Eur. J. Immunol. 25, 3 474±3481. 52. Chevalier, S., Fourcin, M., Robledo, O., W ijdenes, J., Pouplard- Barthelaix, A. & Gascan, H . ( 1996) Inter leukin-6 f amily of cyto- kines induced activation of dierent functional sites expre ssed by gp130 transducing protein. J. Biol. Chem. 271 , 14764±14772. 53. Gu, Z.J., Wijdenes, J., Zhang, X.G., Hallet, M.M., Clement, C. & Klein, B. (1996) Anti-gp130 transducer monoclonal antibodies speci®cally i n hibiting ciliary neurotrophic factor, interleukin-6, interleukin-11, l euke mia i nhibitory f actor or oncostatin M. J. Immunol. Meth. 190, 21±27. 54. Blanc, C., Vusio, P., Schleinkofer, K., Bois teau, O., P¯anz, S., Minvielle, S., Grotzinger, J., M uller-Newen, G., Heinrich, P.C., Jacques, Y. & Montero-Julian, F.A. (2000) Monoclonal a nti- bodies against t he human interleukin-11 r ec eptor a lp ha-chain (IL-11R alpha) a n d their use in studies of h um an mononuclear cells. J. Immunol. Methods 241, 43±59. 55. Trepicchio,W.L.,Bozza,M.,Pedneault,G.&Dorner,A.J.(1996) Recombinant human IL-11 atte nuates the in¯ammatory r esponse through down-regu lation of p roin¯am matory cytokine rele ase and nitric oxide p roductio n. J. Immu nol. 157, 3627±3634. 56. Leng, S.X. & Elia s, J.A. (1997) Interleukin-11 inhibits macrophage interleukin-12 production. J. Immunol. 159, 2 161±2168. 57. Bellido, T., S tahl, N., Farruggella, T.J., Borba, V., Yancopoulos, G.D. & Manolagas, S.C. ( 1996) Detection of r eceptors for inter- leukin-6, interleukin-11, leu kemia inhibitory f actor, oncostatin M, and ciliary neurotrophic factor in bone marrow stromal/osteo- blastic cells. J. Clin. Invest. 97 , 431±437. 58. Girasole, G., Passeri, G ., Jilka, R .L. & M anolagas, S.C. (1994) Interleukin-11: a new cyto kine critical f or osteoclast developm ent. J. Clin. I nvest. 93, 151 6±1524. 59. Cheng, Y. & Pruso, W.H. (1973) R elationship b etween the inhibition constant (K1) and the concentration of inhibitor which causes 5 0 per c ent inhibition ( I50) of an e nzym atic reaction. Biochem. Pha rmacol. 22, 3099±3108. 68 X M. Wang et al. (Eur. J. Biochem. 269) Ó FEBS 2002 . Engineering and use of 32 P-labeled human recombinant interleukin-11 for receptor binding studies Xiao-Ming Wang 1 , Jean-Marc. the regulation of production of pro-in¯ammatory cytokines such as TNF-a,IL-1b,IFN-c and I L-12 by monocytes [55,56], and that the IL-11 receptor analysis on human