The unique pharmacology of the scorpion a-like toxin Lqh3 is associated with its flexible C-tail Izhar Karbat1, Roy Kahn1, Lior Cohen1, Nitza Ilan1, Nicolas Gilles2, Gerardo Corzo3, Oren Froy1, Maya Gur1, Gudrun Albrecht4, Stefan H Heinemann4, Dalia Gordon1 and Michael Gurevitz1 Department of Plant Sciences, George S Wise Faculty of Life Sciences, Tel Aviv University, Ramat Aviv, Tel Aviv, Israel ´ ´ ´ ´ CEA Saclay, Departement d’Ingenierie des Proteines, Gif-sur Yvette, France ´ ´ ´ ´ Instituto de Biotecnologıa, Universidad Nacional Autonoma de Mexico, Cuernavaca Morelos, Mexico Center for Molecular Biomedicine, Department of Biophysics, Friedrich Schiller University Jena, Germany Keywords pH-dependent toxin binding; scorpion a-like toxin; structure–function relationships; toxin effect on inactivation; toxin receptor site on sodium channel Correspondence D Gordon and M Gurevitz, Department of Plant Sciences, George S Wise Faculty of Life Sciences, Tel Aviv University, Ramat Aviv, Tel Aviv 69978, Israel Fax: +972 6406100 Tel: +972 6409844 E-mail: dgordon@post.tau.ac.il and mamgur@post.tau.ac.il (Received January 2007, revised February 2007, accepted 12 February 2007) doi:10.1111/j.1742-4658.2007.05737.x The affinity of scorpion a-toxins for various voltage-gated sodium channels (Navs) differs considerably despite similar structures and activities It has been proposed that key bioactive residues of the five-residue-turn (residues 8–12) and the C-tail form the NC domain, whose topology is dictated by a cis or trans peptide-bond conformation between residues and 10, which correlates with the potency on insect or mammalian Navs We examined this hypothesis using Lqh3, an a-like toxin from Leiurus quinquestriatus hebraeus that is highly active in insects and mammalian brain Lqh3 exhibits slower association kinetics to Navs compared with other a-toxins and its binding to insect Navs is pH-dependent Mutagenesis of Lqh3 revealed a bi-partite bioactive surface, composed of the Core and NC domains, as found in other a-toxins Yet, substitutions at the five-residue turn and stabilization of the 9–10 bond in the cis conformation did not affect the activity However, substitution of hydrogen-bond donors ⁄ acceptors at the NC domain reduced the pH-dependency of toxin binding, while retaining its high potency at Drosophila Navs expressed in Xenopus oocytes Based on these results and the conformational flexibility and rearrangement of intramolecular hydrogen-bonds at the NC domain, evident from the known solution structure, we suggest that acidic pH or specific mutations at the NC domain favor toxin conformations with high affinity for the receptor by stabilizing the bound toxin-receptor complex Moreover, the C-tail flexibility may account for the slower association rates and suggests a novel mechanism of dynamic conformer selection during toxin binding, enabling a-like toxins to affect a broad range of Navs Voltage-gated sodium channels (Navs) are responsible for the depolarization phase of the action potential in most excitable cells Due to their pivotal role in excitability, Navs are targeted by a large variety of toxins that modify their gating, such as long-chain scorpion toxins These toxins are 61–76 residue-long polypeptides that share a similar a ⁄ b scaffold and are divided into two classes, a and b, according to their mode of action and different receptor sites [1,2] Scorpion a-toxins prolong the action potential by slowing channel inactivation upon binding at a site that involves extracellular regions of channel domains and [2–4] Although different a-toxins are similarly toxic to mice when injected subcutaneously and similarly affect Abbreviations Aah2, alpha toxin from the scorpion Androctonus australis hector; BmK M1, alpha toxin from the scorpion Buthus martensii Karsch; CHO, Chinese hamster ovary; Lqh2, Lqh3, LqhaIT, alpha toxins from the scorpion Leiurus quinquestriatus hebraeus; Nav, voltage-gated sodium channel 1918 FEBS Journal 274 (2007) 1918–1931 ª 2007 The Authors Journal compilation ª 2007 FEBS I Karbat et al a-Like toxin binding is linked to its flexibility Fig Sequence alignment of scorpion a-toxins representing three pharmacological groups Positions are numbered according to Aah2 Dashes indicate gaps for best alignment Residues of the five-residue turn and C-tail are shaded Residues of the conserved Core domain are in bold Lqh2, Lqh3, LqhaIT [9], Lqh6, and Lqh7 [40] are from the scorpion L quinquestriatus hebraeus; Aah2 is from Androctonus australis hector; Lqq3 and Lqq5 are from L quinquestriatus quinquestriatus; Bmk-M1, Bmk-M2, Bmk-M4, and Bmk-M8 are from Buthus martensii Karch; Bom3 and Bom4 are from Buthus occitanus mardochei [9] rat skeletal muscle Navs [5–7], they exhibit profound differences in potency when injected into mice brain, and in their affinity for insect and rat-brain neuronal preparations [7,8] Accordingly, scorpion a-toxins were divided into three pharmacological groups (Fig 1): (a) Classical anti-mammalian toxins that bind with high affinity to rat brain synaptosomes and are practically nontoxic to insects [1]; (b) a-toxins highly active on insects that bind with high affinity to insect Navs and are weakly toxic in mammalian brain; and (c) a-like toxins that are active in both mammalian brain and insects (Fig [8,9]) To correlate the selectivity of a-toxins with their structure, the bioactive surface of the anti-insect LqhaIT (from L quinquestriatus hebraeus) and its putative equivalent in the anti-mammalian Aah2 were investigated and shown to consist of two domains [10] Four residues located on short loops that connect the conserved secondary structure elements of the molecule core form the Core domain, while the five-residue-turn (residues 8–12) and the C-terminal segment (residues 56–64) form the NC domain The division of the bioactive surface into two domains is supported by muta- genesis of the a-like toxin BmK M1 (from Buthus martensii Karch) [11–13] As the amino acid composition and spatial arrangement of the NC domain varies among a-toxins, it was suggested to confer toxin preferential binding to various Navs The high insecticidal potency of LqhaIT was correlated with a protruding conformation of the NC domain, a feature typifying all scorpion a-toxins active on insects This protrusion, mediated by a nonproline cis peptide bond between residues and 10 of the five-residue turn, differs markedly from the flat conformation dictated by a trans peptide bond conformation between residues and 10, which characterizes the NC domain in toxins highly active in the rat brain [10,14] In this respect, the high potency of a-like toxins for both insect and various mammalian Navs [7] cannot be readily explained and was addressed here using Lqh3, the most pharmacologically characterized toxin with known structure of the a-like group [15] Lqh3 is highly toxic to insects and competes with LqhaIT on binding to insect Navs Lqh3 differs from classical anti-mammalian a-toxins as it inhibits Nav inactivation in cell bodies of hippocampus brain neurons, on which the anti-mammalian FEBS Journal 274 (2007) 1918–1931 ª 2007 The Authors Journal compilation ª 2007 FEBS 1919 a-Like toxin binding is linked to its flexibility I Karbat et al Lqh2 is inactive, and is unable to affect Nav1.2 in the rat brain, on which Lqh2 is highly active [16] Moreover, it has been shown that the pharmacological properties of Lqh3 are unique in that its binding affinity for insect channels drops >30-fold at pH 8.5 versus pH 6.5, and its rate of association with receptor site-3 on both insect and mammalian Navs is 4–15-fold slower compared with LqhaIT and Lqh2 [6,17,18] To clarify the molecular basis of the unique pharmacological features of Lqh3, we analyzed its bioactive surface seeking for residues involved with its slow association kinetics and sensitivity to pH changes upon interaction with insect Navs Our data reveal that residues at the NC domain, which may serve as hydrogen bond acceptors or donors, are specifically associated with these features Re-examination of the solution structures of Lqh3 disclosed a high conformational flexibility of its C-tail, which may interconvert between two distinct conformers that differ in their intramolecular hydrogen-bonding pattern Based on these observations we suggest that the unique pharmacological features of scorpion a-like toxins are associated with the flexibility of the C-tail Results The bioactive surface of Lqh3 Twenty-four residues were substituted and the toxin mutants were produced in Escherichia coli as a fusion peptide (His-Apamin-Lqh3), folded in vitro, and purified by RP-HPLC (see Experimental procedures) Changes in activity were monitored in toxicity assays on blowfly larvae and binding assays using cockroach neuronal membrane preparations CD spectroscopy was used as a measure of secondary structure signature to discern effects that were due to structural perturbations from those associated directly with toxin activity From a total of 49 mutants, the CD spectrum of only I59R altered (Fig 2B) Of the 24 modified residues, substitution of 15 had a weak (DDG ẳ 1.1 kcalặmol)1) to moderate (DDG ¼ 1.5 kcal ⁄ mol) effect on activity (Table 1) Substitutions in the five-residue turn (residues 8–12) had no significant effect on the activity to insects, even when charges were neutralized or inverted (Table 1) These results imply that the five-residue turn in Lqh3 is most likely not involved in direct interaction with the channel receptor, and that it tolerates considerable changes with no perturbation of toxin folding, in contrast to LqhaIT [19] and BmK M1 [14] Substitutions in the loop preceding the a-helix had large effects on activity, as shown by the replacement of His15 by bulky aliphatic or charged residues (H15F ⁄ L ⁄ R), Phe17 by Ala, and Pro18 by Arg or Gly (Table 1) Substitutions in the loop connecting the second and the third b-strands highlighted the importance for activity of Phe39 and Leu45, as was shown for their equivalents in LqhaIT and Bmk-M1 [10,12] His15, Phe17, Pro18, Phe39 and Leu45 constitute a distinct amino acid cluster on the molecule surface interconnected by hydrophobic–aromatic interactions resembling the Core domain reported for LqhaIT [10] Substitutions I59A ⁄ R had a marked effect on the binding affinity (Table 1) Ile59 is mostly buried in the molecule and forms hydrophobic contacts with Gly4, Tyr5, Ile6, and Ala7 of the N-terminal region [15] While I59R altered the CD signature of the molecule, the CD spectrum of I59A was similar to that of the unmodified toxin, which suggested that Ile59 might form contact with the receptor site, as was suggested for the equivalent residue in other a-toxins [10,11,20] Neutralization or inversion of the charge of Lys64 (K64A ⁄ D) and His66 (H66A ⁄ E) significantly affected the activity, while a conserved substitution had a minor effect (Table 1), which suggested that a Fig The bioactive surface of Lqh3 (A) The toxin backbone is shown in ribbon Residues, whose substitution affected the function (see Table 1) are space-filled and colored according to their chemical nature (aliphatic, green; aromatic, magenta; positive, blue) (B) CD spectra of the recombinant HA-Lqh3 and representative mutants 1920 FEBS Journal 274 (2007) 1918–1931 ª 2007 The Authors Journal compilation ª 2007 FEBS I Karbat et al a-Like toxin binding is linked to its flexibility Table Effects of mutations in Lqh3 on binding to cockroach neuronal membranes The change in apparent binding affinity is presented as the ratio of K mut over K wt K wt and K mut were obtained in competition against 125I-LqhaIT binding at pH 7.2, as previously described [18] i i i i The K wt value is 1.0 ± 0.1 nM, n ¼ Ki determination is described in the Experimental procedures The change in binding energy was calcui lated as DDG ¼ -RT ln(K wt ⁄ K mut ) i i HA-Lqh3 mutant K mut ⁄ K wt i i DDG (kcalỈmol)1) Lqh3 mutant K mut ⁄ K wt i i DDG(kcalỈmol)1) Q8A Q8K P9G E10A E10Y E10R E10P Y14A H15A H15F H15L H15R F17A F17L F17Y P18A P18R P18G S20A S21A D24A H36A F39A K40A V41A 9.5 3.5 9.0 2.5 0.4 6.6 1.0 15.6 3.9 45.0 109.0 577.0 91.0 3.5 10.0 92.0 210.0 258.0 6.0 1.9 1.5 4.9 28.0 9.0 13.0 1.33 0.74 1.30 0.54 )0.54 1.11 0.00 1.62 0.80 2.25 2.77 3.75 2.66 0.74 1.36 2.67 3.16 3.28 1.06 0.38 0.24 0.94 1.97 1.30 1.51 H43A H43R H43E L45A I58A I59A I59R V60A V60L E61A E61L E61R E63A E63R K64A K64D K64L K64R H66A H66R H66E S67A P9C-E10C E10Y-E63R 4.0 0.2 117.0 70.0 1.2 103.0 25.0 1.0 13.0 0.2 1.4 0.5 2.0 0.8 16.0 22.0 18.0 4.0 23.0 4.0 10.0 1.4 1.0 0.4 0.82 )1.05 2.81 2.51 0.11 2.73 1.90 0.00 1.51 )0.95 0.20 )0.41 0.41 )0.13 1.64 1.82 1.71 0.82 1.85 0.82 1.36 0.20 0.00 )0.54 positively charged C-tail was important for activity Substitutions at the negatively charged patch composed of Glu10, Glu61 and Glu63, which is unique to Lqh3 compared to other a-toxins, had no effect on the activity (Table 1) We further examined if the bioactive surface of Lqh3 towards insect Navs coincided with that presented toward rat skeletal muscle Navs by analyzing the effects of various substitutions on Nav1.4 and Drosophila melanogaster DmNav1 Navs expressed in Chinese hamster ovary (CHO) cells and in Xenopus oocytes, respectively (Table 2) Most substitutions that markedly reduced the binding affinity for cockroach neuronal membranes reduced the toxin potency towards rNav1.4 and DmNav1 to a similar extent However, H15A, which had only a slight effect on the toxicity and binding affinity for insects and on potency at DmNav1, profoundly affected the potency at rNav1.4 This analysis highlighted also substitution H66E, which had a larger effect on the potency at DmNav1 than at rNav1.4 (Table 2) Thus, the bioactive surface of Lqh3 towards insect and rat skeletalmuscle Navs is similar, but not identical, where Table Comparison of the effects of selected Lqh3 mutants on rat skeletal muscle Navs (rNav1.4) expressed in CHO cells and on the Drosophila DmNav1 channel expressed in Xenopus oocytes The apparent effective concentration 50% (EC50) of each mutant on rNav1.4 and DmNav1 were determined in at least three independent experiments (see Experimental procedures) and normalmut wt ized to the potency of unmodified Lqh3 (EC50 ⁄ EC50 ) The effect on DmNav1 was assayed at pH 7.1 (EC50 ¼ 10.5 ± 1.6 nM) Lqh3 mutant EC50 (rNav1.4) (nM) mut wt EC50 ⁄ EC50 rNav1.4 mut wt (EC50 ⁄ EC50 DmNav1) Unmodified Lqh3 H15A F17A P18A S20A F39A H43E L45A I58A I59A K64D H66E 4.2 209 87.3 424 11.5 154 505 342 48.3 86.2 128 27.4 49.3 (10.7) 20.6 100 2.7 36 119 80 11.4 20.4 30.1 (2.2) 6.5 (117) FEBS Journal 274 (2007) 1918–1931 ª 2007 The Authors Journal compilation ª 2007 FEBS ± ± ± ± ± ± ± ± ± ± ± ± 0.5 40 10.5 8.0 1.3 35 30 71 17.2 19.4 40 2.2 1921 a-Like toxin binding is linked to its flexibility I Karbat et al His15 and His66 seem to contribute to the differential interaction of Lqh3 with channel receptors of various origin In total, the bioactive surface of Lqh3 is composed of two distinct domains, the Core and NC domains, formed by residues of the loop preceding the a-helix, the loop connecting the second and the third b-strands, and the C-tail (Fig 2A) decrease in the dissociation rate constant at lower pH [18] To clarify the molecular basis of the pH-dependent binding, we examined two mechanisms previously suggested to affect toxin binding It was suggested that a cis–trans isomerization of the nonproline cispeptide bond between residues and 10 of scorpion a-like toxins might function as a molecular switch that determines their preference for various Navs [14] In Lqh3, the peptide-bond between Pro9 and Glu10 appears in solution as a mixed population of cis and trans conformations, and a slow pH- and temperature-dependent interconversion between these two isomeric forms was reported [15,21] Thus, a pH-dependent isomerization of the P9-E10 bond in Lqh3 could underlie its pH-dependent binding We tested this hypothesis by constructing a toxin double mutant, in which Cys substituted both residues Modeling of the double mutant (P9C-E10C) predicted that the position of these two Cys residues on the tight five-residue-turn would force their side chains to adopt a solvent exposed conformation and create a vicinal disulfide bond in a cis conformation (Fig 4A,B) The toxin mutant was successfully expressed and folded in vitro, and exhibited identical toxicity (EC50 ¼ 75 ± ng ⁄ 100 mg blowfly larvae) and binding affinity for cockroach neuronal membranes (Ki ¼ 1.06 ± 0.07 nm, n ¼ 3) as those of the unmodified toxin (Table 1) The molecular mass of the P9C-E10C toxin mutant was determined to be 7040 ± 0.1 Da, which corresponded exactly to the theoretical mass calculated, assuming that the newly introduced Cys residues were both oxidized This Effect of substitutions in Lqh3 on its pH-dependent binding The binding affinity of Lqh3 for cockroach neuronal membranes decreased 32-fold when assayed at pH 8.5 compared to pH 7.2 (Table 3) We have further tested the effect of pH transitions on Lqh3 interaction with DmNav1 channels expressed in Xenopus oocytes Under control conditions, pH alterations of the bath solution in the range 7.0–8.5 had no effect on the sodium current amplitude, and a slight reduction of the peak current was observed at pH 6.5 (not shown) The effect of Lqh3 on DmNav1 increased markedly upon transition from basic to more acidic pH with an estimated half saturation at pH 7.2 (Fig 3A–C) This increase was slow and typically saturated after 10–15 (Fig 3D) The slow kinetics was also evident when the toxin was pre-equilibrated at the tested pH prior to application onto the oocyte, suggesting that Lqh3 sensitivity to pH is associated with some later stage in the binding process to the channel This is corroborated by previous binding studies, which demonstrated that Lqh3 association rate did not change between pH 7.5 and 6.5, and the increased affinity was due to Table Effect of mutations on the pH dependence of Lqh3 binding to cockroach neuronal membranes All binding experiments were performed using 125I-LqhaIT, a pH-independent marker of receptor site-3 [18], and the data represent mean ± SE of 2–4 independent experiments; ND, not determined Ki (pH 8.5) ⁄ Ki (pH 7.2) represents the change in ratio when the analysis was performed at pH 8.5 versus 7.2 Mutant Ki, pH 6.5 (nM) Ki, pH 7.2 (nM) Ki, pH 8.5 (nM) Ki (pH 8.5) ⁄ Ki (pH 7.2) Unmodified Lqh3 Q8A E10Y H15A H15L H36A H43A H43R H43E E63R H66A H66R P9C-E10C E10Y-E63R 0.49 0.56 0.16 3.86 20 0.59 ND 0.13 64.5 ND 6.05 1.14 0.55 0.09 1.0 9.5 0.42 3.85 109 4.9 3.95 0.17 117 0.83 22.7 4.1 1.0 0.44 32.67 5.4 5.9 1633 7207 81.2 170 3.2 3112 6.8 141 14.4 34 2.93 32.7 0.56 14 424 66.3 16.6 43 18.8 26.6 8.19 6.2 3.5 34 6.7 1922 ± ± ± ± ± ± 0.11 0.05 0.08 0.03 1.00 0.11 ± 0.04 ± 2.40 ± ± ± ± 1.55 0.27 0.10 0.03 ± ± ± ± ± ± ± ± ± ± ± ± ± ± 0.1 2.5 0.13 0.65 19 1.9 0.05 0.04 12 0.18 1.3 0.3 0.14 0.14 ± ± ± ± ± ± ± ± ± ± ± ± ± ± 6.67 1.6 1.7 497 1927 10.9 10 0.06 1589 0.8 34 1.25 4.5 0.14 FEBS Journal 274 (2007) 1918–1931 ª 2007 The Authors Journal compilation ª 2007 FEBS I Karbat et al a-Like toxin binding is linked to its flexibility B A C o n tr ol 8.0 7.5 Normalized effect 1.0 0.8 7.0 0.6 0.4 6.5 μΑ 0.2 pH 7.1 pH 7.85 ms 0.0 10 10 10 10 10 [Toxin] (nM) D 1.0 0.7 0.6 0.8 Normalized effect Normalized effect C 0.6 0.4 0.2 0.5 0.4 0.3 0.2 6.5 7.5 7.0 8.0 200 400 pH 600 800 Time (s) Fig pH-dependent effect of Lqh3 on DmNav1 channels expressed in Xenopus oocytes (A) Concentration-response relationship of Lqh3 at pH 7.85 (s) and pH 7.1 (d) Data were fit using the Hill equation (Eqn 1, Experimental procedures) and the EC50 values obtained were 86.6 ± 15.1 nM (n ¼ 3; pH 7.85) and 10.5 ± 1.6 nM (n ¼ 3; pH 7.1) (B) Effect of Lqh3 at various pH values Oocytes were incubated with 50 nM Lqh3 dissolved in buffer at pH 8.0, and the toxin effect was continuously monitored by step depolarizations to )10 mV from a holding potential of )80 mV The toxin effect was allowed to saturate for 10 and the external solution was then replaced by 50 nM Lqh3 in pH 7.5 buffer This procedure was repeated stepwise down to pH 6.5 Current traces from a representative oocyte are shown (C) Toxin effect (Iss ⁄ Ipeak) at each pH in the range 6.5–8.0 was normalized to the maximal effect obtained at pH 6.5 and plotted as a function of the pH Each point represents mean ± SEM from three oocytes (D) Kinetics of the effect developed upon transition from pH 7.5 to pH 7.0 for the cell presented in B The steady-state to peak current ratio was determined at intervals of 15 s from the transition to pH 7.0 and is plotted against the incubation time The kinetics was fit by a single exponential with s ¼ 496 s A B Q8 C Q8 P9 C9 C12 C12 C10 E10 N11 N11 4.0Å 3.9Å E10 H66 E63 Fig Conformations of the five-residue turn and the C-terminal segment of Lqh3 (A,B) Fixation of the peptide bond between residues and 10 in Lqh3 in a cis conformation by an engineered vicinal disulfide bond The five-residue turn of Lqh3 (A) is compared with its modeled equivalent in the P9C-E10C mutant (B) The modeling was based on the structure of Lqh3, and energy minimized in vacuo using the GROMOS96 implementation of Swiss-pdbViewer [39] The arrows point to the cis peptide bond between residues and 10 (C) Hydrogen bond network that involves the sidechains of Glu10, Glu63 and His66 FEBS Journal 274 (2007) 1918–1931 ª 2007 The Authors Journal compilation ª 2007 FEBS 1923 a-Like toxin binding is linked to its flexibility I Karbat et al finding suggested that the two Cys residues were indeed linked by a vicinal disulfide bond (Fig 4B) Still, the binding affinity of the double mutant remained highly dependent on pH, similar to the unmodified Lqh3 (Table 3) Therefore, we concluded that the cis–trans isomerization of the P9-E10 peptide-bond was most likely unrelated to the pH dependence of Lqh3 To test the possibility that the pH-dependent binding of Lqh3 is associated with protonation of surface histidines [18], we examined the effects of toxin mutants H15A ⁄ L, H36A, H43A ⁄ R, and H66A ⁄ R ⁄ E on the binding affinity for cockroach synaptosomes at various pH values (Table 3) Whereas substitutions of His15, His36 and His43 did not reduce Lqh3 sensitivity to pH, substitutions of His66 had a clear impact with the utmost decrease obtained with H66R (Table 3) Unexpectedly, substitutions of neutral or negatively charged residues of the five-residue turn (Q8A and E10Y) and C-tail (E63R), which were not assigned to the bioactive surface, reduced markedly the dependence of binding affinity on pH (Table 3) Combined with the slow build up of Lqh3 effect on DmNav1 upon pH transitions, these results indicate that the dependence of Lqh3 binding on pH is not dictated by the protonation of His residues per se These A LqhαIT findings prompted us to examine structural features of the NC domain that could explain its relatedness with the pH dependency Lqh3 pH-dependent binding is associated with the conformational flexibility of the C-tail Inspection of Lqh3 solution structure reveals that the C-terminal segment is by far more flexible than its equivalent in LqhaIT (Fig 5A,B) The conformational heterogeneity focuses on a short loop spanning residues 60–64 (Fig 5B), and is mediated by alternations in a hydrogen bond network among the negatively charged carboxyl groups of Glu10 and Glu63, and the guanidinium moiety of His66 (Fig 4C), substitution of which clearly affected the pH-dependent binding of Lqh3 (Table 3) To examine whether changes in this hydrogen bond network alter Lqh3 sensitivity to pH, we constructed a double mutant, in which Tyr and Arg substituted Glu10 and Glu63 to eliminate the intramolecular polar interactions of His66 with these two Glu residues The binding affinity of the E10Y-E63R mutant to cockroach neuronal membranes (Table 3), as well as its potency at DmNav1 channels at neutral pH, was similar to that of the unmodified toxin (Fig 6A) Lqh B r.m.s.d ( ) 3.0 2.5 Lqh3 Lqh IT 2.0 1.5 1.0 0.5 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44 46 48 50 52 54 56 58 60 62 64 66 Residue 1924 Fig Conformational heterogeneity in LqhaIT and Lqh3 (A) Solution structures of LqhaIT (PDB ID: 1LQI) and Lqh3 (PDB ID: 1FH3) in a ‘sausage’ representation The Ca carbon trace is depicted as a tube with a radius proportional to the mean rmsd observed within the various conformers in the NMR ensemble a-Helices are highlighted in red; b-strands are colored in cyan The arrows point to the C-terminal segment of the molecule (B) The rmsd of the Ca atoms in the solution structures of LqhaIT and Lqh3 For each model in the NMR ensemble (LqhaIT )29 structures [41]; Lqh3–30 structures [15]) the rmsd of each Ca atom was calculated using the mean structure as reference The rmsd of the individual models were averaged and presented for each toxin residue FEBS Journal 274 (2007) 1918–1931 ª 2007 The Authors Journal compilation ª 2007 FEBS I Karbat et al a-Like toxin binding is linked to its flexibility which suggested that structural flexibility rather than rigidity had an important role on its function A 1.0 Normalized effect 0.8 Comparison of the bioactive surface of Lqh3 to those of other a-toxins 0.6 0.4 0.2 Lqh3 E10Y-E63R 0.0 10 -2 10 -1 10 10 [Toxin] nM 10 10 B 1.0 Normalized effect 0.8 0.6 0.4 0.2 Lqh3 E10Y-E63R 0.0 6.5 7.0 7.5 8.0 pH Fig Effects of mutant E10Y-E63R on the properties of interaction with DmNav1 channels (A) Concentration–response relations of the unmodified Lqh3 (s) and mutant E10Y-E63R (n) at pH 7.0 Data were fitted using Hill equation (Eqn 1, Experimental procedures) and the EC50 values obtained are: Lqh3–10.5 ± 1.6 nM (n ¼ 4), E10Y-E63R )6.5 ± 1.2 nM (n ¼ 3) (B) pH-dependent effect of E10Y-E63R (n) compared with the unmodified toxin (s) Data were collected and analyzed as in Fig Surprisingly, the pH-dependence of E10Y-E63R mutant binding to cockroach sodium channels decreased markedly (Table 3), and it was highly potent at DmNav1 channels even at basic pH (Fig 6B) Discussion Insight into the molecular basis of preferential interactions of scorpion a-toxins with insect or mammalian Navs was thus far obtained mainly from mutagenesis and comparison of bioactive surfaces and overall structures of pharmacologically distinct toxins These analyses were based on available crystal structures of a-toxins and their mutants and highlighted the NC domain as a rigid structural entity, whose precise topology dictates toxin specificity for various Nav subtypes [10,14,20] Here we focused on the a-like toxin Lqh3 because of its unique pharmacological features, Molecular dissection of Lqh3 highlighted a bi-partite functional surface composed of a Core domain and an NC domain (Fig 2), as was previously shown for the anti-insect toxin LqhaIT [10] The chemical nature of the Core domain is highly conserved among various scorpion a-toxins, and is predominated by positively charged and aromatic ⁄ hydrophobic residues In Lqh3, substitution of Core-domain residues (His15, Phe17, Pro18, Phe39 and Leu45) had a profound effect on the binding energy (Table 1) Residue 15 (His or Glu in a-like toxins) is especially peculiar: It was not assigned to the bioactive surface of LqhaIT or BmK M1 [10–13,19], but in Lqh3 it seems to be within atomic proximity of the channel receptor, because substitutions which increased its side chain volume (H15F ⁄ L ⁄ R) reduced profoundly the binding affinity (Table 1) In addition, residue 15 is involved in toxin selectivity, as implied from the different effects of mutant H15A on insect versus rat skeletal muscle Navs (Table 2) Thus, the Core domain of Lqh3 plays an important role in both, interaction with the receptor site and toxin selectivity The NC domain, composed of the five-residue turn and the C-terminal segment, varies in amino acid composition and conformation among a-toxins (Fig 1), and was therefore suggested to play a role in toxin selectivity [10,13,14,19,22,23] In scorpion a-toxins (e.g LqhaIT, Aah2, BmK M1 and Lqh3), residue 58 (59 in Lqh3) is involved in an intricate network of intramolecular contacts, which contribute to C-tail stabilization relative to the molecule core Therefore, chemical modifications or substitutions at this region resulted in a number of instances in marked alterations in structure and function [11,22–25] Although the residue in position 58 is conserved in most scorpion a-toxins (Arg or Lys), its equivalent in a number of a-like toxins is hydrophobic ⁄ aliphatic (e.g Ile59 in Lqh3; Fig 1), and is highly important for activity, as shown in Lqh3 (Table 1) The mutagenic dissection highlighted the importance of the C-tail residues Ile59, Lys64 and His66 for activity and selectivity, but not of residues at the five-residue turn (Tables and 3) Whereas substitutions at the five-residue turn of LqhaIT and BmK M1 were shown to greatly affect the activity [10,11,19], mutagenesis at this region in Lqh3 had no effect (Table 1), suggesting that this structural motif was not involved in direct contact with FEBS Journal 274 (2007) 1918–1931 ª 2007 The Authors Journal compilation ª 2007 FEBS 1925 a-Like toxin binding is linked to its flexibility I Karbat et al the channel receptor site Still, the entire NC domain is important for activity as indicated by the effect of substitutions at the five-residue turn and C-tail on toxin potency and its pH-dependent binding to insect Navs (Table 2) Dissociation of the toxin-receptor complex and the slow association kinetics of Lqh3 are linked to the flexibility of the C-tail The substantial decrease in the sensitivity of binding to alterations in pH of Lqh3 mutants modified at the NC domain in residues other than His (Table 3), as well as the slow onset of Lqh3 effect upon pH transitions (Fig 3D), have raised the possibility that the NC domain undergoes a slow conformational change along the toxin binding process with the channel Close inspection of the published Lqh3 solution structure [15,21] has indicated a high degree of conformational heterogeneity of the NC domain especially around the short loop spanning residues 60–64 Detailed analysis of the various backbone conformations of this loop have suggested that the majority (26 out of 29) of Lqh3 NMR models are divided between two main populations (Figs 7A,B), in which the overall topology of the NC domain varies greatly (Fig 7B–F) They differ in the side chains of His66, Glu10 and Glu63, which project to nearly opposite directions (Figs 7C,D), and in the intramolecular contacts among Gln8, Glu10 (of the five-residue turn), Glu63 and His66 (Fig 7C–F), whose substitution had profound effects on Lqh3 pH-dependent binding (Table 3) As a result, the five-residue turn adopts different conformations, although in both populations the backbone torsion angles around the Pro9–Glu10 bond are restricted to allow for a cis conformation Exchange of Fig Lqh3 solution structure exhibits two distinct conformations at its C-terminal segment (A) Lqh3 NMR ensemble (PDB ID: 1FH3) was divided into two separate populations, designated group A (16 structures) and group B (10 structures), and for each group, a geometric average structure was calculated using MOLMOL [42] The averaged rmsd of the backbone atoms of residues 57–67 from the average structure is presented for each group, as well as for the complete NMR ensemble Three structures, which exhibited great structural variations and could not be classified into these two groups were omitted for clarity (B) Ca trace for residues 60–64 of NMR structures classified to group A (red) or group B (blue) (C,D) The side chains of Gln8, Glu10, Glu63 and His66, whose substitution affected Lqh3 pH-dependent binding, is presented for two individual NMR structures that represents two extreme conformations typifying the group A (C) and group B (D) structure populations (E,F) Comparison of the overall topology and disposition of the NC domain relative to the molecule core in group A (E) versus group B (F) model NCdomain residues are colored as in (C, D); for all other residues only backbone atoms are displayed (gray) 1926 FEBS Journal 274 (2007) 1918–1931 ª 2007 The Authors Journal compilation ª 2007 FEBS I Karbat et al conformations between the two populations would involve the formation and breakdown of hydrogen bonds and changes in the tilt and twist angles of the backbone, and should be sensitive to the pH of the medium As His residues contribute in part the hydrogen bonds that differ in the two molecule populations (His66, His43; Fig 7C,D), such a conformational change may provide the basis for the dependence of Lqh3 binding on pH This hypothesis is supported by the decreased sensitivity to pH of the E10Y-E63R mutant, in which key Glu residues that participate in hydrogen bond formation were eliminated (Fig 4C) On the basis of these structural observations and the unchanged toxin association rate under various pH values, as well as the slower toxin dissociation rate at low pH [18], we speculate that upon toxin binding to the channel, acidic pH favors toxin conformation with high affinity for the receptor, and reduces the probability that the bound toxin spontaneously convert to unfavorable conformations, hence stabilizing the toxin-receptor complex In the case of the E10Y-E63R mutations, elimination of critical hydrogen bonds (Fig 7) allows it to assume conformation favourable for the receptor at a wider pH range To explain the mechanism of slow association of Lqh3 to various Navs, we propose that the rate-limiting step that governs Lqh3 binding is a slow transition between the two conformational populations of the toxin depicted in Fig In the course of Lqh3 binding to its Nav receptor, specific toxin conformers are selected from a dynamic ensemble of structures with various C-tail conformations (Fig 7) Such a mechanism may also rationalize the broad-range potency of this toxin on insect as well as mammalian peripheral and brain Navs [5,16,18] A similar explanation might hold for the slow effect on toxicity and a broad range of activity of the site-3 sea anemone toxin Av2 [26], in which the bioactive surface involves a highly flexible Arg14 loop [26–28] The paradigm of dynamic conformer selection was recently demonstrated for the interaction between the cleavage factor component pcf11 and the C-terminal domain of RNA polymerase II [29] This C-terminal domain was found to exist in solution as a dynamic disordered ensemble of conformers, and upon binding to pcf11 it assumed a structured conformation via induced fit This adaptation ability enables RNA polymerase II C-terminal domain region to bind specifically a broad range of factors involved in mRNA processing [29] By analogy, the ability of Lqh3 and possibly other members of the a-like group to affect a wide range of Nav subtypes may be attributed to their conformational flexibility a-Like toxin binding is linked to its flexibility Experimental procedures Bacterial strains and insects Escherichia coli DH5a was used for plasmid constructions, and the BL21 (DE3, pLys) strain was used for toxin expression using the pET-14b vector as was described previously [30,31] Sarcophaga falculata blowfly larvae were bred in the laboratory Lqh3 expression For expression in E coli we used the cDNA encoding Lqh3 isolated from a cDNA library constructed from the RNA of the scorpion L quinquestriatus hebraeus Because expression of Lqh3 using the pET-11c vector, as was described for the toxin LqhaIT [19], was poor, we used a fusionpartner strategy, whereby the N-terminus of Lqh3 was extended by fusion to a Histag-Apamin-linker (HA-Lqh3) Two oligonucleotide primers were used to construct HA-Lqh3 using the pET-14b vector as template DNA Primer 1, 5¢- GGCAGCCATATGTGTAATTGTAAGGCA CCAGAAACTGCACTTTGCGC-3¢, was designed to add a sequence encoding Apamin and a linker cleavable by thrombin and Fx proteases at an NdeI site behind the Histag Apamin folds well in vitro [32] and was added with the anticipation for improved folding of the Lqh3 sequence behind The 3¢ region of this primer included 11 bases that overlapped the 5¢ region of Lqh3-cDNA Primer 2, 5¢- GGATCCGGCTGCTAACAAAGCCCGAAAGG-3¢, was designed for the opposite strand in reverse orientation at the 3¢ side of the Lqh3 gene, and contained a BamHI restriction site for insertion into pET-14b The PCR conditions were 30 cycles of at 94 °C, at 45 °C, and at 72 °C The final product was cleaved by NdeI and BamHI and cloned into the corresponding restriction sites in the polylinker of pET-14b The recombinant Lqh3, which accumulated in inclusion bodies, was folded in vitro following denaturation (in m guanidinium-HCl, 0.1 m Tris ⁄ HCl pH 8.0, mm EDTA, 30 mm reduced glutathione) and renaturation (by 100-fold dropwise dilution into a 0.2 m ammonium acetate pH 8.0, 0.2 mm oxidized glutathione) at 18 °C for 16–24 h The soluble material was precipitated with m ammonium sulfate at °C for 16 h, collected by filtration (GF ⁄ C Whatman paper) and suspended in H2O Final purification of the recombinant toxin was performed on a Vydac C18 reverse phase HPLC column, and HA-Lqh3 eluted as a single peak at 32% acetonitrile with a typical yield of mg toxin per liter of E coli culture The high yield of recombinant toxin seems to involve both higher yield of inclusion bodies and improved in vitro folding of the fusion polypeptide The recombinant HA-Lqh3 exhibited a very similar activity to that of the native Lqh3 (purchased from Latoxan, Valence, France), in FEBS Journal 274 (2007) 1918–1931 ª 2007 The Authors Journal compilation ª 2007 FEBS 1927 a-Like toxin binding is linked to its flexibility I Karbat et al Table Activity of recombinant HA-Lqh3 and native Lqh3 Assay Toxicity to blowfly larvae, ED50 (ng ⁄ 100 mg) Binding to cockroach synaptosomes, Ki (nM) Potency on Nav1.4 channels, EC50 (nM) HA-Lqh3 Native Lqh3 56 ± 1.93 ± 0.9 5.4 ± 1.2b 25 ± 1.24 ± 0.23a 4.23 ± 0.52c [16] b rNav1.4 expressed in CHO cells (this study) expressed in human embryonic kidney (HEK) cells [6] a c rNav1.4 toxicity assays to blowfly larvae, binding affinity to cockroach neuronal membranes, and potency to rat skeletal muscle rNav1.4 channels expressed in mammalian cells (Table 4) These results corroborated previous observations that extension of the N-terminus of long-chain scorpion toxins does not impair their activity [31] Therefore, most assays were conducted with HA-Lqh3 derivatives without further cleavage and purification of the Lqh3 moiety analytical ResourceÒ RP-HPLC column (6.4 · 100 mm, 15 lm particle size; Amersham, Bjorkgatan, Sweden) The ă concentration of the radiolabeled toxin was determined according to the specific activity of the 125I corresponding to 2500–3000 dpmỈfmol)1 of monoiodotoxin, depending on the age of the radiotoxin and by estimation of its biological activity (usually 70–80%) Composition of media used in the binding assays and termination of the reactions have been previously described [18] Non-specific toxin binding was determined in the presence of lm of the unlabeled toxin Equilibrium competition binding assays were performed using increasing concentrations of unlabeled toxin in the presence of a constant low concentration of 125I-LqhaIT, and analyzed by the computer program kaleidagraph (Synergy Software, Reading, PA, USA) using a nonlinear Hill equation (for IC50 determination) Ki values were calculated using the equation Ki ¼ IC50 ⁄ (1 + (L* ⁄ Kd)), where L* is the concentration of radioiodinated toxin and Kd is its dissociation constant Each experiment was performed in duplicate and repeated at least three times as indicated (n) Data are presented as mean ± SE of the number of independent experiments Mutagenesis Mutations in the cDNA encoding Lqh3 were introduced via PCR using complementary oligonucleotide primers All toxin mutants were produced similarly to the unmodified toxin and all sequences were verified before expression Toxicity assays Four-day-old blowfly larvae (S falculata; 150 ± 20 mg body weight) were injected intersegmentally A positive result was scored when a characteristic contraction was observed up to after injection Five concentrations of each toxin were injected to larvae (nine larvae in each group) in three independent experiments Effective dose 50% (ED50) values were calculated according to the sampling and estimation method of Reed and Muench [33] Notably, even in doses exceeding the ED50, the toxin effect was substantially delayed compared to the effect induced by equivalent doses of the a-toxin LqhaIT, and fully developed 3–5 post injection Competition binding experiments Neuronal membranes were prepared from heads of adult cockroaches Periplaneta americana [18] Membrane protein concentration was determined by a Bio-Rad (Hercules, CA, USA) Protein Assay, using bovine serum albumin as standard Radioiodinated LqhaIT was prepared by lactoperoxidase (Sigma, St Louis, MO, USA; U per 60 lL reaction mix) using 10 lg toxin and 0.5 mCi carrier-free Na125I (Amersham, Chalfont St Giles, UK) following a published protocol [34] The monoiodotoxin was purified using an 1928 CD spectroscopy CD spectra were recorded at 25 °C using a model 202 circular dichroism spectrometer (Aviv Instruments, Lakewood, NJ, USA) HA-Lqh3 and mutants thereof (150 lm) were dissolved in mm sodium phosphate buffer, pH 7.0 and their spectrum was determined using a quartz cell of 0.1-mm light path Each spectrum was recorded three times and averaged Blank spectrum was subtracted from each curve Expression of insect DmNav1 channels in oocytes and two-electrode voltage clamp experiments cRNAs encoding the D melanogaster para (DmNav1) Nav a-subunit, and the auxiliary TipE subunit (kindly provided by J Warmke, Merck, Whitehouse Station, NJ, USA, and M S Williamson, IACR-Rothamsted, UK, respectively), were transcribed in vitro using T7 RNA-polymerase and the mmessage mmachineTM system (Ambion, Austin, TX, USA [35,36]); and injected into Xenopus laevis oocytes as was previously described [37] Currents were measured 4–5 days after injection using a two-electrode voltage clamp and a Gene Clamp 500 amplifier (Axon Instruments, Union City, CA, USA) Data were sampled at 10 kHz and filtered at kHz Data acquisition was controlled by a Macintosh PPC 7100 ⁄ 80 computer, equipped with ITC-16 analog ⁄ digital converter (Instrutech Corp., Port Washington, NY, USA), utilizing Synapse (Synergistic Systems, Sweden) Capacitance transients and leak currents were removed by subtracting a scaled control trace utilizing a P ⁄ protocol [36] Bath solution contained (in mm): 96 NaCl, KCl, FEBS Journal 274 (2007) 1918–1931 ª 2007 The Authors Journal compilation ª 2007 FEBS I Karbat et al MgCl2, CaCl2, Hepes, pH 7.85 Oocytes were washed with bath solution flowing from a BPS-8 perfusion system (ALA Scientific Instruments, Westbury, NY, USA) with a positive pressure of psi Toxins were diluted with bath solution containing mgỈmL)1 bovine serum albumin, and applied directly to the bath to the final desired concentration To discard any application artifacts, mgỈmL)1 bovine serum albumin solution was applied before toxin application Expression of Nav1.4 channels in CHO cells and whole-cell patch clamp recording CHO cells were maintained in F12 medium, supplemented with 10% fetal calf serum, in a 5% CO2 incubator Transient transfection was achieved using FuGENE (Roche Applied Science, Manheim, Germany) with a : 0.3 ratio of the pAlter expression vector encoding rNav1.4 and with a vector encoding the CD8 antigen [38] Individual transfected cells were visualized with Dynabeads (Deutsche Dynal GmbH, Hamburg, Germany) binding to CD8 Currents were recorded 2–3 days after transfection Whole-cell voltage clamp experiments were conducted using an Axopatch 200B amplifier (Axon Instruments) at room temperature Data were acquired with a Macintosh G4 computer equipped with an ITC-16 analog-to-digital converter (Instrutech Corp., Port Washington, NY, USA) using synapse software (Synergistic Systems) Currents were lowpass filtered at kHz and sampled at a rate of 10 kHz Cell and electrode capacitance and series resistance were compensated with an internal voltage clamp circuit Residual linear leak and capacitance were removed by subtracting scaled control traces using P ⁄ protocol [36] The patch pipette contained 35 mm NaCl, 105 mm CsF, 10 mm EGTA, and 10 mm Hepes (adjusted to pH 7.4 with CsOH) The bath solution contained 140 mm NaCl, mm CsCl, 1.8 mm CaCl2, mm MgCl2, mm Na2ATP, and 10 mm Hepes (adjusted to pH 7.4 with NaOH) Toxins were dissolved in the bath solution containing 1% bovine serum albumin, and perfusion of the cells was conducted with a flow pipe glass barrel (400 lm, outer diameter) positioned 100 lm from the cell Concentration–response curves of Lqh3 effect on fast inactivation For the construction of concentration-response curves, currents were elicited by a depolarization to )10 mV from a holding potential of )80 mV in the presence of several toxin concentrations At each toxin concentration, the currents were allowed to reach a steady-state level prior to the final measurement The concentration-dependence for toxininduced removal of fast inactivation was calculated by plotting the ratio of the steady-state current remaining 50 ms a-Like toxin binding is linked to its flexibility after depolarization (Iss) to the peak current (Ipeak) as a function of toxin concentration and fitting with the Hill equation Iss a1 À a0 ¼ a0 ỵ 1ị  H Ipeak EC50 ỵ ẵToxin where H is the Hill coefficient, [Toxin] is the toxin concentration, and a0 is the offset measured prior to toxin application The amplitude a1 ) a0 provides the maximal effect obtained at saturating toxin concentrations EC50 is the concentration of half maximal inhibition of fast inactivation To reduce variability, H was set to in all cases Mass spectrometry The mass of unmodified Lqh3 and that of the Lqh3 P9CE10C mutant (after Fx cleavage) was determined by the Mass Spectrometry Unit of the Weizmann Institute (Rehovot, Israel) using a MALDI mass spectrometer, Bruker REFLEXTM reflector time-of-flight instrument with SCOUTTM multiprobe (384) inlet and gridless delayed extraction ion source, with accuracy of 0.001 Da Three-dimensional modeling and structural analysis Three-dimensional models were prepared using pymol (Delano Scientific LLC, http://www.pymol.org) Conformational variability of Lqh3 solution structure was assessed with deepview/pdb viewer version 3.7 [39] using custom script for the extraction and comparison of backbone atom coordinates Acknowledgements We are thankful to J Warmke, Merck, Whitehouse Station, NJ, USA, and M S Williamson, IACRRothamsted, UK, for the kind gift of DmNav1 and TipE clones, respectively, and to Y Moran, Tel Aviv University, for fruitful discussions This research was supported by the United States–Israel Binational Agricultural Research and Development grant IS-3480–03 (to MG and DG); by the Israeli Science Foundation, grants 733 ⁄ 01 (to MG) and 1008 ⁄ 05 (to DG); by a grant from the GIF, the German–Israeli Foundation for Scientific Research and Development No G-770–242.1 ⁄ 2002 (to DG), and by the German Research Association HE2993 ⁄ (to SHH) References Gordon D, Savarin P, Gurevitz M & Zinn-Justin S (1998) Functional anatomy of scorpion toxins affecting sodium channels J Toxicol Toxin Rev 17, 131–158 FEBS Journal 274 (2007) 1918–1931 ª 2007 The Authors Journal compilation ª 2007 FEBS 1929 a-Like toxin binding is linked to its flexibility I Karbat et al ` Cestele S & Catterall WA (2000) Molecular mechanisms of neurotoxin action on voltage-gated sodium channels Biochimie 82, 883–892 Rogers JC, Qu Y, Tanada TN, Scheuer T & Catterall WA (1996) Molecular determinants of high affinity binding of a-scorpion toxin and sea anemone toxin in the S3–S4 extra-cellular loop in domain IV of the sodium channel a subunit J Biol Chem 271, 15950– 15962 Leipold E, Lu S, Gordon D, Hansel A & Heinemann SH (2004) Combinatorial interaction of scorpion toxins Lqh2, Lqh3 and LqhaIT with sodium channel receptor sites-3 Mol Pharmacol 65, 685–691 Gilles N, Chen H, Wilson H, Le Gall F, Montoya G, Molgo J, Schonherr R, Nicholson G, Heinemann SH & Gordon D (2000) Scorpion a- and a-like toxins differentially interact with sodium channels in mammalian CNS and periphery Eur J Neurosci 12, 2823–2832 Chen H, Gordon SH & Heinemann S (2000) Modulation of cloned skeletal muscle sodium channels by the scorpion toxins Lqh II, Lqh III, and LqhaIT Pflugers Arch - Eur J Physiol 439, 423–432 Gordon D, Gilles N, Bertrand D, Molgo J, Nicholson GM, Sauviat MP, Benoit E, Shichor I, Lotan I, Gurevitz M et al (2002) Scorpion toxins differentiating among neuronal sodium channel subtypes: Nature’s guide for design of selective drugs In Perspectives in Molecular Toxinology (Menez, A, ed.), pp 215–238 Wiley & Sons, Chichester ` Gordon D, Martin-Eauclaire MF, Cestele S, Kopeyan C, Carlier E, Ben Khalifa R, Pelhate M & Rochat H (1996) Scorpion toxins affecting sodium current inactivation bind to distinct homologous receptor sites on rat brain and insect sodium channels J Biol Chem 271, 8034–8045 Possani LD, Becerril B, Delepierre M & Tytgat J (1999) Scorpion toxins specific for Na+-channels Eur J Biochem 264, 287–300 10 Karbat I, Frolow F, Froy O, Gilles N, Cohen L, Turkov M, Gordon D & Gurevitz M (2004) Molecular basis of the high insecticidal potency of scorpion alphatoxins J Biol Chem 279, 31679–31686 11 Wang CG, Gilles N, Hamon A, Gall FL, Stankiewicz M, Pelhate M, Xiong YM, Wang DC & Chi CW (2003) Exploration of the functional site of a scorpion a-like toxin by site directed mutagenesis Biochemistry 42, 4699–4708 12 Sun YM, Bosmans F, Zhu RH, Goudet C, Xiong YN, Tytgat J & Wang DC (2003) Importance of the conserved aromatic residues in the scorpion a-like toxin BmK M1 J Biol Chem 278, 24125–24131 13 Liu LH, Bosmans F, Maertens C, Zhu RH, Wang DC & Tytgat J (2005) Molecular basis of the mammalian potency of the scorpion alpha-like toxin, BmK M1 FASEB J 19, 594–596 1930 14 Guan RJ, Xiang Y, He XL, Wang CG, Wang M, Zhang Y, Sundberg EJ & Wang DC (2004) Structural mechanism governing cis and trans isomeric states and an intramolecular switch for cis ⁄ trans isomerization of a non-proline peptide bond observed in crystal structures of scorpion toxins J Mol Biol 341, 1189–1204 15 Krimm I, Gilles N, Sautiere P, Stankiewicz M, Pelhate M, Gordon D & Lancelin JM (1999) NMR structures and activity of a novel a-like toxin from the scorpion Leiurus Quinquestriatus Hebraeus J Mol Biol 285, 1749– 1763 16 Gilles N, Blanchet B, Shichor I, Zaninetti M, Lotan I, Bertrand D & Gordon D (1999) A scorpion a-like toxin active on insects and mammals reveals an unexpected specificity and distribution of sodium channel subtypes in rat brain neurons J Neurosci 19, 8730–8739 17 Chen H & Heinemann SH (2001) Interaction of scorpion alpha-toxins with cardiac sodium channels: binding properties and enhancement of slow inactivation J General Physiol 117, 505–518 18 Gilles N, Krimm I, Bouet F, Froy O, Gurevitz M, Lancelin JM & Gordon D (2000) Structural implications on the interaction of scorpion a-like toxins with the sodium channel receptor site inferred from toxin iodination and pH-dependent binding J Neurochem 75, 1735–1745 ` 19 Zilberberg N, Froy O, Loret E, Cestele S, Arad D, Gordon D & Gurevitz M (1997) Identification of structural elements of a scorpion alpha-neurotoxin important for receptor site recognition J Biol Chem 272, 14810– 14816 20 Ye X, Bosmans F, Li C, Zhang Y, Wang DC & Tytgat J (2005) Structural basis for the voltage-gated Na channel selectivity of the scorpion a-like toxin BmK M1 J Mol Biol 353, 788–803 21 Krimm I, Volpon L & Lancelin JM (2002) Redundant peptidic isomerisms revealed by NMR of animal toxins In Toxines et Recherches Biome´dicales (Goudey-Perriere F Bon C Puiseux-Dao S & Sauviat MP, eds), pp 183– 192 Elsevier, Paris ´ 22 Legros C, Ceard B, Vacher H, Marchot P, Bougis PE & Martin-Eauclaire MF (2005) Expression of the standard scorpion alpha-toxin AaH II and AaH II mutants leading to the identification of some key bioactive elements Biochim Biophys Acta 1723, 91–99 23 He XL, Li HM, Zeng ZH, Liu XQ, Wang M & Wang DC (1999) Crystal structures of two alpha-like scorpion toxins: non-proline cis peptide bonds and implications for new binding site selectivity on the sodium channel J Mol Biol 292, 125–135 24 Darbon H, Jover E, Couraud F & Rochat H (1983) Alpha-scorpion neurotoxin derivatives suitable as potential markers of sodium channels Preparation and characterization Int J Pept Protein Res 22, 179–186 FEBS Journal 274 (2007) 1918–1931 ª 2007 The Authors Journal compilation ª 2007 FEBS I Karbat et al 25 Fontecilla-Camps JC, Habersetzer-Rochat C & Rochat H (1988) Orthorhombic crystals and three-dimensional structure of the potent toxin II from the scorpion Androctonus australis Hector Proc Natl Acad Sci USA 85, 7443–7447 26 Moran Y, Cohen L, Kahn R, Karbat I, Gordon D & Gurevitz M (2006) Expression and mutagenesis of the sea anemone toxin Av2 reveals key amino acid residues important for activity on voltage-gated sodium channels Biochemistry 45, 8864–8873 27 Norton RS (1991) Structure and structure–function relationships of sea anemone proteins that interact with the sodium channel Toxicon 29, 1051–1084 28 Blumenthal KM & Seibert AL (2003) Voltage-gated sodium channel toxins: poison, probes, and future promise Cell Biochem Biophys 38, 215–238 29 Noble CG, Hollingworth D, Martin SR, EnnisAdeniran V, Smerdon SJ, Kelly G, Taylor IA & Ramos A (2005) Key features of the interaction between Pcf11 CID and RNA polymerase II CTD Nat Struct Mol Biol 12, 144–151 30 Froy O, Zilberberg N, Gordon D, Turkov D, Gilles N, Stankiewicz M, Pelhate M, Loret E, Oren D, Shaanan B et al (1999) The putative bioactive surface of insectselective scorpion excitatory neurotoxins J Biol Chem 274, 5769–5776 31 Cohen L, Karbat I, Gilles N, Ilan N, Gordon D & Gurevitz M (2005) Common features in the functional surface of scorpion b-toxins and elements that confer specificity for insect and mammalian voltage-gated Nachannels J Biol Chem 280, 5045–5053 32 Pease JH, Storrs RW & Wemmer DE (1990) Folding and activity of hybrid sequence, disulfide-stabilized peptides Proc Natl Acad Sci USA 87, 5643–5647 33 Reed L & Muench H (1938) A simple method of estimating fifty-percent endpoint Am J Hyg 27, 493–497 a-Like toxin binding is linked to its flexibility 34 Rochat C, Tessier M, Miranda F & Lissitzky S (1977) Radioiodination of scorpion and snake neurotoxins Anal Biochem 82, 532–548 35 Gershon E, Weigl L, Lotan I, Schreibmayer W & Dascal N (1992) Protein-kinase A reduces voltagedependent Na+ current in Xenopus oocytes J Neurosci 12, 3743–3752 36 Wallner M, Weigl L, Meera P & Lotan I (1993) Modulation of the skeletal muscle sodium channel a-subunit by the b1-subunit FEBS Lett 336, 535–539 37 Shichor I, Zlotkin E, Ilan N, Chikashvili D, Stuhmer W, Gordon D & Lotan I (2002) Domain of Drosophila Para voltage-gated sodium channel confers insect properties to a rat brain channel J Neurosci 22, 4364– 4371 38 Jurman ME, Boland LM & Yellen G (1994) Visual identification of individual transfected cells for electrophysiology using antibody-coated beads Biotechniques 17, 876–881 39 Guex N & Peitsch MC (1997) swiss-model and the swiss-pdbviewer: an environment for comparative protein modeling Electrophoresis 18, 2714–2723 ` 40 Hamon A, Gilles N, Sautiere P, Martinage A, Kopeyan C, Ulens C, Tytgat J, Lancelin JM & Gordon D (2002) Characterization of scorpion a-like toxin group using two new toxins from the scorpion Leiurus Quinquestriatus Hebraeus Eur J Biochem 269, 3920– 3933 41 Tugarinov V, Kustanovich I, Zilberberg N, Gurevitz M & Anglister J (1997) Solution structure of a highly insecticidal recombinant scorpion a-toxin and a mutant of increased activity Biochemistry 36, 2414–2424 42 Koradi R, Billeter M & Wuthrich K (1996) molmol: a program for display and analysis of macromolecular structures J Mol Graph 14, 29–32 FEBS Journal 274 (2007) 1918–1931 ª 2007 The Authors Journal compilation ª 2007 FEBS 1931 ... unrelated to the pH dependence of Lqh3 To test the possibility that the pH-dependent binding of Lqh3 is associated with protonation of surface histidines [18], we examined the effects of toxin mutants... explain its relatedness with the pH dependency Lqh3 pH-dependent binding is associated with the conformational flexibility of the C-tail Inspection of Lqh3 solution structure reveals that the C-terminal... (Table 2) Dissociation of the toxin- receptor complex and the slow association kinetics of Lqh3 are linked to the flexibility of the C-tail The substantial decrease in the sensitivity of binding