Transcriptional activity and Sp 1⁄3 transcription factor binding to the P1 promoter sequences of the human AbH-J-J locus Giordana Feriotto1, Alessia Finotti2, Giulia Breveglieri1, Susan Treves3, Francesco Zorzato4 and Roberto Gambari2 Biotechnology Center, University of Ferrara, Italy Department of Biochemistry and Molecular Biology, Section of Molecular Biology, University of Ferrara, Italy Departments of Anaesthesia and Research, Kantonsspital, Basel, Switzerland Department of Experimental and Diagnostic Medicine, Section of General Pathology, University of Ferrara, Italy Keywords aspartyl (asparaginyl) b-hydroxylase; humbug; junctate; specific transcription factors; transcription Correspondence R Gambari, Department of Biochemistry and Molecular Biology, University of Ferrara, Via Borsari 46, 44100 Ferrara, Italy Fax: +39 532 202723 Tel: +39 532 424443 E-mail: gam@unife.it (Received 22 May 2007, revised 29 June 2007, accepted July 2007) doi:10.1111/j.1742-4658.2007.05976.x Alternative splicing of the locus AbH-J-J generates functionally distinct proteins: the enzyme aspartyl (asparaginyl) b-hydroxylase, humbug and junctate (truncated homologs of aspartyl (asparaginyl) b-hydroxylase with a role in calcium regulation), and junctin (a structural protein of the sarcoplasmic reticulum membrane) Aspartyl (asparaginyl) b-hydroxylase and humbug are overexpressed in a broad range of malignant neoplasms We have previously reported the gene structure of this locus, showing the presence of two putative promoters, P1 and P2, and characterized the P2 sequences, directing tissue-specific transcription of junctin, aspartyl (asparaginyl) b-hydroxylase and junctate In addition, aspartyl (asparaginyl) b-hydroxylase and humbug are expressed from exon by the P1 promoter The present study identifies and functionally characterizes the P1 promoter activity of the AbH-J-J locus We demonstrate that mRNAs from the P1 promoter are actively transcribed in all the human tissues and cell lines analyzed, and define the transcription start point in HeLa and RD cells To investigate the transcription mechanism we cloned 1.7 kb upstream of exon from a human BAC clone, and produced progressively deleted reporter constructs Our results showed that: (a) the 1.7 kb fragment was a powerful activator of the reporter gene in human hepatoblastoma (HepG2) and human embryonic rhabdomyosarcoma (RD) cell lines; (b) 512 bp upstream of the transcription start site were essential for maximal promoter activity; and (c) progressive deletions from ) 512 resulted in gradually decreased reporter expression The region responsible for maximal transcription contains at least 12 GC boxes homologous to binding sequences of specific transcription factor (Sp1); by electrophoretic mobility shift assay and supershift analysis, we identified three GC-rich elements that bind Sp transcription factor family nuclear factors with very high efficiency A functional role of Sp transcription factors in upregulating P1directed transcription was demonstrated by analysis of the effects of: (a) in vitro mutagenesis of the Sp1 transcription factor binding sites; (b) transfection with Sp transcription factor ⁄ expression vectors; and Abbreviations AAH, aspartyl (asparaginyl) b-hydroxylase; ChIP, chromatin immunoprecipitation; EMSA, electrophoretic mobility shift assay; MEF-2, myocyte enhancer factor 2; Sp1, specific transcription factor 1; Sp3, specific transcription factor 3; TF, threshold fluorescence; TFD, transcription factor decoy 4476 FEBS Journal 274 (2007) 4476–4490 ª 2007 The Authors Journal compilation ª 2007 FEBS G Feriotto et al Sp regulation of the AbH-J-J locus P1 promoter (c) treatment with decoy oligonucleotides targeting Sp transcription factors In addition, Sp1 and Sp3 transcription factor chromatin immunoprecipitation demonstrated in vivo binding of these proteins to P1 promoter Our results suggest that Sp transcription factors positively regulate the core of the P1 promoter, and the comparison of the two promoters of the AbH-J-J locus demonstrates that they are very different with regard to transcriptional efficiency and ability to direct tissue-specific transcription We have previously characterized the human AbH-J-J locus, a genomic sequence that generates functionally distinct proteins [1] In addition to the enzyme aspartyl (asparaginyl) b-hydroxylase (AAH), this locus encodes junctin, a structural protein of the sarcoplasmic reticulum, and the truncated homologs of AAH, the Ca2+binding proteins humbug and junctate [1,2] AAH catalyzes post-translational hydroxylation of aspartate and asparagine residues in certain epidermal growth factor-like domains present in a number of proteins, including receptors and receptor ligands, involved in cell growth and differentiation, as well as extracellular matrix molecules [3] AAH, mediating cell motility and invasiveness, is of interest because of its role in placental implantation and ‘receptivity’ of endometrium [4] Humbug is a truncated homolog of AAH that lacks a catalytic domain Overexpression of humbug increases intracellular Ca2+ levels by promoting its release from intracellular stores [5] The levels of humbug immunoreactivity are directly associated with colon cancer tumor grade and inversely associated with patient survival [5] AAH and ⁄ or humbug are overexpressed in infiltrative intrahepatic cholangiocarcinomas, metastasized lung, breast, and colon, hepatocellular carcinomas, and malignant neuroectodermal tumors [6–10] These proteins can contribute to the malignant phenotype by increasing motility and enhancing proliferation, survival, and cell cycle progression Inhibition of AAH expression and its truncated homolog could represent an attractive approach for gene therapy of infiltrating tumors [3,10] Junctate is an integral Ca2+-binding protein of the sarco(endo)plasmic reticulum membrane that forms a supramolecular complex with the inositol 1,4,5-trisphosphate receptor and modulates Ca2+ entry through receptor- and store-activated channels [1,11,12] Our group previously reported the identification of two putative promoter sequences, present within the human AbH-J-J locus (named P1 and P2), that are expected to regulate the transcription of this locus [1,13] The generated primary transcripts are subjected to alternative splicing and direct the synthesis of AAH, humbug, junctin, and junctate [1,13] We have recently reported the characterization of the P2 promoter, demonstrating that the myocyte enhancer factor (MEF-2) transcription factor binds this promoter sequence and drives tissue-specific expression, being responsible for inducing transcription during muscle differentiation [1,13] As little is known, to date, about the role of the P1 promoter, in this work we focused our attention on this regulating sequence To characterize the expression directed by the P1 promoter, we analyzed the corresponding mRNAs in different human tissues and cell lines Furthermore, transfections of human hepatoblastoma (HepG2) and human embryonic rhabdomyosarcoma (RD) cells with progressively deleted reporter constructs of the 1.7 kb DNA sequence upstream of exon were performed, and P1 promoter sequences were characterized by analyzing the transcriptional activity of each fragment As several homologies to specific transcription factor (Sp1)-binding sites were found, by computer-assisted analysis, within the promoter sequence exhibiting maximal transcriptional activity, the interactions of these GC-rich elements with factors belonging to the Sp1 family were studied by electrophoretic mobility shift assay (EMSA) [14,15] Molecular interaction studies were also performed in vitro by supershift assays, and in intact cells by chromatin immunoprecipitation (ChIP) Functional assays were performed by in vitro mutagenesis of the Sp1-binding sites, by cotransfection with Sp1 ⁄ Sp3 expression vectors, and by cell treatment with decoy oligonucleotides targeting Sp transcription factors Results Transcriptional organization of the human AbH-J-J locus and identification of the transcription initiation sites proximal to the P1 promoter The structural organization of the human AbH-J-J locus is shown in Fig The scheme presented is based both on results previously reported in detail elsewhere [1,13] and on newly performed studies employing RT-PCR The combination of data obtained by PCR FEBS Journal 274 (2007) 4476–4490 ª 2007 The Authors Journal compilation ª 2007 FEBS 4477 Sp regulation of the AbH-J-J locus P1 promoter G Feriotto et al Fig Structure of the 5¢-end of the human locus for AAH, junctin, junctate, and humbug Arabic numbers over black boxes indicate exons Intervening sequences are indicated by Roman numerals The two putative promoters P1 and P2 are indicated A schematic representation of AAH, junctin, junctate and humbug exon splicing is given at the bottom of the panel The cytoplasmic, transmembrane, positively charged, Ca2+-binding and catalytic domains are indicated The locations of AUG, stop codons, and poly(A) signals are shown The PstI (P) plasmid subclone of BAC [1] covering the first exon of the locus is also shown amplification and sequencing allowed us to define the splicing events (Fig 1) as well as the structure of the 5¢-region of this locus [1] The data obtained indicate that the use of different splice donors is involved in the generation of protein diversity by alternative splicing (see lower part of Fig 1) [1,2] Furthermore, the P1 promoter sequences direct the expression of these proteins in most human tissues [2,13] The RT-PCR approach presented in Fig 2A shows that by using an exon 1-specific forward primer and an exon 3-specific A B Fig RT-PCR analysis of the transcripts starting from the P1 promoter in adult human tissues or cell lines (A) The exon starting mRNAs of AAH and humbug, the PCR primers and the 134 bp PCR product are represented; gray boxes indicate exons common to the two transcripts (B) Electrophoresis analysis of oligo-dT RTPCR products obtained with the e1F ⁄ e3R primers in the absence of template (a) or in the presence of cDNA from human adult normal tissue (b, pancreas; c, brain; d, adrenal gland; e, liver; f, heart; g, skeletal muscle) or cell line (h, RD; i, HepG2; j, MCF7; k, HeLa; l, Hek293) total RNA M, pUC Mix Marker (Fermentas) 4478 reverse primer, we were able to amplify all the transcripts starting from the P1 promoter (AAH, humbug) We employed this RT-PCR approach to examine samples of total RNA from several human adult tissues, and confirmed by DNA sequencing the fidelity of the PCR products The results obtained from pancreas, brain, adrenal gland, liver, heart and skeletal muscle show that transcription directed from the P1 promoter occurs in all the tissues analyzed (Fig 2B) In contrast, we have previously shown that the expression directed by the P2 promoter is tissue specific, as a high level of transcription is present, in particular, in skeletal muscle, cardiac muscle, and brain [2,13] The P1 promoter directs transcription also in RD, HepG2, human breast cancer (MCF7), human cervix epithelial carcinoma (HeLa) and human embryonic kidney (Hek293) tumor cell lines (Fig 2B) As the transcription start site (TSS) from the P1 promoter has not been previously described, we also performed 5¢-RACE in order to precisely map the origin of transcription Our experiments were performed on 5¢-capped mRNA isolated from HeLa and RD cells As shown in Fig 3A, lanes a and b, a prevalent band is evident following electrophoresis of 5¢-RACE products We cloned the gel-purified PCR products, and their characterized nucleotide sequences (Fig 3B, arrows) allowed mapping of multiple TSSs with differential strength The major TSS, resulting from the stronger band in the PCR gel, was designated + (Fig 3B, larger arrow) The nucleotide sequences located upstream from these TSSs were considered as potential regulatory regions belonging to the P1 promoter FEBS Journal 274 (2007) 4476–4490 ª 2007 The Authors Journal compilation ª 2007 FEBS G Feriotto et al A a b Sp regulation of the AbH-J-J locus P1 promoter M PstI fragment (Fig 1) from the human chromosome BAC clone [1] The PCR-generated fragment spanning from ) 1683 to + 81 with respect to the principal TSS was then inserted into the firefly luciferase reporter vector pGL3-basic, sequenced, and used to generate progressively deleted constructs for transient transfection experiments [13] The reporter constructs (A–M), generated as described in Experimental procedures, are shown on the left side of Fig 4A We then tested the ability of these constructs to drive transcription of luciferase in HepG2 cells and RD cells Promoter activity was expressed as fold induction relative to that of cells transfected with pGL3-basic vector (right side of Fig 4A,B) Our results show that the largest fragment () 1683 ⁄ + 81) exhibited high reporter gene expression in the HepG2 and RD cell lines (the fold induction is about 100 and 45, respectively) Removal of the ) 1683 ⁄ ) 834 sequence significantly increased promoter activity (compare A and E constructs of Fig 4A,B) Further removal of the ) 834 ⁄ ) 512 fragment preserved transcriptional activity to comparable levels in the analyzed cell lines (E–H constructs, Fig 4A,B); however, deletion to nucleotide ) 389 resulted in a significant decrease of luciferase activity (I construct) and, when the sequence was progressively removed to ) 240 and ) 160, reporter expression B P1 transcription initiation sites 183 bp Fig P1 transcription initiation site mapping (A) 5¢-RACE analysis of AbH-J-J locus exon starting transcripts cDNAs, synthesized from HeLa and RD cell total RNA, were amplified with the genespecific e3R primer The nested PCRs were performed with the gene-specific e1R primer, complementary to exon 1, and one-fifth of the reactions, derived from HeLa (a) and RD (b) cells, were analyzed by gel electrophoresis M, pUC Mix Marker (B) Nucleotide sequence of 5¢-RACE products The most represented nested PCR products were gel-purified, cloned and sequenced The principal TSSs are shown by arrows (the stronger TSS was numbered + 1) The gene-specific reverse primer used for the last PCR is underlined, and the translation start site (ATG) is indicated Transcriptional activity of the AbH-J-J P1 promoter To test whether the exon 5¢-flanking sequences have promoter activity, we cloned a 3.1 kb partially digested Relative luciferase activity A +81 -1683 -1289 -1204 -1017 -834 -661 -634 -512 -389 -240 -160 B 50 150 100 200 A B C D E F G H I L M 250 275 HepG2 Relative luciferase activity A B C D E F G H I L M 50 100 C 6,212,5 Relative luciferase activity 25 50 100 -512/+81 P1 sequences (H) -265/+115 P2 sequences RD RD Fig AbH-J-J P1 promoter activity in HepG2 and RD cell lines (A) HepG2 cells were transiently transfected with sequentially deleted reporter constructs of the ) 1683 ⁄ + 81 P1 nucleotide sequence (represented on the left side of the figure, A–M) Transient transfection and luciferase assays were performed in triplicate; the data (right side of the figure) were normalized to Renilla luciferase activity, and are shown as relative activities compared to that for pGL3-basic, a reporter vector with a basal promoter The values are the means ± SD of at least three independent experiments (B) The same procedure as in (A) was performed with the RD cell line (C) AbH-J-J P1 and P2 promoter activity in the RD cell line Cells were transiently transfected with the reporter constructs that present the maximal transcriptional activity of each promoter [13] FEBS Journal 274 (2007) 4476–4490 ª 2007 The Authors Journal compilation ª 2007 FEBS 4479 Sp regulation of the AbH-J-J locus P1 promoter G Feriotto et al A Fig DNA sequence of the AbH-J-J P1 promoter region (A) ) 512 ⁄ + 112 P1 promoter and 5¢-UTR sequences Solid and dashed lines indicate the oligonucleotides used in EMSA (Table 1) The sequences homologous to Sp1 transcription factor-binding site are boxed; the percentage homology was obtained with TF SEARCH version 1.3 Arrows indicate the characterized transcription initiation sites The 5¢-end nucleotide positions of the progressively deleted promoter sequence present in the reporter constructs are shown in gray (B) Schematic representation of the ) 512 ⁄ + 112 region of the P1 promoter Elements homologous to the Sp1-binding site are indicated by boxes, the nucleotide deletions of reporter constructs are shown in gray B gradually decreased (L and M constructs) In conclusion, our findings indicate that 512 bp upstream of the TSS are essential for maximal promoter activity, and deletions to ) 389, ) 240 and ) 160 resulted in progressive reduction of transcription to about 75%, 40%, and 7%, respectively In addition, when we compared the maximal activities of P1 and P2 promoter sequences in inducing transcription of RD cells, the fold inductions were dramatically different, the P1 promoter being 16-fold more active (Fig 4C) It should be underlined that the P1 promoter sequences not share homology regions and signals for transcription factors with the P2 promoter For instance, no MEF-2-binding sites are present within the P1 promoter; this finding is of interest, when related to the different tissue specificities of these two promoters [1,13,16] Identification of GC boxes within the ) 512 ⁄ + 33 AbH-J-J P1 promoter region Sequence analysis of the region required for maximal expression from the P1 promoter was performed using the tfsearch program Looking for homology to 4480 known signals for transcription factors and imposing an 80% threshold, we identified within the ) 512 ⁄ + 33 region at least 12 GC-rich boxes similar to the Sp1 consensus binding sequence (Fig 5A) The location of these putative Sp1-binding sites within the P1 promoter sequence is shown in Fig 5A,B, together with the transcription initiation sites and the ATG signal As the region responsible for maximal P1 promoter transcription contains GC-rich elements (H construct, Fig 4), we concentrated our attention on the activity of binding of nuclear extract to these boxes Binding of nuclear factors to GC-rich boxes of the AbH-J-J P1 promoter In order to study protein–DNA interactions and further characterize the transcription factors involved, we performed competitive EMSA [13] Table and Fig 5A show the synthetic oligonucleotides used for the bandshift experiments The results obtained using lg of HepG2 cell nuclear extract and the 32P-labeled Sp1mer double-stranded oligonucleotide, which contains the consensus-binding site for Sp1 transcription factor, are shown in Fig 6A [17,18] The probe FEBS Journal 274 (2007) 4476–4490 ª 2007 The Authors Journal compilation ª 2007 FEBS G Feriotto et al Sp regulation of the AbH-J-J locus P1 promoter Table Double-stranded synthetic oligonucleotides Sequences (5¢- to 3¢)a Amplified region Oligonucleotides used for EMSA – Sp1merb F ⁄ Gmer – F ⁄ Gmut – H ⁄ Imer – Kmer – Lmer – D ⁄ Emer – D ⁄ Emut – Jmer – MyDmerc – Q-PCR primers P1 ChIP F P1 promoter AbH-J-J P1 ChIP R Neg ChIP F Negative control region Neg ChIP R e1 F From exons to of AbH-J-J transcripts e5 R HMBS F HMBS mRNAd (housekeeping gene) HMBS R a c CCCTTGGTGGGGGCGGGGCCTAAGCTGCG CCTTCCGGGGGCGGGGCGAGGCCGGGA CCTTCCTGGTTCGTAGCTAGTCCTGGA CGGGAAGGGGCGTGGCCGTCGGGCGGCGAGCC GTGCTGCAGGCGGTGCTGAGGCA TCCAGCGGCCCGCCGCCGCCAG GTGAGCAGGGGCGGGGAGCGCGGCAGGGTACCGC GTGAGCATAGTCGTAGAGCATGGTAGAGTACCGC TACACGCGAGGCCGGGCGCGCGCA CCCCCCAACACCTGCTGCCTGA ACGTTTGCCACGTTCCAAAGGA ACGAACCTGTGACTCCCTCCCG TGTGTGATTTCCCGTCAACTGTC CCAGCCTCTTCCATTGGATACAA CAAGAGCAGCGGCAACAG AATAAAACTTTGGCATCATCCACTCAAAATCTCC GAACATGCCCTGGAGAAGAATGA GGTAGCCTGCATGGTCTCTTGTAT Nucleotide mutations are underlined b The oligonucleotide containing the Sp1 site was purchased from Geneka (Montreal, Canada) Feriotto et al [13] d HMBS, hydroxymethylbilane synthase interacts with nuclear proteins producing the three retarded complex pattern typical of transcription factors belonging to the Sp family A high-mobility band and two overlapping low-migrating bands (Fig 6A, lane 1) are generated As expected, a 100-fold excess of unlabeled Sp1mer oligonucleotide completely abolished sequence-specific interactions of the nuclear proteins with the probe (Fig 6A, lane 2) Competitive experiments performed using unlabeled oligonucleotides containing the previously identified GC-rich boxes of the P1 promoter region (Table 1) demonstrated that F ⁄ Gmer, H ⁄ Imer and D ⁄ Emer interfere with the formation of the three complexes (Fig 6A, lanes 3, and 7) These results suggest that the last three oligonucleotides contain binding elements recognized by Sp family transcription factors [19] On the other hand, competitive bandshift demonstrated that the three Sp bands were only slightly reduced by Kmer and Lmer (Fig 6A, lanes and 6), whereas Jmer did not decrease the abundance of the Sp-specific complexes (Fig 6A, lane 8) To better characterize the binding efficiency of the oligonucleotides under investigation, we performed bandshift with the same probe and different fold molar excesses of competitors (Fig 6B,C) As observed for Sp1mer (Fig 6B, lane 10), the three complexes were completely disrupted by a six-fold molar excess of unlabeled H ⁄ Imer (Fig 6B, lane 15), whereas the same excess of F ⁄ Gmer decreased the binding to about 5% of the control in the absence of competitor (Fig 6B, lane 12) Furthermore, the competition with 50-fold molar excess of unlabeled D ⁄ Emer, Kmer and Lmer decreased the interactions to 12%, 60% and 75% of the control, respectively (Fig 6C, lanes 20, 22 and 24), whereas Jmer competitor was not active even if used at 100fold molar excess (Fig 6C, lane 26) To further confirm whether the previously identified GC-rich P1 sequences are able to bind Sp family transcription factors, we performed bandshift assays using as probe the oligonucleotides under investigation, which generated the same complex migration profile obtained with labeled Sp1mer Figure 6D shows an example of the interactions of nuclear extracts with H ⁄ Imer probe As expected from our previous assays, the three complexes were completely disrupted by an excess of the competitors Sp1mer, F ⁄ Gmer and H ⁄ Imer (Fig 6D, lanes 28–33), but not by Jmer or the unrelated oligonucleotide MyDmer (Fig 6D, lanes 34 and 35) [13] Supershift with Sp1 and Sp3 transcription factor antisera In order to obtain the formal demonstration of an involvement of Sp-related proteins in molecular interactions at the P1 promoter, supershift experiments FEBS Journal 274 (2007) 4476–4490 ª 2007 The Authors Journal compilation ª 2007 FEBS 4481 Sp regulation of the AbH-J-J locus P1 promoter 10 11 er r r – Im me er er Em F/G Sp 1m e Competitor Jm D/ er F/G me r H/ Im er Km er Lm er Sp 1m Competitor – Sp1mer Probe H/ Sp1mer Probe G Feriotto et al 12 13 14 15 16 17 12 fold molar excess of competitor 12 25 12 25 Sp1/3 Sp3 Sp1/3 * Sp3 * 23 24 25 26 er r Sp 1m e 31 32 33 34 35 fold 25 50 25 molar excess of competitor 50 25 50 100 100 28 29 Jm H/ Im e 30 – 27 F/G m er Jm Lm er er 22 M yD m 21 er 20 Km Em e er H/ 19 D/ Im – 18 H/Imer er Probe Competitor Sp1 mer r Competitor Probe B r 100 fold molar excess of competitor A Sp1/3 Sp3 C fold 50 50 100 molar excess of competitor 50 100 50 100 100 D were performed using the previously identified GC-rich boxes As shown in the representative experiment reported in Fig 7A, antibodies against Sp1 (lane 2) and Sp3 (lane 3) transcription factors supershifted the specific complexes, indicating that these proteins are able to bind in vitro to P1 promoter sequences of the AbH-J-J gene locus ChIP assay In order to verify whether the binding of Sp1 and Sp3 proteins to the AbH-J-J P1 promoter occurs in intact cells, ChIP was performed HeLa cells were fixed, chromatin was immunoprecipitated with antibodies against Sp1 or Sp3 transcription factors, and quantitative real-time PCR was performed on recovered DNA using primers amplifying a P1 promoter region of the AbH-J-J gene locus that contains the previously characterized Sp1-d ⁄ e, Sp1-f ⁄ g and Sp1-h ⁄ i boxes (Fig 5B) As an immunoprecipitation control, nonimmune rabbit serum or unrelated antisera, of the same isotype, recognizing MEF-2A and myogenin were 4482 Fig AbH-J-J promoter P1 elements homologous to the Sp1 box bind HepG2 nuclear factors EMSAs were carried out on lg of HepG2 nuclear extracts as described in Experimental procedures, using Sp1mer (A–C) or H ⁄ Imer (D) probe (Table 1) –, probe was incubated with nuclear extracts in the absence of competing oligonucleotides The fold molar excess of the added competitor (Table 1) is reported at the bottom of each panel Arrows and asterisks indicate the specific and nonspecific complexes, respectively used Figure 7B shows a representative example of amplification curves (in duplicate determinations) obtained by SYBR Green real-time PCR The data demonstrate that HeLa chromatin immunoprecipitated using Sp1 or Sp3 antiserum reaches the ‘threshold fluorescence’ (TF) value about six cycles before nonimmune serum ChIP samples The results obtained with ChIP performed with antibodies against MEF-2A (Fig 7B) and myogenin (data not shown) are similar to those of immunoprecipitation controls obtained using nonimmune rabbit serum PCR was also performed using control primers flanking a genomic region about kb upstream of the P1 promoter (Table 1) Because this sequence, lacking Sp1-binding sites, should not be bound by Sp factors, PCR with the negative control primers was used to normalize quantitative results from different immunoprecipitations For data analysis, we followed the methodology described in Experimental procedures Normalized results, reported in Fig 7C, indicate mean increases in amplification signal of 13-fold (Sp1 ChIP) and 22-fold FEBS Journal 274 (2007) 4476–4490 ª 2007 The Authors Journal compilation ª 2007 FEBS G Feriotto et al Sp regulation of the AbH-J-J locus P1 promoter B D/Emer p1 p3 -S Ab -S – Ab Antibody Probe Sp1/3 Sp3 Relative Fluorescence Units A 103 P1 promoter Q PCR MEF2A ChIP Input 102 Sp1 ChIP Sp3 ChIP TF 101 Nonimmune serum ChIP 16 18 20 22 24 26 28 30 32 34 36 38 Cycle number Fold increase over negative control PCR C Sp1 ChIP 7.5 10 12.5 Negative control P1 promoter Sp3 ChIP 2.5 15 20 25 Negative control * P1 promoter * Fig Interaction of Sp1 and Sp3 transcription factors with the AbH-J-J P1 promoter (A) A supershift assay was performed using D ⁄ Emer probe and lg of nuclear extract from HeLa cells; the probe was incubated with nuclear exctract in the presence of antibodies (Ab) against Sp1 or Sp3 factors –, control sample in the absence of antibody Arrows and stars indicate the specific and supershifted complexes, respectively (B) Quantitative real-time PCR profiles for the amplification of the P1 promoter are shown for a representative ChIP assay in which chromatin from HeLa cells was immunoprecipitated using either Sp1 and Sp3 antiserum The data (from duplicate determinations) demonstrate the early exponential increase in fluorescence as a result of SYBR Green I incorporation into the amplifying P1 promoter fragment Sp1 ChIP, Sp3 ChIP and MEF-2A ChIP indicate duplicate curves from chromatin that have been immunoprecipitated with Sp1, Sp3 or MEF2A antiserum, respectively; nonimmune serum indicates curves from immunoprecipitations with nonimmune rabbit serum Input represents curves obtained from HeLa chromatin (1%) before immunoprecipitation The cycle at which the amplification curve reaches threshold fluorescence (TF), the threshold cycle, were used to determine the relative amounts of promoter in each sample (C) In vivo association of Sp1 and Sp3 transcription factors with the AbH-J-J P1 promoter The results, obtained from ChIP assay quantitative real-time PCR using Sp1 (Sp1 ChIP) or Sp3 (Sp3 ChIP) antiserum, were analyzed following the methodology described in Experimental procedures The fold increase over negative control PCR in each case compares the values obtained by P1 promoter amplification with the corresponding amplification of a distal genomic region lacking Sp1-binding sites All data represent the mean of two determinations in triplicate from each of at least two independent immunoprecipitations The asterisk indicates that the value is significantly different (P < 0.05) from the control value (Sp3 ChIP) when PCR was performed with P1 promoter-specific primers relative to PCR products obtained with negative control primers These data strongly indicate that transcription factors belonging to the Sp1 superfamily interact with the P1 promoter in intact HeLa cells Effects of mutations of Sp1-binding sites on P1-directed transcription In order to verify the role of Sp1-binding sites in P1directed transcription, we first designed D ⁄ Emut and F ⁄ Gmut mutant oligonucleotides (Table 1) that are unable to bind the Sp family factors We demonstrated that mutated D ⁄ Emut and F ⁄ Gmut failed to disrupt D ⁄ Emer–Sp protein complexes (Fig 8A, lanes and 5) In agreement with this, no retarded bands were generated following incubation of nuclear factors with D ⁄ Emut and F ⁄ Gmut probes (Fig 8B, lanes and 8) Accordingly, we produced, starting from the wild-type reporter construct (H, ) 512 ⁄ + 81), two plasmids carrying the previously characterized Sp1-binding site mutations (d ⁄ e mut and f ⁄ g mut) When the mutant constructs were used to transfect HeLa cells, 22% and 12% decreases in luciferase activity (relative to the wild-type H construct) were detected (Fig 8C) As expected, when transfection was performed with the double mutant construct (d ⁄ e + f ⁄ g mut), a further decrease of transcription activity was consistently found () 32%) These results demonstrate that mutations of Sp1-binding sites lead to a decrease of transcription activity, suggesting a functional role of Sp1 in promoting P1-directed transcription of the AbH-J-J gene locus FEBS Journal 274 (2007) 4476–4490 ª 2007 The Authors Journal compilation ª 2007 FEBS 4483 – D/ Em et D/ Em ut F/ Gm ut G Feriotto et al Sp1/3 Sp3 Sp1/3 Sp3 C 50 Relative Luc Activity 75 100 H (-512/+81) d/e mut f/g mut d/e + f/g mut pPac pPac Sp1 pPac Sp3 pPac Sp1/Sp3 Relative Luc Activity (fold increase) 0.5 1.5 2.5 + 45% + 45% + 130% Fig Cotransfection of Drosophila SL2 cells with the P1 promoter reporter construct and the Sp1 and ⁄ or Sp3 expression vectors Drosophila SL2 cells were cotransfected with ) 512 ⁄ + 81 P1 promoter reporter construct (H) in the presence of Sp1 (pPac Sp1) and ⁄ or Sp3 (pPac Sp3) expression vectors The pPAC void vector was used as cotransfection control plasmid Results (mean ± SD) are presented as fold increase in luciferase activity for cotransfection over that for the promoter construct alone (pPAC) from three experiments, each performed in triplicate Effect of a decoy oligonucleotide targeting Sp family transcription factors on P1 promoterspecific mRNA levels Fig Mutational analysis of Sp1 elements in the AbH-J-J P1 promoter (A–B) EMSAs were performed using D ⁄ Emer probe or mutant probes (D ⁄ Emut, F ⁄ Gmut) and lg of nuclear extract from HepG2 cells Probes were incubated with nuclear extracts in the absence or in the presence (A) of 100-fold molar excess of competing oligonucleotides (Table 1) Arrows indicate the specific complexes (C) HepG2 cells were transfected with wild-type H () 512 ⁄ + 81), single mutant Sp1-d ⁄ e element (d ⁄ e mut) and Sp1-f ⁄ g element (f ⁄ g mut) or double mutant (d ⁄ e + f ⁄ g mut) AbH-J-J P1 promoter reporter constructs Transient transfection and luciferase assay were performed in triplicate, and the data were normalized to Renilla luciferase activity and reported as ratios (means ± SD) to the wild-type reporter construct H Transcriptional effect of Sp1 and Sp3 expression vectors on P1 promoter activity More functional evidence for the involvement of Sp1-related proteins in P1-directed transcription was obtained after cotransfection of Drosophila melanogaster SL-2 cells with the H () 512 ⁄ + 81) reporter construct and pPAC-Sp1 and pPAC-Sp3 expression vectors As control, SL-2 cells were cotransfected with pPAC empty vector The SL-2 cells were chosen because they not contain Sp proteins [20] and are, for this reason, employed in functional studies focused on these transcription factors The results obtained indicate a significant increase of P1-directed transcription in SL-2 cells transfected with pPAC-Sp1 and pPAC-Sp3 (Fig 9, + 45%) These data suggest that Sp1 and Sp3 proteins play a positive role in P1-directed transcription In agreement with this, triple transfection of SL-2 cells with the H reporter construct, and the pPAC-Sp1 and pPAC-Sp3 expression vectors, produced higher levels of P1-directed transcription (Fig 9, + 130%) 4484 H (-512/+81) reporter construct et D/ Em Competitor B D/Emer Probe D/ Em er F/ Gm er F/ Gm ut A Probe Sp regulation of the AbH-J-J locus P1 promoter In order to further confirm the role of Sp1-related proteins in the transcription regulation of the AbH-J-J locus, a transcription factor decoy (TFD) approach was employed This approach is based on the use of double-stranded oligonucleotides for targeting transcription factors, with consequent inhibition of their interactions with promoters The TFD approach has been demonstrated to be very useful in inhibiting gene expression when targeted at key transcription factors [21] We employed as a TFD molecule the doublestranded oligonucleotide Sp1mer reported in Table Briefly, we transfected HeLa cells with lgỈmL)1 of Sp1mer double-stranded oligonucleotide, or a scrambled sequence of the same length as a control Twentyfour hours later, RNA extraction was performed and the transcripts relative to P1 promoter activity were analyzed by using quantitative real-time RT-PCR The results obtained demonstrate that in cells treated with the Sp1 decoy, a 64% reduction of transcription directed by the P1 promoter was obtained (Fig 10) In contrast, scrambled oligonucleotide exibited no effects on transcription of the analyzed mRNA (Fig 10) Discussion The aim of the present work was to investigate in detail one of the two putative promoter sequences regulating the transcription of the AbH-J-J locus [1,13] We isolated and identified the 5¢-flanking region of exon of this locus The cloned nucleotide sequence allowed us to characterize the P1 promoter region, which is involved in the regulation of AAH and humbug expression We have been able to identify transcripts relative to P1 promoter activity in all tissues and cell lines analyzed [2,13,16] Similar to many housekeeping gene FEBS Journal 274 (2007) 4476–4490 ª 2007 The Authors Journal compilation ª 2007 FEBS G Feriotto et al Sp regulation of the AbH-J-J locus P1 promoter Relative mRNA content 0.25 0.5 0.75 0.1 1.25 1.5 - ODN Scramble ODN Sp1 ODN * Fig 10 Effect of decoy oligonucleotide targeting of Sp transcription factors on P1 promoter-specific mRNA levels HepG2 cells were transiently transfected with Sp1mer double-stranded decoy oligonucleotide (Sp1 ODN, Table 1) for 24 h or remained untreated (– ODN) The effect of scrambled, unrelated oligonucleotide (Scramble ODN) is also reported The cDNA obtained from total RNA was subjected to quantitative real-time PCR for P1 promoter-specific transcripts Results are representative of three independent experiments carried out in triplicate; the DDCt method was used to compare gene expression data, and standard error of the mean was calculated Statistical significance: *P < 0.05 promoters, the region under investigation lacks a TATA box and an initiator element [22,23] In contrast, this sequence is GC-rich and presents homologies with the Sp1 consensus binding site, in agreement with previous studies showing that the transcription of other TATAless promoters frequently involves the action of proximal Sp1 sites [24,25] The mapping of the initiation of transcription using 5¢-RACE revealed the presence of different TSSs located around position ) 110 relative to the translation initiation start in HeLa and RD cells We found, upstream of exon 1, cis-elements with negative and positive effects on transcription Furthermore, the maximal promoter is located within 512 nucleotides of the principal TSS Computer analysis indicates the presence of at least 12 sites that match the structural determinants of Sp1-binding specificity, and the screening by EMSA demonstrated three GC-rich elements that bind, with high efficiency, transcription factors belonging to the Sp family [14,15] The migration profiles of the complexes produced by nuclear extracts binding to our GC-rich elements resemble the wellknown electrophoresis pattern obtained with the consensus binding site for Sp1 [17–19] Sp1 is a ubiquitous DNA-binding protein that activates the transcription of many cellular and viral genes [26,27] Other transcription factors, Sp2–Sp6, have been described that have similar structural properties and DNA-binding specificities as Sp1 [14,15] Sp1 and Sp3 are the major DNA-binding constituents observed in nuclear extracts with Sp1 consensus element in EMSA [28] The actions of Sp1 and Sp3 at a given promoter appear to be complex, but, in many cases, expression of Sp3 is thought to antagonize the stimulatory actions of Sp1 on gene transcription [29,30] Moreover, Sp3 can act as an activator or repressor of Sp1-mediated activation, depending on the sequence context and the availability of specific coactivators, corepressors or other transcription factors [27,28] The involvement of Sp1 ⁄ Sp3 binding was confirmed by supershift experiments and ChIP assays The effect of the Sp proteins on transcription can be influenced by multiple factors, including phosphorylation, redox state, and acetylation [31] The first conclusion of the present article is that the P1 promoter of the AbH-J-J locus contains Sp1 cis-acting motifs that are putatively involved in the extensive transcription directed by this promoter The second conclusion is that these interactions are functionally relevant for transcriptional control The relevance of Sp1- and Sp3-binding sites for the transcription regulation of the P1 promoter of the AbH-J-J locus has been addressed with three complementary approaches: (a) mutagenesis of Sp1 elements; (b) transfection of Sp-null SL-2 cells with Sp1 ⁄ expression vectors; and (c) use of a TFD approach targeting Sp factors The results obtained also demonstrate that Sp1 transcription factors and Sp1-binding sites are involved in the upregulation of the P1 promoter of the human AbH-J-J gene locus Although our results not conclusively show the involvement of other factors in the transcription of the AbH-J-J locus, we demonstrate that some of the Sp1-binding activities are important for transcription directed by the P1 promoter When the P1 and P2 promoter sequences of the AbH-J-J locus are compared, important differences are clearly detectable [13,16] The most interesting result emerging from studies focused on the P2 promoter is that the Ca2+-dependent transcriptional factor MEF-2 activates the transcription of junctin, junctate and AAH in muscular tissues and brain [13] No Sp1-binding sites are present in the P2 promoter In contrast, the P1 promoter directs the expression of AAH and humbug in many tissues and contains several functionally active Sp1-binding sites [1,2,13] The finding that the sequences present in the upstream P1 promoter are significantly different from those of the P2 promoter is, in our opinion, of great interest In addition, our data not exclude a concerted regulation of the two promoter sequences based on interactions between different transcription factors There is strong evidence demonstrating that transcription factors belonging to the Sp1 family interact with other transcription factors, including some proteins binding to the P2 promoter [13,32,33] For instance, physical interactions between Sp1 and MEF-2 have been demonstrated in DNA-binding complexes formed in vitro by nuclear extracts [34] An intriguing possibility to be further analyzed is the generation of a looping structure directed by physical interactions between the P1 and P2 FEBS Journal 274 (2007) 4476–4490 ª 2007 The Authors Journal compilation ª 2007 FEBS 4485 Sp regulation of the AbH-J-J locus P1 promoter G Feriotto et al promoters driven by transcription factors able to form heterodimers, such as Sp1 and MEF-2 From the practical point of view, the impact of Sp proteins on the transcriptional regulation of this locus will be of future interest, considering the potential contribution of AAH and humbug to the infiltrating growth of neoplasms by increasing cell migration and enhancing proliferation and survival [3,5–9] Inhibition of AAH and humbug expression could represent an attractive approach for gene therapy of infiltrating tumors [3,10,35,36] Other authors demonstrated that Sp1 is a useful molecular marker in gastric cancer, and upregulates genes involved in tumorigenesis, including hepatocyte growth factor receptor (MET), vascular endothelial growth factor, and BRCA1 [35,37–39] In addition, another study suggested that, in human neuroblastoma cells, insulin-like growth factor-1 signaling is involved in the upregulation of AAH and humbug [40] Interestingly, in cardiac muscle cells, the transcriptional activation of cyclin D3 and Glut1 promoters by insulin-like growth factor-1 requires the induction of Sp1 protein [41] In discussing the possible implications of targeting Sp1 transcription factor(s) with transcription factor decoy oligonucleotides, caution is required, due to the extensive involvement of this transcription factor in the regulation of expression of several genes, including genes involved in development and cell cycle progression [27,38,42] In this respect, we cannot exclude the possibility that an indirect effect of Sp1 might also be responsible for regulation of this gene locus In any case, the data reported here on the functional characterization of the P1 promoter of the AbH-J-J locus demonstrate that this belongs to the class of Sp1-controlled promoters, and it is different from the P2 promoter, both for transcription factor-binding signals and potency in supporting transcription [13,16] When the results given in the present article are considered together with previously published reports by our and other research groups, it can be concluded that the AbH-J-J locus contains at least two functionally distinct promoters (P1 and P2), and multiple alternative splicing sites, leading to the synthesis of the functionally distinct proteins, AAH, humbug, junctin, and junctate [1,2,13,16] Experimental procedures Cell culture HepG2, RD, MCF7, HeLa, Hek293 and SL-2 cell lines, obtained from the ATCC (Manassas, VA, USA), were cultured as described previously [13,20,43,44] 4486 RT-PCR Total RNA from human adult normal tissue was purchased from BD Biosciences Clontech (Palo Alto, CA) Total RNA was harvested from cell lines by using the TRIzol Reagent (Invitrogen, Carlsbad, CA) cDNA was synthesized from lg of total RNA using ImProm-II (Promega, Madison, WI) PCR was performed using the GeneAmp PCR System 9600 (Applied Biosystems, Foster City, CA, USA), lL ⁄ 20 lL of cDNA, the e1F forward primer (Table 1), and the e3R reverse primer, 5¢-TTC CTG AGA GTC CGC CTT TC-3¢ (designed to amplify a 134 bp sequence present in all the transcripts relative to P1 promoter activity and spanning one intron in order to rule out amplification from genomic DNA), U of Taq polymerase, and 33 lm dNTPs PCR reactions were performed for a total of 30 cycles (97 °C for 15 s, 64 °C for 30 s, and 72 °C for 15 s) Starting total RNA was normalized by performing RT-PCR of the b2-microglobulin housekeeping gene (data not shown) 5¢-RACE 5¢-RACE was performed by using the GeneRacer kit (Invitrogen) with lg of total RNA, isolated from HeLa and RD cells cDNA was synthesized using the e5R primer (5¢-AAT AAA ACT TTG GCA TCA TCC ACA TCA AAA TCT CC-3¢), complementary to an exon sequence of the AbH-J-J locus (Fig 1) After ligation to the RNA oligonucleotide, the cDNA was used as template for PCR, which was performed with the GeneRacer kit anchor primer, and the gene-specific e3R primer (Fig 2) A dilution of the original PCR was reamplified using the nested e1R primer (5¢-TTC TCG TCG CCG TTG TCG TCG TC-3¢) complementary to an exon sequence PCR products were analyzed by electrophoresis, and amplified DNA purified from gel slices was cloned with the pGEM-T Vector System (Promega) Recombinant plasmids were sequenced with the ABI PRISM Big Dye terminator cycle sequencing ready reaction kit using the ABI PRISM 377 DNA sequencer (PE Applied Biosystems, Foster City, CA) The stronger transcription initiation site, defined by the most represented 5¢-ends, was numbered + and all the other sites are relative to it Cloning of the AbH-J-J P1 promoter sequences and reporter plasmid construction The 3.1 kb partially digested PstI fragment of the human chromosome BAC clone encompassing AbH-J-J exon (Fig 1) [1] was cloned into the pUC18 vector and sequenced The sequence corresponding to ) 1683 ⁄ + 81, relative to the transcription initiation site, was amplified by using the GeneAmp High Fidelity PCR System (Applied Biosystems, Foster City, CA), and the XF (5¢-CCG CTC GAG TGC AGT GTG AAA ACG GAC TAA TAC AGT G-3¢) forward and NR (5¢-CAT GCC ATG GTG GCG FEBS Journal 274 (2007) 4476–4490 ª 2007 The Authors Journal compilation ª 2007 FEBS G Feriotto et al GAC CTC CTT CAG TGC-3¢) reverse primers, containing an XhoI and an NcoI restriction site, respectively The PCR product was cloned into the XhoI–NcoI restriction sites of pGL3-basic firefly luciferase reporter plasmid (Promega) Ten serial deletion constructs were generated from this recombinant plasmid using the ExoIII ⁄ S1 Deletion kit (Fermentas, Vilnius, Lithuania) The sequences of all the constructs were confirmed by DNA sequencing The AbHJ-J P2 promoter reporter construct with maximal promoter activity () 265 ⁄ + 115) was obtained from the pGL3-basic vector as previously described [13] Sp regulation of the AbH-J-J locus P1 promoter 20 mm Hepes ⁄ KOH (pH 7.9), 25% glycerol, 420 mm NaCl, 1.5 mm MgCl2, 0.2 mm EDTA, 0.5 mm dithiothreitol, 0.2 mm phenylmethanesulfonyl fluoride, lgỈmL)1 aprotinin, lgỈmL)1 leupeptin, mm Na3VO4, and 10 mm NaF (Sigma-Aldrich, St Louis, MO, USA); cell debris was removed by centrifugation at 12 000 g for at °C (centrifuge 5411R, F45-24-11 rotor, Eppendorf) The Bradford method (DC Protein Assay; Bio-Rad, Hercules, CA, USA) was used to measure the protein concentration in the extract, which was then stored in aliquots at ) 80 °C EMSA Transient transfection and dual luciferase assay Cells were seeded at 50–70% confluence in 16 mm wells Transfection was performed after 24 h using 1.5–2 lg of lipofectamine 2000 (Life Technologies, Gaithersburg, MD), 75 ng of pRL-TK vector (Promega), which contains the Renilla luciferase gene as a transfection efficiency control, and 0.75 lg of firefly luciferase reporter plasmid per well Lysates were prepared 24 h after transfection by adding 100 lL of passive lysis buffer (Dual Luciferase Reporter Assay System; Promega) Luciferase activity was determined with an analytical luminometer (model TD-20 ⁄ 20; Turner Designs, Sunnyvale, CA); the light intensity produced by firefly luciferase (test plasmid) was normalized to that produced by Renilla luciferase (control plasmid) Promoter activity was expressed as fold induction relative to that of cells transfected with the pGL3-basic vector [13] At least three independent experiments were performed using each construct Drosophila expression vectors of human Sp1 and Sp3 factors (pPAC Sp1 and pPAC Sp3) were kindly provided by G Suske (Institut fur Molekularbiologie und ă Tumorforschung, Philipps University, Marburg, Germany) Briefly, SL2 cells were seeded at · 105 cells ⁄ well Transfection was performed using 2.5 lg of lipofectamine 2000 (Life Technologies), 0.6 lg of Sp1, Sp3 expression vector or pPAC void vector and 0.6 lg of firefly luciferase reporter plasmid per well Lysates were prepared 72 h after transfection, and luciferase activity was determined The light intensity was normalized against total protein concentration Nuclear extract preparation Nuclear extracts were prepared as described by Andrews & Faller [45] Briefly, cells were collected, washed twice with ice-cold NaCl ⁄ Pi, and resuspended in 0.4 mL (107 cells) of hypotonic lysis buffer (10 mm Hepes ⁄ KOH, pH 7.9, 10 mm KCl, 1.5 mm MgCl2, 0.5 mm dithiothreitol, and 0.2 mm phenylmethanesulfonyl fluoride) After incubation on ice for 10 min, the mixture was vortexed for 10 s, and nuclei were pelleted by centrifugation at 12 000 g for 10 s (centrifuge 5411R, F45-24-11 rotor, Eppendorf, Hamburg, Germany); nuclear proteins were then extracted by incubation of the nuclei for 20 on ice with intermittent gentle vortexing in The double-stranded oligonucleotides used in the EMSA are reported in Table Three picomoles of oligonucleotide were 32 P-labeled using OptiKinase (GE Healthcare, Chalfont St Giles, UK), annealed to an excess of complementary oligonucleotide, and purified from [32P]ATP[cP] (Applied Biosystems) Binding reactions were performed by incubating lg of nuclear extract and 16 fmol of 32P-labeled double-stranded oligonucleotide, with or without competitor, in a final volume of 20 lL of binding buffer [20 mm Tris ⁄ HCl, pH 7.5, 50 mm KCl, mm MgCl2, 0.2 mm EDTA, 5% glycerol, mm dithiothreitol, 0.01% Triton X-100, 0.05 lgỈlL)1 of poly(dI-dC), 0.05 lgỈlL)1 of a single-stranded oligonucleotide] [46] Competitor (a 6–100-fold excess of unlabeled oligonucleotides) and nuclear extract mixture were incubated for 15 min, and then probe was added to the reaction After a further incubation for 30 at room temperature, samples were immediately loaded onto a 6% nondenaturing polyacrylamide gel containing 0.25 · Tris ⁄ borate ⁄ EDTA (22.5 mm Tris, 22.5 mm boric acid, 0.5 mm EDTA, pH 8) buffer Electrophoresis was carried out at 200 V Gels were vacuum heat-dried and subjected to autoradiography Supershift assays were performed as described previously [13] by using lg of commercially available antibodies specific for Sp1 (sc-59X) and Sp3 (sc-644X) transcription factors (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) Site-directed mutagenesis Mutagenesis was performed by using a QuickChange sitedirected mutagenesis kit (Stratagene, La Jolla, CA, USA) The mutant oligonucleotides F ⁄ Gmut and D ⁄ Emut (Table 1) plus ⁄ 12mer flanking nucleotide of the corresponding P1 sequence (and their complementary sequences) were used to inactivate specific binding in the pGL3 construct containing the ) 512 ⁄ + 81 promoter sequence The nucleotide sequences of the mutant constructs were confirmed by DNA sequencing ChIP assays ChIP assays were performed by using the Chromatin Immunoprecipitation Assay Kit (Upstate Biotechnology, FEBS Journal 274 (2007) 4476–4490 ª 2007 The Authors Journal compilation ª 2007 FEBS 4487 Sp regulation of the AbH-J-J locus P1 promoter G Feriotto et al Inc., Lake Placid, NY) Briefly, · 107 HeLa cells (from five 15 cm plates) were treated, for 10 at room temperature, with 1% formaldehyde culture medium After washing in NaCl ⁄ Pi, glycine was added to a final concentration of 0.125 m The cells were then suspended in 1.5 mL of lysis buffer (1% SDS, 10 mm EDTA, and 50 mm Tris ⁄ Cl, pH 8.1) plus protease inhibitors (1 lgỈmL)1 pepstatin A, lgỈmL)1 leupeptin, lgỈmL)1 aprotinin, and mm phenylmethanesulfonyl fluoride), and the chromatin was subjected to sonication (using a Sonics Vibracell VC130 sonicator with a mm probe; Sonics and Materials, Newtown, CT, USA) Fifteen 15 s sonication pulses at 30% amplitude were required to shear chromatin to 200–1000 bp fragments Aliquots of 0.2 mL of chromatin were diluted to mL in ChIP dilution buffer containing protease inhibitors and then cleared with 75 lL of salmon sperm DNA ⁄ protein A agarose 50% gel slurry (Upstate Biotechnology) for h at °C before incubation on a rocking platform with either 6–10 lg of specific antiserum [Sp3, MEF-2A and myogenin (Santa Cruz Biotechnology); Sp1 (Upstate Biotechnology)] or normal rabbit serum (Upstate Biotechnology) Twenty microliters of diluted chromatin was saved and stored for later PCR analysis as 1% of the input extract Incubations were done overnight at °C and continued for an additional h after the addition of 60 lL of protein A agarose slurry Thereafter, the agarose pellets were washed consecutively with low-salt, high-salt and LiCl buffers DNA–protein complexes were recovered from the pellets with elution buffer (0.1 m NaHCO3 with 1% SDS), and crosslinks were reversed by incubating overnight at 65 °C with 0.2 m NaCl The samples were treated with RNaseA and proteinase K, extracted with phenol ⁄ chloroform, and ethanol-precipitated The pelleted DNAs were washed with 70% ethanol and dissolved in 40 lL of Tris ⁄ EDTA Two-microliter aliquots were used for each real-time PCR reaction to quantitate immunoprecipitated promoter fragments [47] Real-time PCR quantitation of immunoprecipitated promoter fragments For quantitative real-time PCR, each 25 lL reaction mixture contained lL of template DNA (from chromatin immunoprecipitations), 10 pmol of primers (Table 1), and · iQ SYBR Green Supermix (Bio-Rad) Real-time PCR reactions were performed for a total of 40 cycles (97 °C for 15 s, 68 °C for 30 s, and 72 °C for 20 s) using an iCycler IQ (Bio-Rad) The relative proportions of immunoprecipitated promoter fragments were determined on the basis of the threshold cycle (Tc) value for each PCR reaction Realtime PCR data analysis followed the methodology previously described [47,48] A DTc value was calculated for each sample by subtracting the Tc value for the input (to account for differences in amplification efficiencies and DNA quantities before immunoprecipitation) from the Tc value obtained for the immunoprecipitated sample A DDTc 4488 value was then calculated by subtracting the DTc value for the sample immunoprecipitated with specific antiserum from the DTc value for the corresponding control sample immunoprecipitated with nonimmune rabbit serum Fold differences (specific antiserum ChIP relative to nonimmune serum control ChIP) were then determined by the equation 2DDTc PCR was also performed using control primers that amplify a 197 bp genomic region lacking Sp1-binding sites The DDTc values were then calculated as previously described, and the negative control PCR data were used to normalize quantitative results from different immunoprecipitations Each sample was quantitated in triplicate on at least two separate occasions and from at least two independent immunoprecipitations Mean ± SD values were determined for each fold difference TFD approach targeting Sp proteins The effect of the Sp1-1 consensus oligonucleotide decoy on P1-directed transcription of the AbH-J-J locus was evaluated by adding lgỈmL)1 of Sp1mer double-stranded oligonucleotide (Table 1), or a scrambled sequence of the same length as a control, and lgỈmL)1 of lipofectamine 2000 to HeLa cells seeded at 50–70% confluence in 16 mm wells [21] Twenty-four hours later, RNA extraction and reverse transcription were performed Aliquots, ⁄ 20 lL, of cDNA were used for each SYBR Green realtime PCR reaction to quantitate the depletion of AbH-J-J transcripts, using the e1F forward primer and the e5R reverse primer (Table 1) designed to amplify a 297 bp sequence present in all the mRNAs relative to P1 promoter activity Amplification of human hydroxymethylbilane synthase cDNA served as an internal standard (housekeeping gene) Real-time PCR reactions were performed for a total of 40 cycles (95 °C for 10 s, 66 °C for 30 s, and 72 °C for 50 s) The DDCt method was used to compare gene expression data Statistical analysis All the data were normally distributed and presented as mean ± SD Statistical differences between groups were compared using one-way anova software Statistical significance was assumed at P < 0.05 Acknowledgements This work was supported in part by grants from FIRB ` and Ministero Universita e Ricerca Scientifica e Tecnologica (60% and 40%), the Department of Anesthesia Kantosspital Basel, HPRN-CT-2002-00331 from the European Union, the Italian Space Agency and the Swiss Muscle Foundation R Gambari is supported by grants from AIRC, COFIN-2004, and FIRB FEBS Journal 274 (2007) 4476–4490 ª 2007 The Authors Journal compilation ª 2007 FEBS G Feriotto et al Sp regulation of the AbH-J-J locus P1 promoter References Treves S, Feriotto G, Moccagatta L, Gambari R & Zorzato F (2000) Molecular cloning, expression, functional characterization, chromosomal localization, and gene structure of junctate, a novel integral calcium binding protein of sarco (endo) plasmic reticulum membrane J Biol Chem 275, 39555–39568 Dinchuk JE, Henderson NL, Burn TC, Huber R, Ho SP, Link J, O’Neil KT, Focht RJ, Scully MS, Hollis JM et al (2000) Aspartyl beta-hydroxylase (Asph) and an evolutionarily conserved isoform of Asph missing the catalytic domain share exons with junctin J Biol Chem 275, 39543–39554 Maeda T, Sepe P, Lahousse S, Tamaki S, Enjoji M, Wands JR & de la Monte SM (2003) Antisense oligodeoxynucleotides directed against aspartyl (asparaginyl) beta-hydroxylase suppress migration of cholangiocarcinoma cells J Hepatol 386, 15–22 Gundogan F, Elwood G, Greco D, Rubin LP, Pinar H, Carlson RI, Wands JR & de la Monte SM (2007) Role of aspartyl-(asparaginyl) beta-hydroxylase in placental implantation: Relevance to early pregnancy loss Hum Pathol 38, 50–59 Wang J, de la Monte SM, Sabo E, Kethu S, Tavares R, Branda M, Simao L, Wands JR & Resnick MB (2007) Prognostic value of humbug gene overexpression in stage II colon cancer Hum Pathol 38, 17–25 Ince N, de la Monte SM & Wands JR (2000) Overexpression of human aspartyl (asparaginyl) beta-hydroxylase is associated with malignant transformation Cancer Res 60, 1261–1266 Sepe PS, Lahousse SA, Gemelli B, Chang H, Maeda T, Wands JR & de la Monte SM (2002) Role of the aspartyl-asparaginyl-beta-hydroxylase gene in neuroblastoma cell motility Lab Invest 82, 881–891 Palumbo KS, Wands JR, Safran H, King T, Carlson RI & de la Monte SM (2002) Human aspartyl (asparaginyl) beta-hydroxylase monoclonal antibodies: potential biomarkers for pancreatic carcinoma Pancreas 25, 39–44 Maeda T, Taguchi K, Aishima S, Shimada M, Hintz D, Larusso N, Gores G, Tsuneyoshi M, Sugimachi K, Wands JR et al (2004) Clinicopathological correlates of aspartyl (asparaginyl) beta-hydroxylase over-expression in cholangiocarcinoma Cancer Detect Prev 28, 313–318 10 de la Monte SM, Tamaki S, Cantarini MC, Ince N, Wiedmann M, Carter JJ, Lahousse SA, Califano S, Maeda T, Ueno T et al (2006) Aspartyl-(asparaginyl)beta-hydroxylase regulates hepatocellular carcinoma invasiveness J Hepatol 44, 971–983 11 Stamboulian S, Moutin MJ, Treves S, Pochon N, Grunwald D, Zorzato F, De Waard M, Ronjat M & Arnoult C (2005) Junctate, an inositol 1,4,5-triphosphate receptor associated protein, is present in rodent sperm and binds 12 13 14 15 16 17 18 19 20 21 22 23 TRPC2 and TRPC5 but not TRPC1 channels Dev Biol 286, 326–337 Treves S, Franzini-Armstrong C, Moccagatta L, Arnoult C, Grasso C, Schrum A, Ducreux S, Zhu MX, Mikoshiba K, Girard T et al (2004) Junctate is a key element in calcium entry induced by activation of InsP3 receptors and ⁄ or calcium store depletion J Cell Biol 166, 537–548 Feriotto G, Finotti A, Volpe P, Treves S, Ferrari S, Angelelli C, Zorzato F & Gambari R (2005) Myocyte enhancer factor activates promoter sequences of the human AbetaH-J-J locus, encoding aspartyl-betahydroxylase, junctin, and junctate Mol Cell Biol 25, 3261–3275 Suske G (1999) The Sp-family of transcription factors Gene 238, 291–300 Suske G, Bruford E & Philipsen S (2005) Mammalian SP ⁄ KLF transcription factors: bring in the family Genomics 85, 551–556 Feriotto G, Finotti A, Breveglieri G, Treves S, Zorzato F & Gambari R (2006) Multiple levels of control of the expression of the human A beta H-J-J locus encoding aspartyl-beta-hydroxylase, junctin, and junctate Ann NY Acad Sci 1091, 184–190 Kiela PR, LeSueur J, Collins JF & Ghishan FK (2003) Transcriptional regulation of the rat NHE3 gene Functional interactions between GATA-5 and Sp family transcription factors J Biol Chem 278, 5659–5668 Jeong JH, Orvis J, Kim JW, McMurtrey CP, Renne R & Dittmer DP (2004) Regulation and autoregulation of the promoter for the latency-associated nuclear antigen of Kaposi’s sarcoma-associated herpesvirus J Biol Chem 279, 16822–16831 Li M & Kellems RE (2003) Sp1 and Sp3 are important regulators of AP-2gamma gene transcription Biol Reprod 69, 1220–1230 Hagen G, Muller S, Beato M & Suske G (1994) Sp1mediated transcriptional activation is repressed by Sp3 EMBO J 13, 3843–3851 Penolazzi L, Lambertini E, Borgatti M, Piva R, Cozzani M, Giovannini I, Naccari R, Siciliani G & Gambari R (2003) Decoy oligo deoxynucleotides targeting NF-kappaB transcription factors: induction of apoptosis in human primary osteoclasts Biochem Pharmacol 66, 1189–1198 Jiang P, Kumar A, Parrillo JE, Dempsey LA, Platt JL, Prinz RA & Xu X (2002) Cloning and characterization of the human heparanase-1 (HPR1) gene promoter: role of GA-binding protein and Sp1 in regulating HPR1 basal promoter activity J Biol Chem 277, 8989–8998 Izumi H, Ise T, Murakami T, Torigoe T, Ishiguchi H, Uramoto H, Yoshida Y, Yoshida T, Tanabe M & Kohno K (2003) Structural and functional characterization of two human V-ATPase subunit gene promoters Biochim Biophys Acta 1628, 97–104 FEBS Journal 274 (2007) 4476–4490 ª 2007 The Authors Journal compilation ª 2007 FEBS 4489 Sp regulation of the AbH-J-J locus P1 promoter G Feriotto et al 24 Wong CC & Lee WM (2002) The proximal cis-acting elements Sp1, Sp3 and E2F regulate mouse mer gene transcription in Sertoli cells Eur J Biochem 269, 3789– 3800 25 Tapias A, Monasterio P, Ciudad CJ & Noe V (2005) Characterization of the 5¢-flanking region of the human transcription factor Sp3 gene Biochim Biophys Acta 1730, 126–136 26 Hilton TL, Li Y, Dunphy EL & Wang EH (2005) TAF1 histone acetyltransferase activity in Sp1 activation of the cyclin D1 promoter Mol Cell Biol 25, 4321– 4332 27 Li L, He S, Sun JM & Davie JR (2004) Gene regulation by Sp1 and Sp3 Biochem Cell Biol 82, 460–471 28 He S, Sun JM, Li L & Davie JR (2005) Differential intranuclear organization of transcription factors Sp1 and Sp3 Mol Biol Cell 16, 4073–4083 29 Yang Y, Hwang CK, Junn E, Lee G & Mouradian MM (2000) ZIC2 and Sp3 repress Sp1-induced activation of the human D1A dopamine receptor gene J Biol Chem 275, 38863–38869 30 Yu B, Datta PK & Bagchi S (2003) Stability of the Sp3–DNA complex is promoter-specific: Sp3 efficiently competes with Sp1 for binding to promoters containing multiple Sp-sites Nucleic Acids Res 31, 5368–5376 31 Sapetschnig A, Koch F, Rischitor G, Mennenga T & Suske G (2004) Complexity of translationally controlled transcription factor Sp3 isoform expression J Biol Chem 279, 42095–42105 32 Fluck CE & Miller WL (2004) GATA-4 and GATA-6 modulate tissue-specific transcription of the human gene for P450c17 by direct interaction with Sp1 Mol Endocrinol 18, 1144–1157 33 Loeffler S, Fayard B, Weis J & Weissenberger J (2005) Interleukin-6 induces transcriptional activation of vascular endothelial growth factor (VEGF) in astrocytes in vivo and regulates VEGF promoter activity in glioblastoma cells via direct interaction between STAT3 and Sp1 Int J Cancer 115, 202–213 34 Grayson J, Bassel-Duby R & Williams RS (1998) Collaborative interactions between MEF-2 and Sp1 in muscle-specific gene regulation J Cell Biochem 70, 366– 375 35 Liang H, O’Reilly S, Liu Y, Abounader R, Laterra J, Maher VM & McCormick JJ (2004) Sp1 regulates expression of MET, and ribozyme-induced down-regulation of MET in fibrosarcoma-derived human cells reduces or eliminates their tumorigenicity Int J Oncol 24, 1057–1067 36 Lou Z, O’Reilly S, Liang H, Maher VM, Sleight SD & McCormick JJ (2005) Down-regulation of overexpressed sp1 protein in human fibrosarcoma cell lines inhibits tumor formation Cancer Res 65, 1007–1017 37 Yao JC, Wang L, Wei D, Gong W, Hassan M, Wu TT, Mansfield P, Ajani J & Xie K (2004) Association 4490 38 39 40 41 42 43 44 45 46 47 48 between expression of transcription factor Sp1 and increased vascular endothelial growth factor expression, advanced stage, and poor survival in patients with resected gastric cancer Clin Cancer Res 10, 4109– 4117 Safe S & Abdelrahim M (2005) Sp transcription factor family and its role in cancer Eur J Cancer 41, 2438– 2448 Maor S, Papa MZ, Yarden RI, Friedman E, Lerenthal Y, Lee SW, Mayer D & Werner H (2007) Insulin-like growth factor-I controls BRCA1 gene expression through activation of transcription factor Sp1 Horm Metab Res 39, 179–185 Lahousse SA, Carter JJ, Xu XJ, Wands JR & de la Monte SM (2006) Differential growth factor regulation of aspartyl-(asparaginyl)-beta-hydroxylase family genes in SH-Sy5y human neuroblastoma cells BMC Cell Biol 7, 41–62 Li T, Chen YH, Liu TJ, Jia J, Hampson S, Shan YX, Kibler D & Wang PH (2003) Using DNA microarray to identify Sp1 as a transcriptional regulatory element of insulin-like growth factor in cardiac muscle cells Circ Res 93, 1202–1209 Zhao C & Meng A (2005) Sp1-like transcription factors are regulators of embryonic development in vertebrates Dev Growth Differ 47, 201–211 Endres K, Postina R, Schroeder A, Mueller U & Fahrenholz F (2005) Shedding of the amyloid precursor protein-like protein APLP2 by disintegrin-metalloproteinases FEBS J 272, 5808–5820 Zampieri L, Bianchi P, Ruff P & Arbuthnot P (2002) Differential modulation by estradiol of P-glycoprotein drug resistance protein expression in cultured MCF7 and T47D breast cancer cells Anticancer Res 22, 2253– 2259 Andrews NC & Faller DV (1991) A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells Nucleic Acids Res 19, 2499 Mischiati C, Feriotto G, Borgatti M, Giacomini P & Gambari R (2000) Characterization of a major histocompatibility complex class II, X-box-binding protein enhancing tat-induced transcription directed by the human immunodeficiency virus type long terminal repeat J Virol 74, 8989–9001 Chakrabarti SK, James JC & Mirmira RG (2002) Quantitative assessment of gene targeting in vitro and in vivo by the pancreatic transcription factor, Pdx1 Importance of chromatin structure in directing promoter binding J Biol Chem 277, 13286–13293 Christenson LK, Stouffer RL, Strauss JF III (2001) Quantitative analysis of the hormone-induced hyperacetylation of histone H3 associated with the steroidogenic acute regulatory protein gene promoter J Biol Chem 276, 27392–27399 FEBS Journal 274 (2007) 4476–4490 ª 2007 The Authors Journal compilation ª 2007 FEBS ... vivo binding of these proteins to P1 promoter Our results suggest that Sp transcription factors positively regulate the core of the P1 promoter, and the comparison of the two promoters of the AbH-J-J. .. transcription factors and Sp1 -binding sites are involved in the upregulation of the P1 promoter of the human AbH-J-J gene locus Although our results not conclusively show the involvement of other factors... attention on the activity of binding of nuclear extract to these boxes Binding of nuclear factors to GC-rich boxes of the AbH-J-J P1 promoter In order to study protein–DNA interactions and further characterize