Platination of telomeric sequences and nuclease hypersensitive elements of human c-myc and PDGF-A promoters and their ability to form G-quadruplexes Viktor Viglasky Department of Biochemistry, Faculty of Sciences, Institute of Chemistry, P. J. Safarik University, Kosice, Slovakia G-rich regions appear in several locations in the human genome, including at the ends of linear chrom- omes, the immunoglobin switch region, centromeres, fragile X syndrome repeats, and promoters of some genes [1]. The sequences repeated in tandem, with three or four adjacent guanines, have been known to form polymorphic quadruplexes containing G-quartets stabi- lized by cyclic Hoogsteen hydrogen bondings. Quadru- plex structures are highly stable DNA or RNA structures formed on G-rich sequences [2]. The Na + and K + ions stabilize the stacking through their inter- actions with carbonyl oxygens of the eight guanines of two adjacent quartets [3]. Direct evidence for the pres- ence of G-quadruplex structures in vivo has been reported both at the telomeres of the ciliate Stylonychi- a [4] and those of humans [5], and at the promoter of c-myc [6,7]. Moreover, other genomic regions were shown to be able to adopt quadruplex structures, such as the promoters of c-kit oncogene [6], HIF-1a [9], Bcl2 [10] and vascular endothelial growth factor [11]. The stabilization of the G-quadruplex structure by small molecules is currently emerging as a very promis- ing anti-cancer strategy. Therefore, molecules that stabi- lize G-quadruplex structures can be used as potential anti-cancer agents [12]. Indeed, recent studies strongly suggest that molecules able to stabilize the quadruplex structure of DNA can lead to an arrest of the prolifera- tion of cancer cells [5,12–14]. At each division of somatic cells, telomeres are shortened, a process leading to senescence and death. It has been shown in vitro that G-quadruplex structures of the human sequence (G 3 T 2 A) 3 G 3 formed in the presence of molecules stabi- lizing the G-quartet stacks, similar to anthraquinones or porphyrins, inhibit the activity of telomerase [13–17]. The anti-tumor drug cisplatin (cis-[PtCl2(NH3)2]), known for its high affinity for G-rich sequences, was Keywords cisplatin; c-myc; G-quadruplex; PDGF-A promoter; telomeric sequences Correspondence V. Viglasky, Department of Biochemistry, Faculty of Sciences, Institute of Chemistry, Safarik University, Moyzesova 11, 04011 Kosice, Slovakia Fax: +421 55 622 21 24 Tel: +421 55 234 12 62 E-mail: viktor.viglasky@upjs.sk (Received 30 August 2008, revised 5 November 2008, accepted 7 November 2008) doi:10.1111/j.1742-4658.2008.06782.x Naturally occurring G-rich DNA sequences that are able to form G-quad- ruplex structures appear as potential targets for anti-cancer chemotherapy, and therefore play an important role in cellular processes, such as cell aging, death and carcinogenesis. The telomeric regions of DNA and nucle- ase hypersensitive elements of human c-myc and PDGF-A promoters repre- sent a very appealing target for cisplatin and may interfere with normal DNA function. Platinum complexes bind covalently to nucleobases, and especially to the N7 atom of guanines, and the four guanines of a G-quar- tet have their N7 atoms involved in hydrogen bonding. Therefore, within a G-quadruplex structure, only the guanines out of the stack of G-quartets should react with electrophilic species such as platinum (II) complexes. Platinum complexes have significant influence on the formation of G-quad- ruplexes. Results obtained by CD spectroscopy and temperature gradient- gel electrophoresis clearly demonstrate that DNA platination significantly affects G-quadruplex folding for telomeric sequences; the abundance of un ⁄ misfolded DNAs compared to the G-quadruplex is proportional to the platinum concentration. Abbreviation TGGE, temperature gradient-gel electrophoresis. FEBS Journal 276 (2009) 401–409 ª 2008 The Author Journal compilation ª 2008 FEBS 401 found to inhibit telomerase activity in testicular cancer cells [18] and to reduce telomere length in treated cells [19]. The anti-tumor drug cisplatin forms two kinds of cross-links with DNA: intrastrand and interstrand. Platinum complexes react with cellular DNA, primarily binding to the N7 positions of guanine bases, forming 60–65% chelates between adjacent guanines named the 1,2-GG adducts, 20% of 1,2-AG adducts and a small amount of interstrand cross-links [20]. It is unclear how cisplatin induces cytotoxicity but it is widely attributed to the formation of the major 1,2-GG adduct because the tumor response correlates with the levels of 1,2-GG adducts [21]. The formation of inter- strand crosslinks requires partial disruption of the Watson–Crick base pairing within double strand DNA, and the cross-linking reaction could therefore be expected to be rather slow. However, by contrast, kinetic measurements indicate that interstrand cross- linking is as fast as intrastrand cross-linking, or even faster [22]. However, the four guanines of a G-quartet have their N7 atoms involved in hydrogen bonding. Therefore, within a G-quadruplex structure, only the guanines outside the stack of G-quartets should react with electrophilic species such as platinum complexes. The influence of platination on the telomeric sequences was described previously by Garnier et al. [22], but the effect of platination on the quadruplex formation has never been described in detail. Guanine-guanine cross- linking by platinum atoms either welds together contiguous guanine residues and stabilizes the G-qua- druplex or the occupancy of N7 hydrogen bonds desta- bilizes these structural motifs. The suggestion that platinum complexes significantly affect the structure of G-quadruplexes is shown. Various G-rich sequences prone to form quadruplex motifs are investigated in the present study. Tempera- ture gradient-gel electrophoresis (TGGE) has been applied for the first time to study quadruplex confor- mational stability. The results obtained by CD spec- troscopy and TGGE clearly demonstrate that the telomeric G-quadruplexes are very sensitive to covalent platinum modification by platinum, but not nuclease hypersensitive elements of human c-myc and PDGF-A promoters; the abundance of unfolded DNA is propor- tional to the platinum concentration. Results CD spectrum of G-rich oligonucleotides CD spectra have been extensively applied to the study of G-quadruplex structures. It is well known that par- allel G-quadruplex structures, such as propeller forms, give a positive band at approximately 263 nm and a negative band at approximately 240 nm, whereas anti- parallel G4 structures, such as basket and chair forms, show two positive bands at approximately 295 and 240 nm and a negative band at approximately 260 nm. These spectral features are mainly attributed to the specific guanine stacking in various G4 structures. Figure 1 shows the CD spectra of c-MYC, PDGF-A, Tel-1 and Tel-2 oligonucleotides in 50 mm Tris–HCl containing 50 mm K + cations. According to the find- ing of multiple conformations, the 293 nm positive CD band associated with a 265 nm positive shoulder of Tel-1 is probably due to the co-existence of both paral- lel and antiparallel G4 structures in K + solution [3,23]. The CD pattern of Tel-1 is similar to the CD pattern of d(TAGGGTTAGGGT) and NMR analysis has revealed the co-existence of the dimeric antiparallel and parallel G4 structures in K + solution [23,24]. The CD spectra of different oligonucleotides show that c-MYC and PDGF-A sequences preferentially form the parallel G-quadruplex structure in 50 mm Tris-HCl buffer at pH 7.8, and the maximum of ellipticity is observed at 263 nm. These results agree with the mea- surements obtained in previous studies [14]. However, telomeric sequences Tel-1 and Tel-2 form a preferen- tially antiparallel configuration of G-quadruplex struc- ture in solutions containing the K + ion, with the maximum being observed at 293 nm. The increase of K + facilitates the folding of G-quadruplexes, and the peak at 293 nm increases [25]. Interestingly, when a Fig. 1. Comparative CD spectra of four known G-quadruplex- forming sequences: Tel-1 (open circle), Tel-2 (solid circle), c-MYC (diamond) and PDGF-A (triangle) in 50 m M Tris–HCl buffer (pH 7.8) with 50 m M KCl. Each spectrum corresponds to three averaged scans taken at 20 °C and is baseline corrected for signal contribu- tion due to the buffer. Influence of platinum complexes on G-quadruplexes V. Viglasky 402 FEBS Journal 276 (2009) 401–409 ª 2008 The Author Journal compilation ª 2008 FEBS DNA tract of repetition contains more than three residues of guanines, then a small amount of DNA without the presence of K + is folded into the G-quad- ruplex structure at room temperature. Defrosted stock solution of G-rich oligomer in distilled water contains a nonzero amount of folded G-quadruplex structure, which is detectable by CD spectroscopy; this was observed for Tel-2, c-MYC and PDGF-A [26]. This is most likely due to the residual amount of monovalent ions that was not removed during desalting process, but is still sufficient for stabilization of the G-quadru- plex motif. CD spectra of platinated Tel-1 and Tel-2 Platination of oligonucleotides was performed in dis- tilled water in the presence of 10 mm KClO 4 , where the G-quadruplex should form a stable conformation. In the case where the platination is performed in dis- tilled water without any univalent ions, a very low amount of folded G-quadruplex is detected by CD spectroscopy (data not shown). Figure 2 shows the influence of platination on the G-quadruplex destabili- zation for Tel-2. Increasing the number of cisplatin molecules per oligonucleotide rapidly decreases the positive and negative elliptic peaks of Tel-2 at 293, 242 and 262 nm, respectively. The same effects were observed for five additional oligonucleotides: d(G 3 T 3 ) 3 G 3 , d(G 4 T 3 ) 3 G 4 , d(G 4 T 2 ) 3 G 4 , d(G 4 T 2 ) 3 G 4 and d(G 4 T 2 A) 3 G 4 (data not shown). The intersected isosbe- stic points were detected nearby, at 237, 252 and 280 nm at the given conditions for Tel-2. An addi- tional increase of the K + concentration in solution during the collection of CD spectra has no significant effect on the ellipticity of Tel-2. These multi-isosbestic- point spectra are clear evidence for the formation of intermediates [27]. A molar ratio of 1 : 1 platinum complexes incubated with DNA oligomer decreases the ellipticity at 293 nm by approximately 20%. An increase in the amount of platinum complexes incu- bated with DNA oligonucleotide (four platinum com- plexes per oligomer) causes an additional decrease of this characteristic peak, by approximately 38%. A molar ratio of 16 platinum complexes to oligomer can occupy all guanines of Tel-2 oligonucleotide; this decreases the ellipticity by approximately 73% com- pared to the original nonplatinated oligonucleotides under the same conditions. A similar effect had also been observed for trans-platinum complex (data not shown). Interestingly, single platinum molecules per parallel c-MYC and PDGF-A do not show the effect of a decreasing peak at 263 nm, probably due to the preference of cisplatin to bind with guanines occurring in the loop of the G-quadruplex motif, and these N7 nitrogens of guanine are not associated with Hoogs- teen pairing of the G-tetrad. When the amount of platinum complexes achieves a molar ratio of four molecules per oligonucleotide, then the same effect is observed as for Tel-1 and Tel-2; the decrease of ampli- tude of the characteristic peaks for parallel structures is observed (263 and 240 nm). The decrease of peaks should correlate with the amount of oligomers correctly folded into the quadruplex structure. Analysis of thermal stability of G-quadruplexes The results shown in Fig. 3 clearly demonstrate that the number of G-tetrad in quadruplex is the determining factor for the thermal stability of both parallel and antiparallel G-quadruplexes. Thermal stability in the presence of KCl is: Tel-1 < Tel-2 < c-MYC < PDGF-A quadruplexes (Table 1). The results again confirm that the concentration of K + is a determining factor for the thermal stability of G-quadruplexes. The data shown in Fig. 3A,B,D are normalized. TGGE analysis – influence of platination on thermal stabilization The original data shown in Fig. 3C confirm that platination decreases the amount of correctly folded Fig. 2. Representative CD spectra of Tel-2 in 50 mM Tris–HCl buffer (pH 7.8) with 50 m M KCl. Various amounts of platinum complexes incubated with DNA were used. The molar ratios of platinum complexes incubated per oligomer were: 0 : 1, 1 : 1, 4 : 1 and 16 : 1. All spectra were collected at 20 °C and in a strand concentration of 15 l M. V. Viglasky Influence of platinum complexes on G-quadruplexes FEBS Journal 276 (2009) 401–409 ª 2008 The Author Journal compilation ª 2008 FEBS 403 oligomers into the antiparallel G-quadruplex. Platina- tion does not principally affect the melting tempera- tures of Tel-1 and Tel-2; the normalized data shown in Fig. 3D and Table 1 confirm this claim. However, the transition is widespread for platinated oligonucleotides. An explanation of why the covalent modification of oligonucleotides does not affect thermal stability is offered by the TGGE results (Fig. 4). In Fig. 4, the thermal mobility profiles of platinated and nonplatinated Tel-1 are compared. Tel-1 mobility shows a sigmoidal profile, as expected based on CD measurements, but platination causes an increasing amount of unfolded conformational states (Fig. 4, area highlighted by double arrow). Folded and unfolded conformations are depicted by solid and empty arrows, respectively. The double arrow high- lights the ‘smear area’ representing a population of unfolded and misfolded oligonucleotides. The intensity of this area is increased by the increasing ratio of cisplatin to DNA. Ridge tracking analysis, as applied for proteins, was used for this purpose. T m values were the same (55 ± 2 °C) for both TGGE and CD measurements. The TGGE results clearly demonstrate that CD spec- troscopy results are a convolution of the misfolded and folded spectra of the G-quadruplexes. An identical melting profile of the original (Fig. 4, top) and the pla- tinated DNA (Fig. 4, bottom) is observed after exclud- ing the smear from the electrophoretic record representing any intermediates (Fig. 4). The increased ratio between cisplatin and the oligomer causes an increased abundance of the misfolded population of G-quadruplexes. Discussion The present study aimed to evaluate whether cisplatin is able covalently to trap quadruplex structures. TGGE and CD spectroscopy were used to characterize the folding of platinated G-quadruplex sequences. This structural motif usually plays an important biological role. In particular, the folding of telomeric DNA into the G-quadruplex has been shown to inhi- bit telomerase, an enzyme involved in the maintenance of the telomere length in cancerous cells [2,14]. The human quadruplexes of telomeric sequences have Fig. 3. Normalized elliptic changes of 15 lM c-MYC (A) and PDGF-A (B) oligomers at 260 nm against temperature in 50 mM Tris–HCl buffer (pH 7.8) with 5, 10 and 20 m M KCl. Original (C) and normalized elliptic changes (D) of 15 lM Tel-1 and Tel-2 oligomers at 293 nm against temperature in 50 m M Tris–HCl buffer (pH 7.8) with 50 mM KCl. 1Pt and 4Pt represent platinated Tel-1; the molar ratios of platinum com- plexes incubated per oligomer were 1 and 4. Melting temperatures of platinated DNAs were not affected by the platinum complex, but less cooperative transitions were observed. Table 1. Melting temperatures of oligomers at different salt concentration. +1 cisplatin represents oligomers platinated by a single molecule of cisplatin. ND, not determined. Oligomer 0 m M KCl 10 mM KCl 20 mM KCl +1 cisplatin 50 mM KCl +1 cisplatin Tel-1 ND 33 ± 2 45 ± 2 45 ± 2 55 ± 2 54 ± 2 Tel-2 36 57 ± 2 64 ± 2 63 ± 2 71 ± 2 70 ± 2 c-MYC ND 66 ± 2 76 ± 2 77 ± 2 82 ± 2 84 ± 2 PDGF-A 46 70 ± 2 78 ± 2 80 ± 2 85 ± 2 86 ± 2 Influence of platinum complexes on G-quadruplexes V. Viglasky 404 FEBS Journal 276 (2009) 401–409 ª 2008 The Author Journal compilation ª 2008 FEBS therefore received attention in the context of the telomerase inhibition as a potential anti-cancer ther- apy, using specific small molecules that are able to stabilize DNA quadruplexes [6,13]. Platinum com- plexes, which are widely used for cancer therapies, have a high affinity to attack N7 of the guanine resi- due [20,22]. However, N7 nitrogen is associated with the hydrogen bond stabilization of the G-tetrad. The destabilization of the G-tetrad structure and, finally, the destabilization of the G-quadruplex structure were both expected en bloc. A proposed model of G-tetrad destabilization by two molecules of cisplatin is pro- vided in Fig. 5A. The variability of the cisplatin mode to bind with G-rich sequences is vast; in principle, there is the possibility to bind within each guanine, to form intrastrand and interstrand bifunctional and monofunctional adducts, etc. Some of the proposed binding places of studied oligomers possessing a high affinity for platination are shown in Fig. 5B,C for Tel-1 and c-MYC, respectively. The expectation that folded G-quadruplex would not offer such a wide spectrum for platinum binding was not observed by TGGE. It is known that platinum related complexes cause local bending of DNA and steric hindrance for any DNA associated enzymes in the place of their binding [20]. Except for these effects, the correct fold- ing of G-quadruplexes is significantly affected by covalent modification due to cisplatin. However, for some biological mechanisms, the quadruplexes appear to be essential. Bertrand et al. [28] confirmed that the platination of guanine residues constituting the 5¢ external G-quartet is feasible by a disruption of Hoogsteen organization, which is particularly favored in the case of the antipar- allel conformation of the quadruplex. However, in these studies, the authors had used only human telo- meric sequences forming a hybrid-type intramolecular G-quadruplex structure with mixed parallel ⁄ antiparal- lel strands in potassium solution [3]. Cation-dependent experiments, which modify the equilibrium between the different quadruplex structures, and molecular modeling both led to the conclusion that the antiparallel and parallel forms exhibit different platination profiles. However, it was noted that the identification of the platinable guanines of the mixed-hybrid structure could be problematic [28,29]. Human telomeric repeti- tions do not contain any additional residues of guanine in the connective loop of the G-quadruplex such as that constituting the PDGF-A and c-MYC sequences. In the present study, we did not localize the binding sites of cisplatin for c-MYC and PDGF-A folded oligonucleotides, although it is suggested that unassociated guanines on the formation of G-terad are more preferred for platination. After platination of these more accessible guanines, the excess cisplatin attacks another guanine, similar to that occuring for Tel-1 and Tel-2 [28]. It should not be overlooked that adenine in the con- nective loop can also be platinated, and therefore so too can oligomers where adenine was replaced by thymine (data not shown). However, oligomers d(G 3 T 3 )3G 3 , d(G 3 T 4 )3G 3 and d(G 4 T 3 )G 4 behave as uniformly as Tel-1 and Tel-2 oligomers. No principal discrepancies were observed, either by CD or TGGE. The experimental results obtained clearly demonstrate that platinum derivatives affect the compactness of the G-quadruplex structure. In addition, transplatin was used instead of cisplatin in the present study, but the results obtained confirmed that both platinum com- plexes significantly affect the G-quadruplex structure, regardless of whether a parallel or an antiparallel structure is formed. However, the experimental data do not offer a clear answer with respect to whether the monofunctional or bifunctional platinum adduct is mainly responsible for Tel-1 and Tel-2 destabilization. Nevertheless, the purification of these adducts and Fig. 4. Representative comparative inverted TGGE records of Tel-1 oligomer (top) and Tel-1-platinum complex (bottom) in 50 m M Tris– HCl pH 7.8 in the presence of 50 m M KCl. One molecule of cisplatin per Tel-1 was used. The gradient of temperature was per- pendicular to the electric field. Folded and unfolded G-quadruplex structures are indicated by dark and white arrows, respectively. The intermediate structure represents a ‘smear area’ marked by a double arrow. V. Viglasky Influence of platinum complexes on G-quadruplexes FEBS Journal 276 (2009) 401–409 ª 2008 The Author Journal compilation ª 2008 FEBS 405 subsequent mass spectrometry is required to clearly indicate the number of platinum complexes bound per oligonucleotide. A distinguishable G-quadruplex conformation after platination was expected, but the TGGE experiments did not confirm this fact. An increased population of misfolded structures characterized by various thermo- dynamic properties can be observed. On the other hand, the platination of guanine in the loop of the G-quadruplex could stabilize this form, probably due to DNA bending [17]. However, further investigations are currently in progress that aim to provide a clear answer about the structural stability of the G-quadru- plex containing platinable guanine in the connective loop. To date, determination of the G-quadruplex folding in the presence of platinum derivatives in K + solution remains unresolved. Experimental procedures DNA oligomers (sequences shown in Table 2) were obtained from Sigma-Aldrich (St Louis, MO, USA) and Biosearch Technologies, Inc. (Novato, CA, USA). All DNA oligomers were PAGE-purified and dissolved in dou- ble-distilled water before use. Acrylamide : bisacrylamide (19 : 1) solution and ammonium persulfate were purchased from Bio-Rad (Hercules, CA, USA), and N,N,N¢,N¢-tetra- methylethylenediamine was purchased from Fisher Slova- kia (Fisher Slovakia, Levoc ˇ a, Slovakia). T4 polynucleotide kinase was purchased from Promega (Madison, WI, USA). [c-32P]ATP was purchased from Amersham (Arlington Heights, IL, USA). Cisplatin and transplatin were obtained from Sigma-Aldrich. The stock solutions of the platinum complexes at a concentration of 5 · 10 )4 m in 10 mm KClO 4 were prepared under conditions of darkness at 25 °C. For platination, it is more suitable to use per- chloride instead of chloride salts to avoid chloride ions. A BC Fig. 5. (A) Proposed mechanism of G-tetrad destabilization by cisplatin. The first platinum molecule can destabilize any of the Hoogsteen pairings and the second cisplatin destabilizes an additional Hoogsteen pairing. Four cisplatin molecules per G-tetrad totally disrupt this struc- ture. The propensity of cisplatin binding to Tel-1 and c-MYC oligomers is indicated by arrows. The size of an arrow is proportional to the affinity of the platinum complex to attack N7 of the quinines. The schemes in (B) and (C) represent Tel-1 and c-MYC oligomers, respectively. The c-MYC oligomer contains three guanine residues located in loops of the G-quadruplex structure and five residues (gray arrows) that are not directly associated with the G-quadruplex structure, although these guanines are the most preferred for platination. The guanines out of the stack of G-quartets should react with electrophilic species such as platinum complexes. This explains why the platination G-quadruplexes formed from Tel-1 and Tel-2 are more sensitive than c-MYC and PDGF oligomers and, in addition, why these oligomers can be stabilized by platinum complexes. Influence of platinum complexes on G-quadruplexes V. Viglasky 406 FEBS Journal 276 (2009) 401–409 ª 2008 The Author Journal compilation ª 2008 FEBS Single-strand concentrations were determined by measuring the absorbance (260 nm) at high temperature. The concen- tration of DNA was determined by UV measurements carried out on Varian Cary 300 Bio UV–visible spectro- photometer (Amedis, Bratislava, Slovakia). Cells with opti- cal path lengths of 10 mm were used, and the temperature of the cell holder was controlled by an external circulating water bath. CD spectroscopy CD spectra were recorded on a Jasco J-810 spectropolarime- ter (Jasco Inc., Easton, MD, USA) equipped with a PTC-423L temperature controller using a quartz cell of 1 mm optical path length and an instrument scanning speed of 100 nmÆmin )1 , with a response time of 2 s, over a wave- length range of 220–320 nm. The scan of the buffer alone was subtracted from the average scan for each sample. CD spectra were collected in units of millidegrees versus wave- length and normalized to the total species concentrations. The cell-holding chamber was flushed with a constant stream of dry nitrogen gas to avoid water condensation on the cell exterior. All DNA samples were dissolved and diluted in Tris–HCl buffer (50 mm, pH 7.8) and, where appropriate, the samples contained different concentrations of KCl (KClO 4 ). The amount of DNA oligomers used in the experi- ment was maintained at D 220–330 in the range 0.2–0.8, and the CD data represent three averaged scans taken at an experi- mental temperature (25–90 °C). All CD spectra are baseline- corrected for signal contributions due to the buffer. Labeling and purification The DNA oligomers were 5¢-end-labeled with [c 32 P]ATP using T4 polynucleotide kinase for 45 min at 37 °C. The labeling reaction was inactivated by heating the samples at 90 °C for 5 min after the addition of 1.5 lL of 0.5 m EDTA. The 5¢-end labeled DNA was then purified using a Bio-Spin 6 chromatography column (Bio-Rad). Platination of oligonucleotides For 5¢-end-radiolabeled oligonucleotides, the same proce- dure was used as described previously [29]. Oligomers in the presence of potassium form a quadruplex structure as confirmed in CD measurements. To avoid any multimeric form, the oligomers were heated before platination to 95 °C and cooled slowly to achieve a final temperature 37 °C within 1 h. Unlabeled oligonucleotides and platinum com- plexes were mixed at ratio 1 : 1, 1 : 4, 1 : 12 and 1 : 16 in 10 mm KClO 4 . The reaction was performed overnight at 37 °C in a volume of 10 lL. The reaction products were purified on 20% denaturing gel electrophoresis and desalted on a Sephadex G25 column. At least six to nine different bands after denaturing gel electrophoresis were observed, as described previously [29]. Only one intensive but ‘smeared’ band was observed under nondenaturing conditions, and this was used for all the CD and TGGE experiments; no additional purification of DNA conformers has been applied. TGGE TGGE was performed using the same equipment as described previously [30]. A temperature gradient was gen- erated in the gel in a direction perpendicular to that of the electrical field. The gradient was established on a copper plate placed adjacent to the electrophoretic apparatus by cooling and heating its opposing ends with two indepen- dently circulating water baths. DNA samples were run through 15% total polyacrylamide gels [19 : 1 acrylamide: bis(acrylamide)] buffered with 50 mm Tris–HCl (pH 7.8) for 4 h at 6 VÆcm )1 . The dried gel was exposed on a phos- phor screen. Visualization was performed using a phos- phorimager (Storm 820; Molecular Dynamics, Sunnyvale CA, USA) and imagetools, version 2.1 (available at: http://ddsdx.uthscsa.edu/dig/itdesc.html). Digital image pro- cessing was used to determine an objective curve consisting of the darkest points of the electrophoretic records of the deformed electrophoretic band representing the dependence of DNA mobility on temperature [30]. Acknowledgements This study was supported by grants from the Slovak Grant Agency (1 ⁄ 1274 ⁄ 04 and 1 ⁄ 3254 ⁄ 06) and the Science and Technology Assistance Agency (APVT- 20-006604). I would like to thank Gavin Cowper and Lenka Sieber for critically reading and correcting the manuscript, my student Lubos Bauer and Professor Vik- tor Brabec for the opportunity to work in his laboratory and obtain skills with respect to DNA platination. References 1 Huppert JL & Balasubramanian S (2005) Prevalence of quadruplexes in the human genome. Nucleic Acids Res 33, 2908–2916. Table 2. Deoxyoligonucleotides used in the present study. Tel-1 is derived from human telomere and Tel-2 is derived from Oxytricha telomere. Name Sequence of DNA oligomers (5¢-to3¢) Tel-1 GGGTTAGGGTTAGGGTTAGGG Tel-2 GGGGTTTGGGGTTTGGGGTTTGGGGG c-MYC TGGGGAGGGTGGGGAGGGTGGGGAAGG PDGF-A GGAGGCGGGGGGGGGGGGGCGGGGGCGGGGGCGGGG GAGGGGCGCGGC V. Viglasky Influence of platinum complexes on G-quadruplexes FEBS Journal 276 (2009) 401–409 ª 2008 The Author Journal compilation ª 2008 FEBS 407 2 Neidle S & Parkinson GN (2003) The structure of telo- meric DNA. Curr Opin Struct Biol 13, 275–283. 3 Ambrus A, Chen D, Dai J, Bialis T, Jones RA & Yang D (2006) Human telomeric sequence forms a hybrid- type intramolecular G-quadruplex structure with mixed parallel ⁄ antiparallel strands in potassium solution. Nucleic Acids Res 34, 2723–2735. 4 Schaffitzel C, Berger I, Postberg J, Hanes J, Lipps HJ & Plu ¨ ckthun A (2001) In vitro generated antibodies spe- cific for telomeric guanine-quadruplex DNA react with Stylonychia lemnae macronuclei. Proc Natl Acad Sci USA 98, 8572–8577. 5 Granotier C, Pennarun G, Riou L, Hoffschir F, Gau- thier LR, De Cian A, Gomez D, Mandine E, Riou JF, Mergny JL et al. (2005) Preferential binding of a G-quadruplex ligand to human chromosome ends. Nucleic Acids Res 33, 4182–4190. 6 Siddiqui-Jain A, Grand CL, Bearss DJ & Hurley LH (2002) Direct evidence for a G-quadruplex in a pro- moter region and its targeting with a small molecule to repress c-MYC transcription. Proc Natl Acad Sci USA 99, 11593–11598. 7 Belotserkovskii BP, De Silva E, Tornaletti S, Wang G, Vasquez KM & Hanawalt PC (2007) A triplex-forming sequence from the human c-MYC promoter interferes with DNA transcription. J Biol Chem 282, 32433– 32441. 8 Rankin S, Reszka AP, Huppert J, Zloh M, Parkinson GN, Todd AK, Ladame S, Balasubramanian S & Neidle S (2005) Putative DNA quadruplex formation within the human c-kit oncogene. J Am Chem Soc 127, 10584–10589. 9 DeArmond R, Wood S, Sun D, Hurley LH & Ebbing- haus SW (2005) Evidence for the presence of a guanine quadruplex forming region within a polypurine tract of the hypoxia inducible factor 1alpha promoter. Biochem- istry 44, 16341–16350. 10 Dai J, Dexheimer TS, Chen D, Carver M, Ambrus A, Jones RA & Yang DJ (2006) An intramolecular G-quadruplex structure with mixed parallel ⁄ antiparallel G-strands formed in the human BCL-2 promoter region in solution. Am Chem Soc 128, 1096–1098. 11 Sun D, Guo K, Rusche JJ & Hurley LH (2005) Facili- tation of a structural transition in the polypurine ⁄ poly- pyrimidine tract within the proximal promoter region of the human VEGF gene by the presence of potassium and G-quadruplex-interactive agents. Nucleic Acids Res 33, 6070–6080. 12 Haider SM, Parkinson GN & Neidle S (2003) Structure of a G-quadruplex–ligand complex. J Mol Biol 326, 117–125. 13 Patel DJ, Phan AT & Kuryavyi V (2007) Human telo- mere, oncogenic promoter and 5¢-UTR G-quadruplexes: diverse higher order DNA and RNA targets for cancer therapeutics. Nucleic Acids Res 35, 7429–7455. 14 DeCian A, Cristofari G, Reichenbach P, DeLemos E, Monchaud D, Teulade-Fichou MP, Shin-Ya K, Lacroix L, Lingner J & Mergny JL (2007) Reevaluation of telo- merase inhibition by quadruplex ligands and their mechanisms of action. Proc Natl Acad Sci USA 104, 17347–17352. 15 DeCian A & Mergny JL (2007) Quadruplex ligands may act as molecular chaperones for tetramolecular quadruplex formation. Nucleic Acids Res 35, 2483–2493. 16 Qin Y & Hurley LH (2008) Structures, folding patterns, and functions of intramolecular DNA G-quadruplexes found in eukaryotic promoter regions. Biochimie 90 , 1149–1171. 17 Qin Y, Rezler EM, Gokhale V, Sun D & Hurley LH (2007) Characterization of the G-quadruplexes in the duplex nuclease hypersensitive element of the PDGF-A promoter and modulation of PDGF-A promoter activ- ity by TMPyP4. Nucleic Acids Res 35, 7698–7713. 18 Burger AM, Double JA & Newell DR (1997) Inhibition of telomerase activity by cisplatin in human testicular cancer cells. Eur J Cancer 3, 638–644. 19 Ishibashi T & Lippard SJ (1998) Telomere loss in cells treated with cisplatin. Proc Natl Acad Sci USA 95, 4219–4223. 20 Jamieson ER & Lippard SJ (1999) Structure, recogni- tion, and processing of cisplatin-DNA adducts. Chem Rev 99, 2467–2498. 21 Wang D & Lippard SJ (2005) Cellular processing of plati- num anticancer drugs. Nat Rev Drug Discov 4, 307–320. 22 Ourliac Garnier I & Bombard S (2007) GG sequence of DNA and the human telomeric sequence react with cis- diammine-diaquaplatinum at comparable rates. J Inorg Biochem 101, 514–524. 23 Chang CC, Chien CW, Lin YH, Kang CC & Chang TC (2007) Investigation of spectral conversion of d(TTAGGG) 4 and d(TTAGGG) 13 upon potassium titration by a G-quadruplex recognizer BMVC mole- cule. Nucleic Acids Res 35, 2846–2860. 24 Phan AT & Patel DJ (2003) Two-repeat human telo- meric d(TAGGGTTAGGGT) sequence forms intercon- verting parallel and antiparallel G-quadruplexes in solution: Distinct topologies, thermodynamic properties, and folding ⁄ unfolding kinetics. J Am Chem Soc 125, 15021–15027. 25 Miyoshi D, Nakao A & Sugimoto N (2003) Structural transition from antiparallel to parallel G-quadruplex of d(G 4 T 4 G 4 ) induced by Ca 2+ . Nucleic Acids Res 31 , 1156–1163. 26 Murashima T, Sakiyama D, Miyoshi D, Kuriyama M, Yamada T, Miyazawa T & Sugimoto N (2008) Cationic porphyrin induced a telomeric DNA to G-quadruplex form in water. Bioinorg Chem Appl 29, 47–56. 27 Li W, Wu P, Ohmichi T & Sugimoto N (2002) Charac- terization and thermodynamic properties of quadru- plex ⁄ duplex competition. FEBS Lett 526, 77–81. Influence of platinum complexes on G-quadruplexes V. Viglasky 408 FEBS Journal 276 (2009) 401–409 ª 2008 The Author Journal compilation ª 2008 FEBS 28 Bertrand H, Bombard S, Monchaud D & Teulade- Fichou MP (2007) A platinum–quinacridine hybrid as a G-quadruplex ligand. J Biol Inorg Chem 12, 1003– 1014. 29 Redon S, Bombard S, Elizondo-Riojas MA & Chottard JC (2003) Platinum cross-linking of adenines and gua- nines on the quadruplex structures of the AG3(T2AG3)3 and (T2AG3)4 human telomere sequences in Na + and K + solutions. Nucleic Acids Res 15, 1605–1613. 30 Vı ´ glasky´ V, Antalı ´ k M, Bagel’ova ´ J, Tomori Z & Podhradsky´ D (2000) Heat-induced conformational transition of cytochrome c observed by temperature gradient gel electrophoresis at acidic pH. Electrophoresis 21, 850–858. V. Viglasky Influence of platinum complexes on G-quadruplexes FEBS Journal 276 (2009) 401–409 ª 2008 The Author Journal compilation ª 2008 FEBS 409 . Platination of telomeric sequences and nuclease hypersensitive elements of human c-myc and PDGF-A promoters and their ability to form G-quadruplexes Viktor. cell aging, death and carcinogenesis. The telomeric regions of DNA and nucle- ase hypersensitive elements of human c-myc and PDGF-A promoters repre- sent