Mixed lineage kinase LZK and antioxidant protein-1 activate NF-jB synergistically Megumi Masaki, Atsushi Ikeda, Eriko Shiraki, Shogo Oka and Toshisuke Kawasaki Department of Biological Chemistry and CREST (Core Research for Educational Science and Technology) Project, Japan Science and Technology Corporation, Graduate School of Pharmaceutical Sciences, Kyoto University, Kyoto, Japan Leucine zipper-bearing kinase (LZK) is a novel member of the mixed lineage kinase (MLK) family [Sakuma, H., Ikeda, A.,Oka,S.,Kozutsumi,Y.,Zanetta,J.P.,andKawasaki,T. (1997) J. Biol. Chem. 272, 28622–28629]. We have previously shown that LZK activates the c-Jun-NH 2 terminal kinase (JNK) pathway, but not the extracellular signal-related kinase (ERK) pathway, by acting as a mitogen-activated protein kinase kinase kinase (MAPKKK) [Ikeda, A., Hasegawa, K., Masaki, M., Moriguchi, T., Nishida, E., Kozutsumi, Y., Oka, S., and Kawasaki, T. (2001) J. Bio- chem. 130, 773–781]. However, the mode of activation of LZK remains largely unknown. By means of a yeast two-hybrid screening system, we have identified a molecule localized to mitochondria, antioxidant protein-1 (AOP-1), that binds to LZK and which acts as a modulator of LZK activity. Recently, several MAPKKKs involved in the JNK pathway, such as MEKK1, TAK1 and MLK3, were shown, using over-expression assay systems, to activate a tran- scription factor, NF-jB, through activation of the IKK complex. Using similar assay systems, we demonstrated that LZK activated NF-jB-dependent transcription through IKK activation only weakly, but this was reproducible, and that AOP-1 enhanced the LZK-induced NF-jB activation. We also provided evidence that LZK was associated directly with the IKK complex through the kinase domain, and that AOP-1 was recruited to the IKK complex through the binding to LZK. Keywords: antioxidant protein; JNK/SAPK pathway; MLK; NF-jB; yeast two-hybrid system. The JNK/SAPK pathway is one of the major signal transduction pathways activated when cells are exposed to inflammatory cytokines or stress [1–5]. Similar to other MAP kinase (MAPK) pathways, the JNK pathway involves at least three types of protein kinases, MAPK, MAPK kinase (MAPKK) and MAPKK kinase (MAP KKK). Upon activation, MAPKKK is first activated by an extracellular stimulus, and then phosphorylates and acti- vates MAPKK. The activated MAPKK phosphorylates MAPK at the conserved threonine and tyrosine residues within the kinase catalytic domain. The phosphorylated MAPK is then translocated to the nucleus, where it phosphorylates various target molecules, such as transcrip- tion factors, leading to regulation of gene expression. A number of MAPKKK in the JNK pathway, such as MEKK1 [6]; TGF-b activated kinase 1 (TAK1) [7]; apoptosis signal-regulated kinase 1 (ASK1) [8] and MLK family proteins [9–14], have been cloned and characterized from mammalian cells, but the physiological significance of these remains to be determined. We reported previously the molecular cloning and characterization of a novel MLK, leucine zipper-bearing kinase (LZK), from human brains [15]. Like other MLK family proteins, LZK contains a kinase catalytic domain, which is a hybrid between those of serine/threonine kinases and tyrosine kinases, followed by two short leucine zipper-like motifs called the Ôdual leucine zipper-like motifsÕ. LZK directly phosphorylates and acti- vates MKK7 (and SEK1/MKK4 to a lesser extent), leading to activation of JNK, indicating that LZK is a MAPKKK in the JNK pathway. LZK forms a dimer or oligomer in cells through its dual leucine zipper-like motif, and this dimerization/oligomerization is essential for LZK to acti- vate the JNK pathway [16]. Most MAPKKK molecules are thought to be in an inactive state when expressed in cells and to be activated when stimulated. However, MLKs, including LZK, readily activate the JNK pathway when expressed in cells and do not require any exogenous activators. Recently, the activity of MUK, one of the MLKs, which exhibits the highest sequence similarity to LZK, was shown to be regulated via binding to its inhibitor, MBIP1 [17]. This suggests that LZK might be regulated through association with other modu- lator(s) in cells. To identify these modulators for LZK, we performed yeast two-hybrid screening, and isolated a cDNA that encodes a thioredoxin peroxidase, AOP-1. Some MAPKKK are known to trigger NF-jB dependent transcription via phosphorylation and activation of the Correspondence to T. Kawasaki, Department of Biological Chemistry, Graduate School of Pharmaceutical Sciences, Kyoto University, Kyoto, Japan. Fax: + 81 75 753 4605, Tel.: + 81 75 753 4572, E-mail: kawasaki@pharm.kyoto-u.ac.jp Abbreviations: LZK, leucine zipper-bearing kinase; AOP-1, antioxidant protein-1; MLK, mixed lineage kinase; JNK, c-Jun NH 2 terminal kinase; MAPK, mitogen-activated protein kinase; MAPKK, MAPK kinase; MAPKKK, MAPKK kinase; MUK, MAPK-upstream kinase; DLK, dual leucine zipper-bearing kinase; IjB, inhibitor of NF-jB; MBIP1, MUK-binding inhibitory protein 1; IKK, IjB kinase; HA, hemagglutinin; GST, glutathione S-transferase; NaCl/P i , phosphate-buffered saline. (Received 1 July 2002, revised 23 October 2002, accepted 12 November 2002) Eur. J. Biochem. 270, 76–83 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03363.x IKK complex directly [18,19], or indirectly through another type of protein kinase such as NF-jB inducing kinase (NIK) [20]. Recently, MLK3 was shown to associate with the IKK complex, and to phosphorylate IKKa and IKKb directly [21]. In the present study, we demonstrate that LZK also associates with IKKb and the activated IKK complex. Interestingly, AOP-1 was recruited to the IKK complex via binding to LZK and enhanced the LZK-induced NF-jB activation. Experimental procedures Plasmids, antibodies and reagents The expression constructs of pcDNA His-LZK, a series of His-tagged LZK deletion mutants, were described previ- ously [16, 22]. To construct an expression vector for AOP-1, the full-length cDNA for the AOP-1 coding region was amplified by PCR, and then subcloned into the pEF Flag vector [22] with XbaIandBamHI restriction sites. The oligonucleotides used for PCR were; 5¢-CCCTCTAGAA TGGCGGCTGCTGTAGGACG-3¢ and 5¢-CCCGGATC CCTACTGATTTACCTTCTGAAAGTAC-3¢,assense and antisense primers, respectively. Expression construct pcDNA Myc/His-AOP-1, the full-length cDNA for the AOP-1 coding region, was amplified by PCR and subcloned into the pcDNA Myc/His vector (Invitrogene). The oligo- nucleotides used for PCR were: 5¢-TCCGAATTCATG GCGGCTGCTGTAGGAC-3¢ and 5¢-TCCAAGCTTCT GATTTACCTTCTGAAAGTAC-3¢,assenseandanti- sense primers, respectively. The expression vectors for antioxidation-negative AOP-1 point mutants were con- structed by PCR-based site-directed mutagenesis [23], TGT (C178) being converted into AGT (Ser) in the C178S mutant, and TGC (C229) into AGC (Ser) in the C229S mutant. The sequences of the oligonucleotides used for C178S and C229S were: 5¢-ATTTCACCTTTGTG AG TCCTACAGAAATTG-3¢ and 5¢-CACATGGAGAA GTC AGCCCAGCGAACTGGA-3¢, respectively. The mismatched nucleotides for mutagenesis are underlined. To construct pcDNA3.1 Flag-IKKb, the full-length cDNA for the IKKb coding region was amplified by PCR and then subcloned into the pcDNA 3.1vector (Invitrogene). Expres- sion construct pSRa HA-JNK was provided generously by E. Nishida [7,24,25]. pGEX-6P1 IjBa(1–54) was provided generously by K. Shimotohno [26]. Anti-His and Anti-HA Ig were purchased from Qiagen and Santa Cruz Biotech- nologies, respectively. Anti-Flag and anti-(phosphorylated JNK) Igs were from Sigma and Promega, respectively. A Matchmaker Yeast Two-Hybrid System 2 kit and a human pancreas cDNA library for two-hybrid screening were purchased from Clontech. Yeast two-hybrid assay Yeast two-hybrid screening was performed with yeast strain Y190 using the Matchmaker Two-Hybrid System 2 kit according to manufacturer’s protocol (Clontech). Briefly, the cDNA fragment coding the N-terminal half of LZK [LZK(1–558)] was fused to the pAS2-1 vector and then used as a bait construct to screen the human pancreas cDNA library. A total of 2.54 · 10 6 clones were analyzed, and positive clones were recovered and re-screened until a single colony was isolated. Cell culture and transfection COS7 cells were cultured and transfected as described previously [16]. HeLa cells were cultured in minimum essential medium (MEM) supplemented with 10% heat- inactivated fetal bovine serum and nonessential amino acids (Gibco BRL). For transfection, cells were subcultured and grown overnight, and then transfected transiently with various expression constructs using LipofectAMINE PLUS TM reagent (Gibco BRL) according to the manufac- turer’s protocol. After 24 h, the cells were subjected to either immunoprecipitation or Western blotting as described previously [16]. Reporter assay A reporter plasmid containing a synthetic NF-jB binding site was constructed as below. A double stranded DNA containing two NF-jB binding motifs was prepared by annealing the following oligonucleotides, and then sub- cloned into a luciferase reporter plasmid, Enhancer vector 2 (Promega) using HindIII and KpnI restriction sites. The sequences of the oligonucleotides used were: 5¢-C GGGGA ATCTCCGGATCCGGGGAATCTCCA-3¢ and 5¢-AGC TTGGAGATTCCCCGGATCCGGAGATTCCCCGGT AC-3¢.TheNF-jB binding sites are underlined. HeLa cells were transfected transiently with various expression plas- mids, the reporter plasmid and pRL-TK (which contains the Renilla reniformis luciferase gene under the control of the HSV-thymidine kinase promoter) as an internal control. After 30 h, the cells were washed with phosphate-buffered saline, followed by a dual-luciferase assay according to the manufacturer’s instructions (Promega). To measure luci- ferase activity, the fluorescence was measured for 30 s using a Luminometer (Lumat LB9501; Berthod Systems, Aliquippa, PA, USA). Preparation of GST-IjBa GST-IjBa(1–54) was produced in E. coli using a pGEX expression system (Amersham Pharmacia). GST-IjBa(1– 54) was purified with glutathione–sepharose beads. GST- IjBa(1–54) bound to the beads was eluted with a buffer comprising 20 m M glutathione, 50 m M Tris/HCl, pH 8.0, 2m M EDTA and 0.15 M NaCl. The eluted protein was dialyzed against a buffer comprising 20 m M Tris/HCl, pH 7.5, 1 m M EGTA and 1 m M dithiothreitol and stored at )20 °C until used. IKK kinase assay To measure the activity of IKK, an in vitro kinase assay was carried out as described previously [16]. Briefly, HeLa cells were transfected with pcDNA-IKKb, pEF-AOP-1 and pcDNA-LZK or pcDNA-LZK K195A and then lysed after 24 h. To equalize the amount of IKKb protein in the samples, aliquots of cell lysates were first subjected to West- ern blotting, followed by estimation of the amount of IKKb expressed in each sample by quantitative densitometry. Ó FEBS 2003 Synergistic activation of NF-jB by LZK and AOP-1 (Eur. J. Biochem. 270)77 The kinase reaction was carried out in kinase reaction buffer containing 0.5 lCi of [c- 32 P] and 5 lgofGST-IjBa(1–54) for 10 min at 30 °C. The phosphorylated GST-IjBa(1–54) protein was visualized with a Fuji BAS2000 scanner (Tokyo, Japan) after SDS/PAGE. Results Identification of AOP-1 as a molecule binding to LZK To determine the function of LZK, we employed a yeast two)hybrid system to search for proteins that bind to LZK. As a bait construct, the N-terminal half of LZK including the kinase catalytic domain (residues 1–558) was fused to the pAS2-1 vector, and then the fused vector was transfected into yeast strain Y 190. The transformant yeast was then transformed with a human pancreas cDNA library because LZK mRNA is expressed in the pancreas at the highest level [15]. Positive clones were selected by means of a colony-lift b-galactosidase filter assay. Sequence analysis of positive clones revealed that one clone contains an open reading frame encoding the C-terminal 35 amino acids of AOP-1 [23]. To confirm the binding of AOP-1 to LZK in mammalian cells, COS7 cells were transfected transiently with His-tagged LZK and Flag-tagged AOP-1, followed by immunoprecipitation with anti-His Ig. As shown in Fig. 1A, Flag-tagged AOP-1 was coimmunoprecipitaed with His- LZK, indicating that AOP-1 binds to full-length LZK in mammalian cells. Next we investigated the region of LZK responsible for the binding with AOP-1. The bait protein used for the yeast two-hybrid screening consisted of the 558 amino acids comprising the N-terminal region of LZK. We focused on the kinase domain and the leucine zipper-like motif as functional motifs in this region. A series of deletion His-tagged LZK mutants (Fig. 1B) was examined with regard to the ability to bind to AOP-1. As shown in Fig. 1C, the full-length LZK (LZK FL) and LZKDZip, a mutant that lacks the dual leucine zipper-like motif, were coimmu- noprecipitated with AOP-1 to similar extents. LZKDKD Zip, which lacks both the dual leucine zipper-like motif and the kinase domain, was also coimmunoprecipitated with AOP-1, but the amount of LZKDKD Zip coimmunopre- cipitated with AOP-1 was lower than those of LZK FL and LZKDZip. These results suggest that the N-terminal 167 amino acids in addition to the kinase domain are important for the interaction with AOP-1. We also constructed an expression vector of a LZK deletion mutant, which lacks the N-terminal region of LZK. However, the mutant LZK protein could not be detected in COS7 cells because of its instability (data not shown). Therefore, we concluded that the kinase domain and/or the N-terminal region of LZK are responsible for the interaction with AOP-1. Antioxidant activity of AOP-1 is not essential for its association with LZK The AOP-1 gene product was first identified as a molecule that exhibited a high sequence similarity to the mouse MER5 gene one, which belongs to a family of thioredoxin- dependent antioxidant proteins [23]. AOP-1 has two cysteine residues (C178 and C229) that are conserved in thioredoxin-dependent peroxidases and are essential for the antioxidant activity [27]. AOP-1 is believed to form a dimer within cells. When AOP-1 reduces reactive oxygen species, an intermolecular disulfide bond is formed between the two conserved cysteine residues of AOP-1 dimers [28]. To Fig. 1. AOP-1 associates with LZK in COS7 cells. (A) His-tagged LZK and/or Flag-tagged AOP-1 were coexpressed in COS7 cells. At 24 h post- transfection, the cells were lysed with lysis buffer. LZK was immunoprecipitated from the cell lysate with anti-His Ig and protein G-sepharose beads. The presence of Flag-AOP-1 in the immunoprecipitate was examined by Western blotting with anti-Flag Ig. Similarly, AOP-1 was immunopre- cipitated from the cell lysate using anti-Flag Ig. The presence of His-LZK in the immunoprecipitate was detected by Western blotting with anti-His Ig. The asterisk indicates the immunoglobulin light chain used for immunoprecipitation. The presence of Flag-AOP-1 and His-LZK in the cell lysate were examined by Western blotting with anti-Flag and anti-His Ig, respectively. (B) The deletion mutants used in this study are represented schematically. (C) Deletion mutants were coexpressed in COS7 cells with AOP-1 as indicated. After immunoprecipitation of AOP-1, the presence of His-LZK or a deletion mutantation in the immunoprecipitate was examined by Western blotting with anti-His Ig. The presence of His-LZK or a deletion mutantation and Flag-AOP-1 in each cell lysate was examined by Western blotting with anti-His and anti-Flag Ig. 78 M. Masaki et al. (Eur. J. Biochem. 270) Ó FEBS 2003 determine whether these conserved cysteine residues are necessary for AOP-1 to bind to LZK, we constructed point mutants in which one of the two conserved cysteine residues was mutated to a serine residue (AOP-1 C178S and C229S, respectively).AsshowninFig.2,bothAOP-1C178Sand C229S were effectively coimmunoprecipitated with LZK as well as wild-type AOP-1, indicating that these conserved cysteines are not essential for the binding of AOP-1 to LZK. AOP-1 has no effect on LZK-induced JNK activation As LZK is known to activate the JNK-1 pathway, we next examined whether AOP-1 modulates LZK-induced activa- tion of the JNK pathway. COS7 cells were cotransfected with HA-JNK and His-LZK, with or without Flag-AOP-1. The level of JNK activation in each transfectant was measured by Western blotting with anti-(phosphorylated JNK) Ig. As shown in Fig. 3, phosphorylation of JNK was observed in the presence of LZK, and coexpression of AOP- 1 did not have an apparent effect on the LZK-induced JNK activation (top panel). Note that the quantity of JNK expressed in each sample was almost identical (Fig. 3, second panel from the top). The increase in the amount of the AOP-1 expression plasmid relative to those of LZK and JNK was similar (data not shown). These results indicated that AOP-1 has essentially no effect on the activity of LZK as a MAPKKK in the JNK pathway. AOP-1 enhances LZK-induced NF-jB activation Recently, it was reported that several MAPKKKs, such as TAK1, MEKK1 and MLK3, activate signal transduction pathways leading to NF-jB activation as well as the JNK pathway [18–21]. Thus, we examined whether or not LZK activates endogenous NF-jB-dependent transcription by means of a luciferase reporter assay. HeLa cells were cotransfected with a reporter construct, which expresses Photinus pysralis luciferase under the control of NF-jB, and either wild type or kinase negative mutant LZK, and then the luciferase activity was measured as described under Experimental procedures. As shown in Fig. 4 (lanes 1–3), NF-jB dependent transcription was triggered reproducibly by the expression of wild-type LZK (1.4-fold increase), in contrast, the expression of inactive kinase LZK (LZK K195A) failed to trigger NF-jB dependent transcription. This indicates that the LZK-induced NF-jB activation is dependent on the kinase activity of LZK. We also examined the effect of AOP-1 expression on the LZK induced NF-jB activation. As shown in Fig. 4 (lanes 4–6), the expression of AOP-1hadaverylittleeffectontheNF-jB-dependent transcription (1.2-fold). Interestingly, when coexpressed with wild type LZK, AOP-1 significantly enhanced the LZK-induced NF-jB-dependent transcription (2.4-fold). The enhanced activation by AOP-1 was not detected on Fig. 2. Antioxidant activity of AOP-1 is not essential for binding to LZK. His-LZK was coexpressed in COS7 cells with wild type or point mutant AOP-1. After immunoprecipitation of LZK with anti-His Ig, the presence of AOP-1 in the immunoprecipitate was examined by Western blotting with anti-Flag Ig (top panel). The amounts of LZK (middle panel) and AOP-1 (bottom panel) in each cell lysate were determined by Western blotting with anti-His and anti-Flag Ig, respectively. Fig. 3. Co-expression of AOP-1 has no effect on LZK-induced JNK activation. His-LZK and HA-JNK were coexpressed, with or without Flag-AOP-1. At 24 h post-transfection, the cells were lysed by the addition of the SDS/PAGE sample buffer, and then the amount of dually phosphorylated JNK was determined by Western blotting with anti-(phosphorylated JNK) Ig (top panel). To determine the total amount of JNK expressed in each transfection, the same samples were analyzed by Western blotting with anti-HA Ig (second panel). The amounts of LZK and AOP-1 in each lysate were determined by Western blotting with anti-His and anti-Flag Ig, respectively (third and bottom panels). Ó FEBS 2003 Synergistic activation of NF-jB by LZK and AOP-1 (Eur. J. Biochem. 270)79 coexpression with inactve kinase LZK. These results, taken together, suggest that LZK activates NF-jB, and that AOP- 1 enhances this signal transduction pathway synergistically. To determine whether this effect is specific for AOP-1, we examined the effect of another thioredoxine-dependent peroxidase, AOE372, which exhibits high sequence similar- ity to AOP-1 [29]. AOE372 had no effect on the LZK- induced NF-jB activation, although AOE372 was coimmunoprecipitated with LZK when coexpressed in COS7 cells (data not shown). Therefore, we concluded that AOP-1 has a specific function as an enhancer of LZK- induced NF-jB activation. LZK activates the IjB kinase complex It is well known that NF-jBiskeptinactiveinthe cytoplasm through the formation of a complex with its inhibitor, IjB. Upon activation, IjB is first phosphorylated by a protein kinase complex called the IjB kinase (IKK) complex and then degraded. The degradation of IjBresults in the translocation of NF-jB to the nucleus and the transcriptional activation of target genes [30,31]. As LZK triggered the transcriptional activity of NF-jB, as described above, we examined whether LZK could activate the IKK complex or not. HeLa cells were transfected transiently with His-tagged LZK, Myc-tagged AOP-1 and Flag-tagged IKKb, one component of the IKK complex. At 24 h post-transfection, the cells were lysed and IKKb activity was determined as described under Experimental procedures. As expected, IKKb activity was increased in the cells transfect- ed with wild-type LZK (Fig. 5). In contrast, the LZK inactive kinase mutant, K195A, failed to activate the IKK complex. These results indicated that LZK activates the IKK complex and that this activation is dependent on the kinase activity of LZK. We further examined the effect of AOP-1 on the LZK-induced IKK activation. In cells cotransfected with AOP-1 and LZK, IKK activity was almost the same as that in cells transfected with LZK alone (Fig. 5), indicating that AOP-1 has no significant effect on the LZK-induced IKK activation under the experimental conditions used. LZK associates with the IjB kinase complex As LZK triggered the transcription activity of NF-jB through activation of the IKK complex, we then examined whether or not LZK physically associated with IKKb. COS7 cells were transfected with His-tagged LZK, Myc- tagged AOP-1 and Flag-tagged IKKb, followed by immu- noprecipitation with anti-Flag Ig to pull down the IKKb. Coimmunoprecipitated proteins were detected by Western blotting with antibodies against epitope tags (Fig. 6A). LZK was coimmunoprecipitated with IKKb regardless of Fig. 5. LZK activates NF-jB through the IjB kinase complex. HeLa cells were cotransfected with pcDNA-IKKb, pEF-AOP-1 and pcDNA-LZK or pcDNA-LZK K195A, as indicated. At 24 h post- transfection, the cells were lysed and the amount of IKKb was deter- mined as described under Experimental procedures. An equal amount of IKKb was subjected to in vitro kinase assaying in the presence of [c- 32 P]ATP and GST-IjBa(1–54). A representive autoragiogram is shown (top panel). The amount of GST- IjBa(1–54) included in each reaction mixture as a substrate is indicated (second panel from the top). The amounts of LZK (third panel from the top) and AOP-1 (bottom panel) expressed in the cells were determined by Western blotting with anti-His and anti-Myc Ig, respectively. 0 0.5 1 1.5 2 2.5 3 3.5 1 1.4 2.4 1.4 3.30.9 1 .2 A OP-1 L ZK L ZKK195A + ++ + + + TPA + Fig. 4. AOP-1 enhances LZK-induced NF-jB activation. HeLa cells were cotransfected with 2 · NF-jB-Luc reporter plasmid (0.8 lg), pRL TK (0.2 lg), pEF Flag AOP-1 (0.5 lg) and pcDNA His-LZK or pcDNAHis-LZK K195A (0.5 lg),asindicated.After30h,luciferase activity was assayed as described under Experimental procedures. The luciferase activity of each transfection is expressed as fold activation. Bars show the means + SD of three independent experiments, expressed in arbitrary units adjusted to the mean of a negative control (lane 1) as one unit. As a positive control, cells were treated with 25 ngÆmL )1 12-O-tetradecanoylphorbol 13-acetate for 8 h. Note that coexpression of AOP-1 enhanced significantly LZK-induced NF-jB activation under the experimental condition used. 80 M. Masaki et al. (Eur. J. Biochem. 270) Ó FEBS 2003 the presence or absence of AOP-1 (lanes 1 and 2). AOP-1 was coimmunoprecipitated with IKKb only in the presence of LZK (lane 2, second panel from the top). Thus, LZK is associated directly with the IKK complex but AOP-1 can be included in the IKK complex in the presence of LZK. The region of LZK necessary for the association with IKKb was examined by means of an immunoprecipitation assay with a series of His-tagged LZK mutants (Fig. 1B). As shown in Fig. 6B, LZKDZip, was coimmunoprecipitated with IKKb, but LZKDKD Zip was not coimmunoprecipitated with it, suggesting that LZK associates with IKKb through its kinase domain. Discussion In this study, we identified AOP-1 as a modulator of LZK activity by means of a yeast two-hybrid system. We demonstrated that LZK can trigger NF-jB dependent transcription by increasing IKK activity. AOP-1 enhanced LZK-induced NF-jB activation but did not affect LZK- induced JNK activation. This is the first evidence that a MAPKKK in the JNK signaling pathway, LZK, and an antioxidant protein, AOP-1, synergistically enhance the NF- jB signaling pathway. Thus, AOP-1 may have the ability to regulate the flow of intracellular signaling of LZK to the NF-jB signaling pathway rather than to the JNK pathway. AOP-1 was first identified as a molecule that exhibits sequence similarity to mouse MER5, which is localized in mitochondria. AOP-1 has also been shown to be localize in mitochondria [27]. While LZK is known to be localized in the cytoplasm. Recently, however, the association of AOP-1 with a cytosolic protein that inhibits AOP-1 activity was reported[27].Thus,LZKmightalsointeractwithAOP-1 under physiological conditions. On the other hand, it is well known that mitochondrial proteins are present in the cytoplasm under apoptotic conditions. Therefore, it is possible that LZK associates with AOP-1 under some pathogenic conditions, such as apoptosis, and activates the NF-jB pathway to prevent apoptosis. It has been reported that several MAPKKKs, such as TAK1, MEKK1 and MLK3, activate the NF-jB pathway as well as the JNK pathway [18–21]. MLK3 has been shown to associate with the IKK complex, and to phosphorylate directly, IKKa and IKKb. In contrast, TAK1 and MEKK1 are known to trigger NF-jB dependent transcription via phosphorylation and activation of the IKK complex indirectly through other protein kinases, such as NF-jB inducing kinase (NIK) [20]. As LZK also interacted with IKKb and the interaction resulted in increases in IKKb activity and NF-jB transcription, we examined the possi- bility that LZK phosphorylates directly, IKKb.However, we could not detect kinase activity of LZK towards IKKb (data not shown), suggesting that LZK activates the IKK complex through other protein kinase(s), such as NIK. AOP-1 triggered NF-jB dependent transcription and enhanced LZK-induced NF-jB activation (Fig. 4), while AOP-1 had no apparent effect on IKK activation, as judged by an in vitro kinase assay (Fig. 5). At present we have no experimental data that explain this apparent discrepancy. However, AOP-1 is an antioxidant protein and functions as a thioredoxin-dependent peroxidase, which scavenges reactive oxygen species such as H 2 O 2 in the presence of thioredoxine. It has been reported that H 2 O 2 reduces cytokine-induced NF-jB activation through oxidative inactivation of IKK [40]. AOP-1 recruited to the IKK Fig. 6. LZK is associated with the IjB kinase complex. (A) His-tagged LZK, Myc-tagged AOP-1 and Flag-tagged IKKb were coexpressed in COS7 cells. After 24 h post-transfection, the cells were lysed with lysis buffer, and IKKb was immunoprecipitated from the cell lysate with anti-Flag Ig and protein G Sepharose beads. The presence of His-LZK and Myc-AOP-1 in the IKKb immunoprecipitate was examined by Western blotting with anti-His and anti-Myc Ig, respectively. The asterisk indicates the immunoglobulin light chain used for immuno- precipitation. The amounts of both Myc-AOP-1 and His-LZK expressed in the cells were also determined by Western blotting. (B) Various deletion mutations were coexpressed in COS7 cells with IKKb, as indicated. After immunoprecipitation of IKKb, the presence of His-LZK or a deletion mutation in the immunoprecipitate was examined by Western blotting with anti-His Ig. The presence of His- LZK or a deletion mutation and Flag-IKKb in each cell lysate were examined by Western blotting with anti-His or anti-Flag Ig. Ó FEBS 2003 Synergistic activation of NF-jB by LZK and AOP-1 (Eur. J. Biochem. 270)81 complex through LZK might protect the IKK complex from oxidative inactivation by the removal of H 2 O 2 in cells resulting in the triggering of NF-jB dependent transcription (Fig. 4). Thus, AOP-1 may prevent the inactivation of IKK by H 2 O 2 , but not activate IKK itself. From this point of view, the in vitro kinase assay conditions used might have cancelled out the effect of AOP-1 on IKK activity because the assay was performed under reducing conditions (i.e. in the presence of dithiothreitol). However, another thio- redoxine-dependent peroxidase, AOE372, exhibiting high sequence similarity to AOP-1 [29], had no effect on LZK- induced NF-jB activation, even though AOE372 was coimmunoprecipitated with LZK. These results suggest that we can not exclude the possibility that AOP-1 may have unidentified new functions in addition to that of a thiore- doxin-dependent peroxidase. In some types of cells such as neurons, it is known that activation of the JNK pathway leads to apoptotic cell death [34–36]. In fact, MLK family kinases including LZK are expressed in neuronal cells [15, 37–39], and MLK2 and MLK3 play important roles in activation of the JNK pathway leading to neuronal apoptosis in response to kainate [36]. In contrast, the activation of NF-jBcan protect cells from death by triggering the gene expression of Bcl2 family proteins and inhibitors of the JNK/SAPK pathway [32,33]. As described above, LZK triggered NF- jB-dependent transcription (as well as the JNK pathway) and AOP-1 enhanced the LZK-induced NF-jB activation. These results suggest that the association of LZK with AOP-1 might be important for preventing LZK-induced apoptotic cell death and for ensuring activation of the JNK pathway by LZK without cell death. We demonstrated previously that LZK binds to a scaffold protein, JIP-1, which is also associated with downstream effectors, MKK7 and JNK, in the JNK pathway. Owing to the physical proximity of LZK and its effectors (MKK7 and JNK) on JIP-1, LZK is able to activate JNK with higher efficiency [22]. Thus, JIP-1 positively modulates LZK activity as a MAPKKK in the JNK pathway. On the other hand, AOP-1 has no effect on the JNK pathway but enhances LZK-induced NF-jB, suggesting that the signal transduction pathway from LZK could be dependent on the binding partner, such as JIP-1 and AOP-1. Acknowledgements We wish to thank Drs E. Nishida and K. Shimotohno for the generous gifts of the plasmids used in this study. This work was supported in part by a Grant-in-Aid for Scientific Research from the Japan Society for the Promotion of Sciences. A. I. was the recipient of a Research Fellowship from the Japan Society for the Promotion of Science for Young Scientists. References 1. Kyriakis, J.M., Banerjee, P., Nikolakaki, E., Dai, T., Rubie, E.A., Ahmad, R.F., Avruch, J. & Woodgett, J.R. (1994) The stress- activated protein kinase subfamily of c-Jun kinases. Nature 369, 156–160. 2. Derijard,B.,Hibi,M.,Wu,I H.,Barrett,T.,Su,B.,Deng,T., Karin, M. & Davis, R.J. (1994) JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain. Cell 76, 1025–1037. 3. Han, J., Lee, J.D., Bibbs, L. & Ulevitch, R.J. (1994) A MAP kinase targeted by endotoxin and hyperosmolarity in mammalian cells. Science 265, 808–811. 4. Lee, J.C., Laydon, J.T., McDonnell, P.C., Gallagher, T.F., Kumar, S., Green, D., McNulty, D., Blumenthal, M.J., Heys, J.R., Land- vatter, S.W. et al. (1994) A protein kinase involved in the regulation of inflammatory cytokine biosynthesis. Nature 372, 739–746. 5. Ip, Y.T. & Davis, R.J. (1998) Signal transduction by the c-Jun N-terminal kinase (JNK) – from inflammation to development. Curr. Opin. Cell Biol. 10, 205–219. 6. Minden, A., Lin, A., McMahon, M., Lange-Carter, C.D., Derij- ard, B., Davis, R.J., Johnson, G.L. & Karin, M. (1994) Differ- ential activation of ERK and JNK mitogen-activated protein kinases by Raf-1 and MEKK. Science 266, 1719–1723. 7. Yamaguchi, K., Shirakabe, K., Shibuya, H., Irie, K., Oishi, I., Ueno, N., Taniguchi, T., Nishida, E. & Matsumoto, K. (1995) Identification of a member of the MAPKKK family as a potential mediator of TGF-beta signal transduction. Science 270, 2008– 2011. 8. Ichijo, H., Nishida, E., Irie, K., ten Dijke, P., Saitoh, M., Moriguchi, T., Takagi, M., Matsumoto, K., Miyazono, K. & Gotoh, Y. (1997) Induction of apoptosis by ASK1, a mammalian MAPKKK that activates SAPK/JNK and p38 signaling path- ways. Science 275, 90–94. 9. Hirai, S., Izawa, M., Osada, S., Spyrou, G. & Ohno, S. (1996) Activation of the JNK pathway by distantly related protein kinases, MEKK and MUK. Oncogene 12, 641–650. 10. Fan, G., Merritt, S.E., Kortenjann, M., Shaw, P.E. & Holzman, L.B. (1996) Dual leucine zipper-bearing kinase (DLK) activates p46SAPK and p38mapk but not ERK2. J. Biol. Chem. 271, 24788–24793. 11. Hirai, S., Katoh, M., Terada, M., Kyriakis, J.M., Zon, L.I., Rana, A., Avruch, J. & Ohno, S. (1997) MST/MLK2, a member of the mixed lineage kinase family, directly phosphorylates and activates SEK1, an activator of c-Jun N-terminal kinase/stress-activated protein kinase. J. Biol. Chem. 272, 15167–15173. 12. Rana, A., Gallo, K., Godowski, P., Hirai, S., Ohno, S., Zon, L., Kyriakis, J.M. & Avruch, J. (1996) The mixed lineage kinase SPRK phosphorylates and activates the stress-activated protein kinase activator, SEK-1. J. Biol. Chem. 271, 19025–19028. 13. Tibbles, L.A., Ing, Y.L., Kiefer, F., Chan, J., Iscove, N., Woodgett, J.R. & Lassam, N.J. (1996) MLK-3 activates the SAPK/JNK and p38/RK pathways via SEK1 and MKK3/6. EMBO J. 15, 7026–7035. 14. Teramoto, H., Coso, O.A., Miyata, H., Igishi, T., Miki, T. & Gutkind, J.S. (1996) Signaling from the small GTP-binding pro- teins Rac1 and Cdc42 to the c-Jun N-terminal kinase/stress-acti- vated protein kinase pathway. A role for mixed lineage kinase 3/protein-tyrosine kinase 1, a novel member of the mixed lineage kinase family. J. Biol. Chem. 271, 27225–27228. 15. Sakuma, H., Ikeda, A., Oka, S., Kozutsumi, Y., Zanetta, J.P. & Kawasaki, T. (1997) Molecular cloning and functional expression of a cDNA encoding a new member of mixed lineage protein kinase from human brain. J. Biol. Chem. 272, 28622–28629. 16. Ikeda, A., Masaki, M., Kozutsumi, Y., Oka, S. & Kawasaki, T. (2001) Identification and characterization of functional domains in mixed lineage kinase LZK. FEBS Lett. 488, 190–195. 17. Fukuyama, K., Yoshida, M., Yamashita, A., Deyama, T., Baba,M.,Suzuki,A.,Mohri,H.,Nakajima,H.,Hirai,S.& Ohno, S. (2000) MAPK upstream kinase (MUK)-binding inhibitor protein, a negative regulator of MUK/dual leucine zip- per-bearing kinase/leucine zipper protein kinase. J. Biol. Chem. 275, 21247–21254. 82 M. Masaki et al. (Eur. J. Biochem. 270) Ó FEBS 2003 18. Nakano, H., Shindo, M., Sakon, S., Nishinaka, S., Mihara, M., Yagita, H. & Okumura, K. (1998) Differential regulation of IjB kinase a and b by two upstream kinases, NFjB-inducing kinase and mitogen-activated protein kinase/ERK kinase kinase-1. Proc. NatlAcad.Sci.USA95, 3537–3542. 19. Lee, F.S., Peters, R.T., Dang, L.C. & Maniatis, T. (1998) MEKK1 activates both IjBkinasea and b. Proc. Natl Acad. Sci. USA 95, 9319–9324. 20. Ninomiya-Tsuji, J., Kishimoto, K., Hiyama, A., Inoue, J., Cao, Z. & Matsumoto, K. (1999) The kinase TAK1 can activate the NIK- IjB as well as the MAP kinase cascade in the IL-1 signaling pathway. Nature 398, 252–256. 21. Hehner, S.P., Hofmann, T.G., Ushmorov, A., Dienz, O., Leung, I.W., Lassam, N., Scheidereit, C., Droge, W. & Schmitz, M.L. (2000) Mixed-lineage kinase 3 delivers CD3/CD28-derived signals into the IjB kinase complex. Mol. Cell Biol. 20, 2556–2568. 22. Ikeda, A., Hasegawa, K., Masaki, M., Moriguchi, T., Nishida, E., Kozutsumi,Y.,Oka,S.&Kawasaki,T.(2001)Mixedlineage kinase LZK forms a functional signaling complex with JIP-1, a scaffold protein of the c-Jun NH 2 -terminal kinase pathway. J. Biochem. 130, 773–781. 23. Tsuji, K., Copeland, N.G., Jenkins, N.A. & Obinata, M. (1995) Mammalian antioxidant protein complements alkylhydroper- oxide reductase (ahpC) mutation in Escherichia coli. Biochem. J. 307, 377–381. 24. Moriguchi, T., Toyoshima, F., Masuyama, N., Hanafusa, H., Gotoh, Y. & Nishida, E. (1997) A novel SAPK/JNK kinase, MKK7, stimulated by TNFalpha and cellular stresses. EMBO J. 16, 7045–7053. 25. Toyoshima, F., Moriguchi, T. & Nishida, E. (1997) Fas induces cytoplasmic apoptotic responses and activation of the MKK7- JNK/SAPK and MKK6-p38 pathways independent of CPP32- like proteases. J. Cell Biol. 139, 1005–1015. 26. Watashi, K., Hijikata, M., Marusawa, H., Doi, T. & Shimotono, K. (2001) Cytoplasmic localization is important for transcription factor nuclear factor-jB activation by hepatitis C virus core pro- tein through its amino terminal region. Virology 286, 391–402. 27. Shih, S.F., Wu, Y.H., Hung, C.H., Yang, H.Y. & Lin, J.Y. (2001) Abrin triggers cell death by inactivating a thiol-specific antioxidant protein. J. Biol. Chem. 276, 21870–21877. 28. Kang, S.W., Baines, I.C. & Rhee, S.O. (1998) Characterization of a mammalian peroxiredoxine that contains one conserved cysteine. J. Biol. Chem. 273, 6303–6311. 29. Jin, D.Y., Chae, H.Z., Rhee, S.G. & Jeang, K.T. (1997) Reg- ulatory role for a novel human thioredoxin peroxidase in NF-jB activation. J. Biol. Chem. 272, 30952–30961. 30. Didonato,J.A.,Hayakawa,M.,Rothwarf,D.M.,Zandai,E.& Karin, M. (1997) A cytokine-responsive IkappaB kinase that activates the transcription factor NF-kappaB. Nature 388, 548–554. 31. Zandai, E., Rothwarf, D.M., Delhase, M., Hayakawa, M. & Karin, M. (1997) The IkappaB kinase complex contains two kinase subunits, IKKalpha and IKKb, necessary for IkappaB phosphorylation and NF-kappaB activation. Cell 91, 243–252. 32. Smaele, E.D., Zazzeroni, F., Papa, S., Nguyen, D.U., Rongguan, J., Jones, J., Cong, R. & Franzoso, G. (2001) Induction of gadd45b by NF-jB downregulates pro-apoptotic JNK signaling. Nature 414, 308–313. 33. Tang,G.,Minemoto,Y.,Dibling,B.,Purcell,N.H.,Karin,M.& Lin, M. (2001) Inhibition of JNK activation through NF-jB target genes. Nature 414, 313–317. 34. Yang, D.D., Kuan, C.Y., Whitmarsh, A.J., Rincon, M., Zheng, T.S., Davis, R.J., Pakic, P. & Falvell, R.A. (1997) Absence of excitotoxicity-induced apoptosis in the hippocampus of mice lacking the Jnk3 gene. Nature 389, 865–870. 35. Tournier, C., Hess, P., Yang, D.D., Xu, J., Turner, T.K., Nimnual, A., Bar-Sagi, D., Jones, S.N., Flavell, R.A. & Davis, R.J. (2000) Requirement of JNK for stress-induced activation of the cytochrome c-mediated death pathway. Science 288, 870–874. 36. Savinainen, A., Garcia, E.P., Dorow, D., Marshall, J. & Liu, Y.F. (2001) Kainate receptor activation induces mixed lineage kinase- mediated cellular signaling cascades via post-synaptic density protein 95. J. Biol. Chem. 276, 11382–11386. 37. Holzman, L.B., Merritt, S.E. & Fan, G. (1994) Identification, molecular cloning, and characterization of dual leucine zipper bearing kinase. A novel serine/threonine protein kinase that def- ienes a second subfamily of mixed lineage kinases. J. Biol. Chem. 269, 30808–30817. 38. Ing, Y.L., Leung, I.W.L., Heng, H.H.Q., Tsuji, L.C. & Lassam, N.J. (1994) MLK-3: identification of a widely-expressed protein kinase bearing an SH3 domain and a leucine zipper-basic region domain. Oncogene 9, 1745–1750. 39. Mata, M., Merritt, S.E. & Fan, G., Yu, G.G. & Holzman, L.B. (1996) Characterization of dual leucine zipper-bearing kinase, a mixed lineage kinase present in synaptic terminals whose phos- phorylation state is regulated by membrane depolarization via calcineurin. J. Biol. Chem. 271, 16888–16896. 40.Korn,S.H.,Wouters,E.F.M.,Vos,N.&Jassen-Heininger, Y.M.W. (2001) Cytokine-induced activation of nuclear factor-jB is inhibited by hydrogen peroxide through oxidative inactivation of IjBkinase.J. Biol. Chem. 276, 35693–35700. Ó FEBS 2003 Synergistic activation of NF-jB by LZK and AOP-1 (Eur. J. Biochem. 270)83 . Mixed lineage kinase LZK and antioxidant protein-1 activate NF-jB synergistically Megumi Masaki, Atsushi Ikeda, Eriko Shiraki, Shogo Oka and Toshisuke. kawasaki@pharm.kyoto-u.ac.jp Abbreviations: LZK, leucine zipper-bearing kinase; AOP-1, antioxidant protein-1; MLK, mixed lineage kinase; JNK, c-Jun NH 2 terminal kinase; MAPK, mitogen-activated