Saccharomyces cerevisiae Pip2p–Oaf1p regulates PEX25 transcription through an adenine-less ORE Hanspeter Rottensteiner 1 , Andreas Hartig 2 , Barbara Hamilton 2 , Helmut Ruis 2 , Ralf Erdmann 1 and Aner Gurvitz 2 1 Institut fu ¨ r Physiologische Chemie, Ruhr-Universita ¨ t Bochum, Bochum, Germany; 2 Institut fu ¨ r Biochemie und Molekulare Zellbiologie der Universita ¨ t Wien and Ludwig Boltzmann-Forschungsstelle fu ¨ r Biochemie, Vienna Biocenter, Vienna, Austria TheroleoftheSaccharomyces cerevisiae Pip2p–Oaf1p transcription factor was examined in reference to the regu- lation of the peroxin gene PEX25 involved in peroxisome proliferation. The PEX25 promoter contains an oleate response element (ORE)-like sequence comprising a CGG palindrome lacking a canonical adenine, which is considered critical for element function and Pip2p–Oaf1p binding. Pex25p levels were higher in wild-type cells grown on oleic acid medium than in those grown on ethanol, but this induction was abolished in cells devoid of Pip2p–Oaf1p. Studies based on lacZ reporter genes and in vitro protein– DNA interactions revealed that the PEX25 ORE could bind Pip2p–Oaf1p and confer activation on a basal promoter. These findings reinforced the central role played by Pip2p– Oaf1p in regulating peroxisome proliferation. We also investigated whether Pip2p–Oaf1p is important for regulating genes encoding peroxins involved in protein import into the peroxisomal matrix. Pip2p–Oaf1p was able to bind effici- ently to the PEX5 ORE but not to an ORE-like CGG pal- indrome in the PEX14 promoter. However, immunoblotting revealed that both Pex5p and Pex14p (as well as Pex7p and Pex13p) were not more abundant in cells grown on oleic acid medium compared with ethanol. These data on a functional, adenine-less, PEX25 ORE and a nonfunctional N 13 -spaced ORE-like sequence in the PEX14 promoter capable of binding Pip2p–Oaf1p prompts readjustment of the ORE consensus to comprise CGGN 3 TN A / (R) N 8)12 CCG. Keywords: oleate response element (ORE) consensus; peroxin; peroxisome membrane proteins; peroxisome proli- feration; protein import. Peroxisomes are found in most eukaryotic cells, and in fungi they are the exclusive location for fatty acid degradation [1]. Growth of the yeast Saccharomyces cerevisiae on fatty acids as a sole carbon source elicits a dual response. It prompts proliferation of peroxisomes, and induces expression of peroxisomal matrix proteins [2], such as b-oxidation enzymes, by upregulating transcription of the correspond- ing genes. Several transporters located at the organellar membrane have also been shown to be inducible in fatty acid media [3,4]. However, only fragmentary data are available on the inducibility of peroxins, which are required for the biogenesis of peroxisomes [5]. Transcriptional upregulation of b-oxidation enzyme genes is controlled by a pair of zinc-cluster proteins, Pip2p and Oaf1p [3,6–9], which unite to form a transcription factor that binds to oleate response elements (OREs) in their promoters [10,11]. To ensure that the processes of enzyme induction and peroxisome proliferation remain tightly coordinated, a further transcription factor, Adr1p, is called upon to provide an additional level of control [12]. A combination of Pip2p–Oaf1p and Adr1p governs the upregulation not only of genes encoding the matrix enzymes Pox1p/Fox1p, Pot1p/Fox3p, Sps19p, and Cta1p, but also the gene for the Pex11p peroxin [12–15]. With respect to peroxins, global expression patterns based on serial analysis of gene expres- sion [16] and transcriptome profiling [17,18] has led to the suggestion that transcription of PEX genes does not react to the presence of fatty acids in the growth medium to the same level as that of genes encoding peroxisomal matrix proteins. However, several S. cerevisiae PEX genes contain sequences in their promoters that resemble OREs and Adr1p-binding elements (UAS1s), six of which are listed in Table 1. The completeness of the data on the regulation of PEX11 [6,12] contrasts with the limited information available on the transcription of PEX5 [3], PEX14 [19], and the recently identified PEX25 [17],allofwhichhavebeenreportedonat least one occasion to be upregulated in cells grown on oleic acid medium. These PEX genes are the focus of our study. The exact function of Pex25p is not yet known, but its absence from cells grown on oleic acid medium appears to affect the extent of proliferation of the peroxisomal compartment [17]. This observation is reminiscent of cells lacking Pex11p [20,21], a peroxin thought to be involved in Correspondence to A. Gurvitz, Institut fu ¨ r Biochemie und Molekulare Zellbiologie, Vienna Biocenter, Dr Bohrgasse 9, A-1030 Vienna, Austria. Fax: + 43 1 4277 9528, Tel.: + 43 1 4277 52815, E-mail: AG@abc.univie.ac.at Abbreviations: ORE, oleate response element; UAS1, Adr1p-binding upstream activation sequence; EMSA, electrophoretic mobility shift analysis; ORF, open reading frame. Dedication: dedicated to the memory of our coauthor, Professor Helmut Ruis, who died on 1 September 2001. (Received 30 January 2003, revised 11 March 2003, accepted 14 March 2003) Eur. J. Biochem. 270, 2013–2022 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03575.x medium-chain fatty acid transport [22]. However, a more widely accepted function assigned to Pex11p is involvement in the constriction of smaller peroxisomes from expanded organelles [20,21,23]. In reference to Pex5p [24,25], this peroxin acts as receptor for peroxisome targeting signal type 1 which occurs at the C-termini of almost all of the peroxisomal matrix proteins [26]. At least one matrix enzyme, Pot1p/Fox3p, enters peroxisomes via an N-ter- minal peroxisome targeting signal type 2 which is recognized by the Pex7p peroxin [27,28]. The two receptors bind their cargo proteins in the cytosol and recruit them to the peroxisomal membrane by interacting with the core com- ponents of the docking machinery, Pex14p [19,29] and Pex13p [30–32]. Here, we examined in detail whether S. cerevisiae PEX5, PEX14,andPEX25 are regulated by Pip2p–Oaf1p under oleic acid-induction conditions. In addition, the minimal structure of the ORE was also scrutinized, and we report on a new and significant deviation from the ORE consensus found in the promoter of PEX25. Experimental procedures Strains and plasmids The S. cerevisiae strains, plasmids, and oligonucleotides used are listed in Table 2. Construction of the BJ1991- derived strain [33] BJ1991pip2Doaf1D [8] has been described. The corresponding adr1D mutant [12] was constructed in the laboratory of H. F. Tabak, University of Amsterdam, Academic Medical Center, Amsterdam, the Netherlands (H. F. Tabak, unpublished data). UTL7-Apex25D was derived from UTL7-A [34] by replacing the open reading frame (ORF) with the kanMX4 cassette from plasmid pFA6 [35]. Escherichia coli strains DH10B and DH5a were used for plasmid amplification and isolation. Media and growth conditions For b-galactosidase measurements, cells were grown on oleic acid medium as described previously [8]. Immunoblot- ting was conducted using cells that were grown initially on yeast extract/peptone medium [1% (w/v) yeast extract, 2% (w/v) peptone] containing 2% (w/v) D -glucose, shifted to yeast extract/peptone media containing either 4% D -glucose, 2.5% (v/v) ethanol, or 0.2% (w/v) oleic acid and 0.02% (w/v) Tween 80 (adjusted to pH 7.0 with NaOH), and aerated vigorously with shaking for 8 h in the case of 4% glucose medium (to an A 600 <1.0)andfor20h on ethanol or oleic acid medium. Immunoblotting Whole-cell extracts were prepared according to a published protocol [36]. In all experiments, lanes were loaded with samples equivalent to 100 lg protein obtained from 400 lg cells (wet weight). Monoclonal antibodies against yeast 3-phosphoglycerate kinase (Pgk1p) were purchased from Molecular Probes, Eugene, OR, USA. Antibodies against Pex5p [37], Pex13p [31], Pex14p [29], Pex7p [38], Kar2p [39], and Aac2p [40] have been described. To generate polyclonal antibodies against Pex25p, an N-terminally His 6 -tagged fragment of Pex25p (amino acids 173–248) was expressed from a pET21b-derived plasmid (Novagen, Madison, WI, USA) pETak in E. coli strain BL21 (DE3; Novagen) and subsequently purified on a nickel/nitrilotriacetic acid matrix (Invitrogen, De Schelp, the Netherlands) under denaturing conditions. The fragment was used to immunize rabbits at Eurogentech (Serain, Belgium). The antibody against Cta1p was a gift from the laboratory of H. F. Tabak. Immuno- reactive complexes were visualized using anti-rabbit or anti- mouse IgG-coupled horseradish peroxidase in combination with the ECL TM system from Amersham Biosciences (Freiburg, Germany). Plasmid constructions The OREs in the promoters of PEX5, PEX14,andPEX25 were generated from synthetic oligonucleotides (Table 2). Double-stranded oligonucleotides delineated by SalIsitesor by SalIandEcoRI sites were ligated to the appropriate sites in the plasmid vector pBluescriptÒ SK+ (pSK; Stratagene, La Jolla, CA, USA). The nucleotides of the inserts in the respectiveplasmidspSKPEX5ORE(PEX5ORE), pHPR143 (PEX25 ORE) and pHPR160 (PEX14 ORE) were confirmed by automatic sequencing. To insert the PEX14 and PEX25 OREs into a basal CYC1-lacZ reporter gene, the annealed oligonucleotides were similarly ligated into an EcoRI/SalI- digested Matchmaker one-hybrid vector pLacZi (Clontech Laboratories Inc, Palo Alto, CA, USA). This resulted in the integrative plasmids pHPR153 (PEX25 ORE::CYC1-lacZ) and pHPR159 (PEX14 ORE::CYC1-lacZ). Table 1. Analysis of the promoter regions of S. ce revisiae PEX genes. Analysis was performed on 500 bp upstream of the ATG translational start site. Nucleotides in bold represent deviations from the consensus that would not exclude the sequence from qualifying as a canonical element, whereas those also italicized are critical. Regions that are underlined overlap in the native promoter sequence. Gene ORE CGGN 3 TNAN 8)12 CGG UAS1 CYCCRDN 4)36 HYGGRG Inducible PEX5 CGGN 10 TTAACTCCG [6] CTCCGAN 4 CTCCGAN 20 GCGGAG Yes [3] PEX7 CAGN 10 TNAN 3 CCG CTCCAGN 15 GCCGAG Not reported CTCCTCN 26 AAGGTG PEX11 CGGN 3 TNAN 4 GGAGN 3 CCG T TCCATN 19 N 11 TCGGAG Yes [6] PEX13 CGGN 12 TNAN 3 CGG CGCCGGN 17 CAGAAGTTGGTG No [16] PEX14 CGGN 3 TNAN 7 CCG None Yes [19] PEX25 CGGN 3 TAGN 5 GAAN 3 CCG None Yes [17] 2014 H. Rottensteiner et al.(Eur. J. Biochem. 270) Ó FEBS 2003 To fuse the native promoter of PEX25 to lacZ,anEcoRI/ XbaI-delineated fragment incorporating 262 bp upstream and 207 bp downstream of the 1185-bp PEX25 ORF was generated by PCR using oligonucleotides RE39 and RE40 (Table 2). The single amplification product was cloned into an appropriately digested pSK vector, resulting in plasmid pSKPMP45. The promoter fragment was isolated after digestion with EcoRI and HindIII, and inserted into a similarly cut YEp356 vector [41], resulting in plasmid pHPR164. The PEX5 promoter was obtained from plasmid YCpPEX5 [19] as a HindIII–NheI fragment containing 194 bp of the promoter region (including 20 bp upstream of the putative ORE) plus 999 bp of the ORF. This fragment was blunt-ended with Klenow fragment and cloned into an EcoRV-cut pSK to yield plasmid pHPR180. The orienta- tion of the insert was determined before being isolated as a SalI–PstI fragment based on sites originating from pSK. The insert was then cloned into the appropriate gap in YEp356, resulting in plasmid pHPR181. The PEX14-lacZ fusion (pHPR166) was constructed by excising the PEX14 promoter (614 bp plus 699 bp of the ORF) as a BamHI– HindIII fragment from plasmid pWG14/9 [37] and inserting Table 2. S. cerevisiae strains, plasmids and oligonucleotides used. The superscript numbers after the strain’s designation refer to parental genotypes, e.g. BJ1991pip2Doaf1D 1 was derived from (1) BJ1991. Strain, plasmid, or oligonucleotide Description Source or reference S. cerevisiae (1) BJ1991 MATa leu2 ura3–52 trp1 pep4–3 prb1–1122 gal2 [33] (2) BJ1991pip2Doaf1D 1 pip2D::LEU2 oaf1D::kanMX [8] yHPR288 1 PEX25 ORE::CYC1-lacZ reporter gene (pHPR153) This study yHPR289 2 PEX25 ORE::CYC1-lacZ reporter gene (pHPR153) This study yHPR292 1 PEX14 ORE::CYC1-lacZ reporter gene (pHPR159) This study yHPR293 2 PEX14 ORE::CYC1-lacZ reporter gene (pHPR159) This study yHPR400 1 PEX25-lacZ reporter gene (pHPR164) This study yHPR401 2 PEX25-lacZ reporter gene (pHPR164) This study yHPR402 1 PEX14-lacZ reporter gene (pHPR166) This study yHPR403 2 PEX14-lacZ reporter gene (pHPR166) This study yHPR404 1 PEX5-lacZ reporter gene (pHPR181) This study yHPR405 2 PEX5-lacZ reporter gene (pHPR181) This study yHPR406 1 Expressing Pex25p (pSH45) This study yHPR407 2 Expressing Pex25p (pSH45) This study (3) UTL7-A MATa leu2–3112 ura3–52 trp1 [34] (4) UTL7-Apex25D 3 pex25D::kanMX4 E. Sonnehol yHPR408 4 Expressing Pex25p (pSL45) This study Plasmid pETak PEX25 519-744 in pET21b E. Sonnenhol pHPR143 PEX25 ORE in pSK/SalI-EcoRI This study pHPR160 PEX14 ORE in pSK/SalI-EcoRI This study pSKPEX5ORE PEX5 ORE in pSK/SalI This study pHPR153 pLacZi-based PEX25 ORE::CYC1-lacZ This study pHPR159 pLacZi-based PEX14 ORE::CYC1-lacZ This study pHPR164 YEp356-based PEX25-lacZ This study pHPR166 YEp358-based PEX14-lacZ This study pSKPMP45 PEX25 in pSK/EcoRI-XbaI This study pSL45 PEX25 in pRS416/EcoRI-XbaI E. Sonnenhol pSH45 PEX25 in YEp352/EcoRI-XbaI E. Sonnenhol pHPR180 PEX5 promoter in pSK/EcoRV This study pHPR181 PEX5-lacZ in YEp356 This study Oligonucleotide PEX25 ORE1 (RE313) 5¢- AATTCAGGTCGGTGATAGTATATGAAATTCCGGTGGG-3¢ This study PEX25 ORE2 (RE314) 5¢- TCGACCCACCGGAATTTCATATACTATCACCGACCTG-3¢ This study PEX5 ORE1-F 5¢- TCGACCGGATCATCGCGATTAACTCCGG-3¢ This study PEX5 ORE1-R 5¢- TCGACCGGAGTTAATCGCGATGATCCGG-3¢ This study PEX5 ADR1-F 5¢- TCGACACTCCGAATTCCTCCGACAAGTCGGTACCCTCTTCCGGCGGAGAG-3¢ This study PEX5 ADR1-R 5¢- TCGACTCTCCGCCGGAAGAGGGTACCGACTTGTCGGAGGAATTCGGAGTG-3¢ This study PEX14 ORE1 (RE328) 5¢- AATTCATAGCGGTTTTAATAAGCGCCCGAAAGAG-3¢ This study PEX14 ORE2 (RE329) 5¢- TCGACTCTTTCGGGCGCTTATTAAAACCGCTATG-3¢ This study RE39 5¢- ATCGAATTCACCCTGATGTCCTCGGATCG-3¢ This study RE40 5¢- TGCATCTAGATAGATCTGCGTCAGTGTCAG-3¢ This study Ó FEBS 2003 Regulation of PEX25 by Pip2p–Oaf1p in S. cerevisiae (Eur. J. Biochem. 270) 2015 the fragment into the appropriate gap in YEp358 [41]. Correct fusion of the promoter fragments with the lacZ gene was verified by sequencing in all cases. To express Pex25p ectopically, an EcoRI–XbaI fragment was excised from plasmid pSKPMP45 and inserted into similarly digested plasmid vectors YEp352 [42] or pRS416 [43] to yield plasmids pSH45 and pSL45, respectively. Miscellaneous b-Galactosidase activities were assayed in cells that were broken after three freeze–thaw cycles, and were expressed as lmol chlorophenol red b- D -galactopyranoside hydro- lysedÆmin )1 Æcell )1 [4]. Alternatively, b-galactosidase activi- ties were measured in soluble protein extracts prepared by breaking cells with glass beads [44], and expressed as nmol o-nitrophenyl b- D -galactopyranoside hydrolyzed per min and mg of protein. The following procedures were per- formed according to published methods: nucleic acid manipulations [45], yeast transformation [46], verification of single plasmid integration [47], determination of protein concentration [48], and electrophoresis [49]. DNA frag- ments were isolated using QIAEX II (Qiagen Inc., Valencia, CA, USA) according to the manufacturer’s instructions. Fragments containing POT1/FOX3 ORE, PEX5 ORE, PEX14 ORE or PEX25 ORE were isolated from plasmids pSKFOX3ORE [50], pSKPEX5ORE, pHPR160 and pHPR143 after digestion with EcoRI and XhoI. Electro- phoretic mobility shift analysis (EMSA) was carried out according to a published protocol [6]. Results Induction of Pex25p on oleic acid medium is abolished in cells devoid of Pip2p–Oaf1p The current ORE consensus stipulates that the two inverted CGG triplets delineating the imperfect palindrome must be spaced by 14–18 intervening nucleotides [4], i.e. CGGN 3 TNAN 8)12 CCG. In addition, at least one half site in all hitherto known OREs contains conserved thymine and adenine bases at specific positions that are important for binding the cognate transcription factor Pip2p–Oaf1p and for ORE function [10,11]. Expression of Pex25p representing a peroxisomal peri- pheral membrane protein has been previously shown to be induced in cells grown on oleic acid medium, and the corresponding PEX25 gene was suggested to contain an ORE in its promoter [17]. However, closer inspection of the PEX25 ORE-like sequence (Table 1) revealed that, Fig. 1. Expression of Pex25p is oleic acid inducible. (A) An antibody raised in rabbits against Pex25p specifically recognizes a band of 45 kDa in yeast whole-cell extracts. The antibody was affinity-purified and applied to an immunoblot on to which were immobilized extracts of oleic acid-induced cells of the indicated strains (WT, UTL7-A; pex25D,UTL7-Apex25D; pex25D +[PEX25], yHPR408). (B) Whole- cell extracts of a BJ1991 wild-type strain or an otherwise isogenic pip2Doaf1D mutant grown on rich medium supplemented with glu- cose, ethanol or oleic acid were assayed by immunoblotting for the presence of Pex25p, Pex11p, Pot1p/Fox3p, and Kar2p (protein loading control). (C) The experiment was repeated under oleic acid-medium conditions as in (B) above, using strains additionally expressing Pex25p from the episomal plasmid pSH45 which was loaded with PEX25 tethered to the native promoter (strains yHPR406 and yHPR407). The control for equal protein loading was represented by Aac2p. 2016 H. Rottensteiner et al.(Eur. J. Biochem. 270) Ó FEBS 2003 although the palindrome comprises an intervening sequence complying with the required spacing between the two CGG triplets (N 17 ), it nevertheless lacks the canonical adenine at the ninth position in the CGGN 3 TNA half site. Hence, this prompted the question of whether PEX25 is governed by Pip2p–Oaf1p. Levels of native Pex25p in mutant cells lacking Pip2p– Oaf1p were determined using polyclonal antibodies gener- ated against an internal fragment of the membrane protein. The function of these antibodies was examined by immu- noblotting performed on yeast whole-cell extracts. The signal obtained using wild-type cells (WT; Fig. 1A) was not seen in extracts from mutant cells lacking the genomic copy of PEX25, but was reinforced in extracts from mutants that additionally expressed PEX25 from a centromeric plasmid, thereby verifying antibody specificity (pex25D or pex25D + [PEX25], respectively; Fig. 1A). The experiment showed that the amount of Pex25p in wild-type cells grown on oleic acid medium was higher than in those grown on ethanol or glucose (Fig. 1B). These results agree with previous ones obtained using a Protein A- tagged variant of this peroxin [17]. Importantly, the fatty acid-dependent increase in Pex25p abundance seen in the wild-type strain was not observed in the pip2Doaf1D mutant (Fig. 1B; extreme right lane). The expression pattern provided here for Pex25p in wild-type cells resembled that of a further peroxin involved in peroxisome proliferation, Pex11p, as in addition to being oleic acid inducible, both proteins could also be readily detected on glucose medium (Fig. 1B; upper two panels). In contrast, Pot1p/Fox3p exhibited a much more specific increase in abundance on oleic acid (Fig. 1B; third panel). Application of an antibody against the constitutively expressed Kar2p served to verify equal loading of protein (Fig. 1B; bottom panel). To underscore the reliance of Pex25p expression on a functional oleic acid-induction machinery, wild-type and pip2Doaf1D cells were used that additionally expressed PEX25 under the control of the native promoter from a multicopy plasmid (Fig. 1C). The results provided further support for the inability of pip2Doaf1D cells to induce Pex25p expression on oleic acid medium. For comparison, levels of Pex11p and the constitutively expressed Aac2p [51] were also examined (Fig. 1C). As the observed loss of induction of Pex25p in the pip2Doaf1D mutant is character- istic of proteins encoded by ORE-regulated genes, including Pex11p and Pot1p/Fox3p, the Pip2p–Oaf1p transcription factor may also be involved in upregulating PEX25. Characterization of the adenine-less ORE regulating PEX25 transcription A more detailed analysis of PEX25 transcription was performed using a lacZ reporter gene fused to 262 bp of the PEX25 promoter region. Expression of PEX25-lacZ loaded on an episomal plasmid was 2.8-fold higher in an oleic acid-grown wild-type strain than in an ethanol- grownstrain(Table3;PEX25-lacZ).Inthepip2Doaf1D mutant, this induction was abolished. The moderate level of expression of the reporter gene under non-fatty acid conditions was in agreement with the relatively large amount of Pex25p seen on ethanol, compared with Pot1p/ Fox3p (Fig. 1B). The deviation of the presumptive fatty acid-responsive element in the PEX25 promoter from the ORE consensus prompted an examinination of whether the sequence could confer transcriptional activation. Hence, it was inserted into aUAS-lessCYC1-lacZ reporter gene that was used to transform wild-type and pip2Doaf1D mutant cells. After propagation of transformants on ethanol or oleic acid media, cells were broken and analysed for reporter-gene expression. b-Galactosidase activities were 11.3-fold higher in the wild-type strain grown on oleic acid medium than in those grown on ethanol, whereas no upregulation was detectable in the mutant strain (Table 3; PEX25 ORE::CYC1-lacZ). In contrast with the previous situation using PEX25-lacZ, lack of activation by the isolated ORE- like sequence in the presence of ethanol implied that other, unidentified, promoter elements presumably control the relatively high basal transcription of native PEX25 under noninducing conditions. These results led us to assign the oleic acid-specific increase in transcriptional activation to the putative PEX25 ORE. We also examined whether PEX25 ORE could bind the Pip2p–Oaf1p transcription factor in vitro. The results of a competition EMSA showed that the Pip2p–Oaf1p complex could bind to the POT1/FOX3 ORE using wild-type cell extracts (Fig. 2A; lane 9). The corresponding band was missing from the lane containing extracts of cells devoid of Pip2p–Oaf1p (lane 10), thereby verifying its specificity for the transcription factor. Importantly, the intensity of the signal partially diminished after the addition of unlabeled PEX25 ORE to the incubation mixture (lane 6). Signal intensity was also shown to be reduced using competitor DNA representing a number of other OREs (lanes 4, 5, and 7), but not after addition of a mutated CTA1 ORE (lane 8) which fails to bind Pip2p–Oaf1p [6]. When labeled PEX25 ORE was used in the assay (Fig. 2B), a Pip2p–Oaf1p complex appeared in the lane containing wild-type extract (lane 2), but not when an extract obtained from the pip2Doaf1D mutant was used (lane 7). Following the strategy of the previous EMSA, addition of competitor Table 3. Reporter gene activities. The strains used were yHPR400, 401, 288, and 289 for PEX25, or yHPR404 and 405 for PEX5.Values reported here are the mean ± SD of three experiments. The assays were performed using chlorophenol red b- D -galactopyranoside as substrate. Relative level refers to the ratio of oleic acid-specific activity measured for mutant cells to the wild-type strain. Strain b-Galactosidase activity (lmolÆmin )1 Æcell )1 ) Relative level (%)Ethanol Oleic acid PEX25-lacZ BJ1991 156.2 ± 21.1 444.3 ± 30.9 100.0 BJ1991pip2Doaf1D 207.3 ± 13.4 172.2 ± 16.2 39.0 PEX25 ORE::CYC1-lacZ BJ1991 2.88 32.6 ± 1.5 100.0 BJ1991pip2Doaf1D 0.9 1.3 ± 0.3 4.0 PEX5-lacZ BJ1991 86.2 185.5 100.0 BJ1991pip2Doaf1D 108.3 133.3 72.0 Ó FEBS 2003 Regulation of PEX25 by Pip2p–Oaf1p in S. cerevisiae (Eur. J. Biochem. 270) 2017 DNA representing various OREs diminished the intensity of the signal, except when CTA1 ORE mut was used (lane 6). Hence, PEX25 ORE interacted with Pip2p–Oaf1p in vitro. The combined data support the argument that PEX25 is an oleic acid-inducible gene controlled by a promoter element which, despite not containing a canonical adenine, nevertheless represents a bona fide ORE. Thus, by being subordinate to Pip2p–Oaf1p, PEX25 transcription is coreg- ulated with that of the only other gene known to be specifically involved in the expansion of the peroxisomal compartment, PEX11. However, unlike PEX11,basedon immunoblotting (not shown) and the nucleotide sequence of the promoter, PEX25 did not appear to be additionally governed by Adr1p. Pip2p–Oaf1p binds the putative OREs in the promoters of PEX5 and PEX14 Promoter regions comprising 500 bp upstream of the ORFs of PEX5 and PEX13 contain consensus ORE sequences (Table 1). On the other hand, the PEX14 promoter contains a CGG palindrome that is one intervening nucleotide short of the revised consensus (Table 1). Pex5p forms complexes with cytosolically synthesized matrix enzymes containing a peroxisome targeting signal type 1, while Pex13p and Pex14p constitute the core components of the machinery docking these complexes at the peroxisomal membrane. These three peroxins participate in the early steps of protein import, and may be expected to be present in large amounts to cope with the high level of matrix proteins produced under fatty acid-induction conditions. As mentioned in the introduction, both PEX5 and PEX14 have been previously reported to be transcriptionally upregulated to some extent in oleic acid-grown cells [3,16,17,19]. Therefore, we exam- ined whether the peroxisomal import machinery would be upregulated by Pip2p–Oaf1p in concert with the highly induced matrix enzymes. Competition EMSA was performed to determine if the potential OREs in the promoters of PEX5 and PEX14 could bind Pip2p–Oaf1p in vitro. The results show that the signal representing Pip2p–Oaf1p bound to POT1/FOX3 ORE (Fig. 3A; lane 3) disappeared after the addition of unlabeled PEX5 ORE to the incubation mixture (lane 4). By comparison, addition of SPS19 ORE (lane 6) representing a positive control [15], but not nonspecific competitor DNA from PEX5 or SPS19 (lanes 5 and 7), also competed for Pip2p–Oaf1p, indicating that the presumptive PEX5 ORE was able to recruit the transcription factor. Excess PEX14 ORE could also compete with POT1/FOX3 ORE for Pip2p–Oaf1p (Fig. 3B; lane 5). Application of this assay to labeled PEX5 ORE (Fig. 3C) and PEX14 ORE (Fig. 3D) revealed a band pattern consistent with Pip2p–Oaf1p binding. However, compared with the situation with PEX5 ORE, the pattern seen with the PEX14 sequence was different because the complex corresponding to Pip2p– Oaf1p in the lane containing wild-type cell extracts did not represent the predominant signal (Fig. 3D; lane 3). To determine if Pip2p–Oaf1p is essential for PEX5 transcription, a PEX5-lacZ reporter gene was expressed in wild-type cells or those lacking Pip2p–Oaf1p. The trans- formed strains were grown for 18 h on medium containing either ethanol or oleic acid as the sole carbon source. Measurements of b-galactosidase activities revealed that in the wild-type strain, reporter-gene expression was approxi- mately 2.2-fold greater on oleic acid than on ethanol Fig. 2. EMSA of PEX25 ORE. (A) Labeled DNA representing POT1/FOX3 ORE was mixed with protein extracts obtained from wild-type cells (lane 9) or from pip2Doaf1D mutants (lane 10). Exces- sive amounts of competitor DNA (25-fold) were added as indicated. The competition achieved with the PEX25 ORE (lane 6) was com- pared with the OREs of POT1/FOX3 (lane 2), POX1/FOX1 (lane 4), and ANT1 (lane 5). (B) Labeled PEX25 ORE was assayed as above. In these and subsequent EMSAs, free and bound DNA fragments were resolved on a 5% (w/v) polyacrylamide gel. The nucleotide sequence of PEX25 ORE is given in Table 2. The sequences of POT1/ FOX3 ORE [50], POX1/FOX1 ORE [6], ANT1 ORE [4], CTA1 ORE and CTA1 OREmut [6] have been reported previously. In this and subsequent EMSAs, 30 lg protein was used in the incubation mixtures. 2018 H. Rottensteiner et al.(Eur. J. Biochem. 270) Ó FEBS 2003 (Table 3; PEX5-lacZ). This induction was reduced in the pip2Doaf1D strain to only 1.2-fold. A similar approach was used to examine PEX14 (using strains yHPR402 and yHPR403); however, b-galactosidase activity expressed from the PEX14-lacZ fusion gene was below the detection limit of the assay used, which was based on the substrate o-nitrophenyl b- D -galactopyranoside. As this quiescence may not necessarily reflect the true level of expression of native PEX14, the isolated PEX14 ORE was also analyzed in the context of a basal promoter. The b-galactosidase activities measured with o-nitrophenyl b- D -galactopyrano- side in cells harboring a CYC1-lacZ reporter gene contain- ing the PEX14 ORE were not significantly higher than those with the empty vector control (strains yHPR292 and yHPR293; data not shown). These results indicate that, despite its weak ability to bind Pip2p–Oaf1p in vitro,the ORE-like sequence in PEX14 is probably not relevant for mediating transcriptional activation. On the other hand, PEX5 ORE may be functional in vivo, as demonstrated in the context of a reporter gene. Expression of Pex5p, Pex7p, Pex13p and Pex14p on oleic acid medium Pex5p, Pex7p, Pex13p and Pex14p are involved in the early, cytosolic, steps of import of proteins into the peroxisomal matrix. To examine the abundance of these peroxins under fatty acid medium conditions, immunoblotting was per- formed. Cells devoid of Pip2p–Oaf1p or Adr1p were used to assess whether the putative OREs or Adr1p-like binding sites (UAS1; CYCCRDN 4)36 HYGGRG) in the promoters of the listed PEX genes (Table 1) are functional. Applica- tion of monoclonal antibodies against Pgk1p served as an internal control for equal loading of protein, whereas an antibody against Cta1p was used to demonstrate the effects of the loss of Pip2p–Oaf1p or Adr1p on expression of the product of a gene regulated by both an ORE and UAS1 [13]. The results demonstrated that the four peroxins were not more abundant in cells grown on oleic acid medium than in those grown on ethanol, as was seen with the control Fig. 3. EMSA of PEX5 ORE and PEX14 ORE. (A,B) Competition EMSA was per- formed using labeled POT1/FOX3 ORE mixed with soluble protein extracts from wild- type or pip2Doaf1D cells. UAS1 PEX5 refers to nonspecific double-stranded DNA listed in Table 2 as PEX5 ADR1-F/R, and UAS1 SPS19 represents the previously published fragment SPS19 ADR1-F/R [15] (C,D) EMSA of labeled PEX5 ORE or PEX14 ORE. Com- plexes specific to Pip2p–Oaf1p are marked with arrows. Asterisks denote complexes of unknown identity. The reason for the increase in the intensity of the signal for the upper nonspecific complex (arrow and asterisk in D) after competition with an excessive amount of unrelated OREs is not known. The nucleotide sequences of PEX5 ORE and PEX14 ORE are foundinTable2.ThesequenceofSPS19 ORE [56] has been reported. Ó FEBS 2003 Regulation of PEX25 by Pip2p–Oaf1p in S. cerevisiae (Eur. J. Biochem. 270) 2019 enzyme Cta1p, which was clearly induced (Fig. 4). In addition, neither Pip2p–Oaf1p nor Adr1p appeared to play any role in this process. It is also worth noting that, whereas expression of Pex7p, Pex13p, and Pex14p was repressed on glucose, Pex5p seemed to be similarly abundant on the three carbon sources tested. Discussion Transcription of PEX genes in response to cell growth on fatty acids has received relatively scant attention compared with that of genes encoding peroxisomal matrix proteins. In a previous study of oleic acid-dependent upregulation of genes encoding peroxisomal proteins, including peroxins, using serial analysis of gene expression [16], not only were moderately inducible genes such as ANT1 [4] and PEX25 (the present work) not detected, but also more highly inducible ones such as ECI1 [52,53] and DCI1 [54,55] were not revealed. In two subsequent DNA-array experiments [17,18], data were compiled from wild-type strains but not from induction mutants such as pip2D, oaf1D or adr1D cells. These studies exposed all of the published oleic acid- inducible genes but otherwise contained little or no new information on peroxin induction. The role of Pip2p–Oaf1p was examined in reference to the transcriptional upregulation of the peroxin gene PEX25 in cells grown on fatty acid medium. The results presented here based on immunoblotting, EMSAs and lacZ gene fusions extend the previous finding of Pex25p induction to show that this depended on a modified ORE interacting with Pip2p–Oaf1p. We therefore propose a readjustment of the ORE consensus as follows: CGGN 3 TN A / (R) N 8)12 CCG, with (R) representing a purine as a rare alternative to the predominant adenine. Just how often guanines replace adenines at this position in functional OREs remains to be determined. Moreover, it is still not clear whether the difference between the modest induction level of PEX25 and the much higher one of PEX11 is due to the critical deviation from the consensus of the ORE in the former gene’s promoter, or to Adr1p not playing an active role in its regulation. This investigation also examined whether expression of Pex5p, Pex7p, Pex13p, and Pex14p, which are involved in the early steps of protein import into the peroxisomal matrix, are induced by oleic acid. Their respective gene promoters all contain consensus OREs or related sequences. In addition, sequences resembling UAS1, the Adr1p- binding element, were found in three of the four peroxin promoters analyzed (Table 1). PEX5 was reported previ- ously to belong to a group of fatty acid-responsive genes that are upregulated by Pip2p–Oaf1p, albeit only two to threefold [3]. Nevertheless, it hitherto remained unclear whether this upregulation was due to the transcription factor acting directly on the PEX5 promoter. The results presented here show that Pip2p–Oaf1p can bind to the PEX5 ORE to activate transcription. However, based on immunoblotting that was sufficiently sensitive to expose the inducibility of Cta1p, Pex5p levels appeared to remain constant in cells irrespective of the carbon source used to supplement the growth medium. We did not examine directly the function of the ORE-like sequence in PEX7 or the canonical ORE in PEX13. However, it was shown that the levels of both Pex7p and Pex13p were also not higher in cells grown on oleic acid medium compared with ethanol. Regarding the transcrip- tion of PEX14, this has been previously reported to be mildly upregulated in cells grown on oleic acid medium [16,17,19], but at the protein level [29] Pex14p is not more abundant in such cells. Notwithstanding the in vitro demonstration of Pip2p–Oaf1p forming a complex of minor intensity with the N 13 -spaced candidate PEX14 ORE, the isolated sequence was not able to confer transcriptional activation on a basal CYC1 promoter. This points to a minimum of 14 intervening nucleotides required for an ORE to be functional. Acknowledgements We are endebted to Eike Sonnenhol for providing the pex25D deletant, the Pex25p over-expressing plasmids, and the purified fragment for raising the Pex25p antibody. We thank Professor Wolf-Hubert Kunau for antibodies. This work was supported in part by the Deutsche Forschungsgemeinschaft, grant ER178/2–3 (to R.E.), the Austrian Fonds zur Fo ¨ rderung der wissenschaftlichen Forschung (FWF), grants P12061-MOB (to H.R. and B.H.) and P12118-MOB (to A.H.). H. Rottensteiner was supported by a long-term EMBO fellowship (ALTF- 255–2000). References 1. Kunau, W H., Dommes, V. & Schulz, H. (1995) b-Oxidation of fatty acids in mitochondria, peroxisomes, and bacteria: a century of continued progress. Prog. Lipid Res. 34, 267–342. 2. Veenhuis, M., Mateblowski, M., Kunau, W H. & Harder, W. (1987) Proliferation of microbodies in Saccharomyces cerevisiae. Yeast 3, 77–84. 3. Karpichev, I.V. & Small, G.M. (1998) Global regulatory functions of Oaf1p and Pip2p (Oaf2p), transcription factors that regulate Fig. 4. Levels of Pex5p, Pex7p, Pex13p and Pex14p in cells grown on oleic acid medium. Immunoblotting was performed using whole-cell extracts from BJ1991 wild-type, adr1D,andpip2Doaf1D cells grown on the indicated medium. Expression patterns of peroxins representing the peroximal targeting signal receptors (Pex5p and Pex7p) and the docking machinery (Pex13p and Pex14p) were analyzed and compared with those of the oleic acid-inducible Cta1p and the constitutively expressed Kar2p. 2020 H. Rottensteiner et al.(Eur. J. Biochem. 270) Ó FEBS 2003 genes encoding peroxisomal proteins in Saccharomyces cerevisiae. Mol. Cell. Biol. 18, 6560–6570. 4. Rottensteiner, H., Palmieri, L., Hartig, A., Hamilton, B., Ruis, H., Erdmann, R. & Gurvitz, A. (2002) The peroxisomal transporter gene ANT1 is regulated by a deviant oleate response element (ORE): characterization of the signal for fatty acid induction. Biochem. J. 365, 109–117. 5. Purdue, P.E. & Lazarow, P.B. (2001) Peroxisome biogenesis. Annu. Rev. Cell. Dev. Biol. 17, 701–752. 6. Rottensteiner, H., Kal, A.J., Filipits, M., Binder, M., Hamilton, B., Tabak, H.F. & Ruis, H. (1996) Pip2p: a transcriptional regu- lator of peroxisome proliferation in the yeast Saccharomyces cerevisiae. EMBO J. 15, 2924–2934. 7. Luo, Y., Karpichev, I.V., Kohanski, R.A. & Small, G.M. (1996) Purification, identification, and properties of a Saccharomyces cerevisiae oleate-activated upstream activating sequence-binding protein that is involved in the activation of POX1. J. Biol. Chem. 271, 12068–12075. 8. Rottensteiner, H., Kal, A.J., Hamilton, B., Ruis, H. & Tabak, H.F. (1997) A heterodimer of the Zn 2 Cys 6 transcription factors Pip2p and Oaf1p controls induction of genes encoding peroxi- somal proteins in Saccharomyces cerevisiae. Eur. J. Biochem. 247, 776–783. 9. Karpichev, I.V., Luo, Y., Marians, R.C. & Small, G.M. (1997) A complex containing two transcription factors regulates peroxi- some proliferation and the coordinate induction of b-oxidation enzymes in Saccharomyces cerevisiae. Mol. Cell. Biol. 17, 69–80. 10. Einerhand, A.W., Kos, W.T., Distel, B. & Tabak, H.F. (1993) Characterization of a transcriptional control element involved in proliferation of peroxisomes in yeast in response to oleate. Eur. J. Biochem. 214, 323–331. 11. Filipits, M., Simon, M.M., Rapatz, W., Hamilton, B. & Ruis, H. (1993) A Saccharomyces cerevisiae upstream activating sequence mediates induction of peroxisome proliferation by fatty acids. Gene 132, 49–55. 12. Gurvitz, A., Hiltunen, J.K., Erdmann, R., Hamilton, B., Hartig, A., Ruis, H. & Rottensteiner, H. (2001) Saccharomyces cerevisiae Adr1p governs fatty acid b-oxidation and peroxisome prolifer- ation by regulating POX1 and PEX11. J. Biol. Chem. 276, 31825– 31830. 13. Simon, M., Adam, G., Rapatz, W., Spevak, W. & Ruis, H. (1991) The Saccharomyces cerevisiae ADR1 gene is a positive regulator of transcription of genes encoding peroxisomal proteins. Mol. Cell. Biol. 11, 699–704. 14. Igual, J.C. & Navarro, B. (1996) Respiration and low cAMP- dependent protein kinase activity are required for high-level expression of the peroxisomal thiolase gene in Saccharomyces cerevisiae. Mol. Gen. Genet. 252, 446–455. 15. Gurvitz, A., Wabnegger, L., Rottensteiner, H., Dawes, I.W., Hartig,A.,Ruis,H.&Hamilton,B.(2000)Adr1p-dependent regulation of the oleic acid-inducible yeast gene SPS19 encoding the peroxisomal b-oxidation auxiliary enzyme 2,4-dienoyl-CoA reductase. Mol. Cell. Biol. Res. Commun. 4, 81–89. 16. Kal, A.J., Van Zonneveld, A.J., Benes, V., Van den Berg, M., Koerkamp, M.G., Albermann, K., Strack, N., Ruijter, J.M., Richter, A., Dujon, B., Ansorge, W. & Tabak, H.F. (1999) Dynamics of gene expression revealed by comparison of serial analysis of gene expression transcript profiles from yeast grown on two different carbon sources. Mol. Biol. Cell 10, 1859–18572. 17. Smith, J.J., Marelli, M., Christmas, R.H., Vizeacoumar, F.J., Dilworth, D.J., Ideker, T., Galitski, T., Dimitrov, K., Rachubin- ski, R.A. & Aitchison, J.D. (2002) Transcriptome profiling to identify genes involved in peroxisome assembly and function. J. Cell Biol. 158, 259–271. 18. Koerkamp, M.G., Rep, M., Bussemaker, H.J., Hardy, G.P., Mul, A., Piekarska, K., Szigyarto, C.A., De Mattos, J.M. & Tabak, H.F. (2002) Dissection of transient oxidative stress response in Saccharomyces cerevisiae by using DNA microarrays. Mol. Biol. Cell 13, 2783–2794. 19. Brocard, C., Lametschwandtner, G., Koudelka, R. & Hartig, A. (1997) Pex14p is a member of the protein linkage map of Pex5p. EMBO J. 16, 5491–5500. 20. Erdmann, R. & Blobel, G. (1995) Giant peroxisomes in oleic acid- induced Saccharomyces cerevisiae lacking the peroxisomal mem- brane protein Pmp27p. J. Cell Biol. 128, 509–523. 21. Marshall, P.A., Krimkevich, Y.I., Lark, R.H., Dyer, J.M., Veenhuis, M. & Goodman, J.M. (1995) Pmp27 promotes peroxi- somal proliferation. J. Cell Biol. 129, 345–355. 22. Van Roermund, C.W., Tabak, H.F., Van Den Berg, M., Wanders, R.J. & Hettema, E.H. (2000) Pex11p plays a primary role in medium-chain fatty acid oxidation, a process that affects peroxi- some number and size in Saccharomyces cerevisiae. J. Cell Biol. 150, 489–498. 23. Li, X. & Gould, S.J. (2002) PEX11 promotes peroxisome division independently of peroxisome metabolism. J. Cell Biol. 156, 643–651. 24. Van der Leij, I., Franse, M.M., Elgersma, Y., Distel, B. & Tabak, H.F. (1993) PAS10 is a tetratricopeptide-repeat protein that is essential for the import of most matrix proteins into peroxisomes of Saccharomyces cerevisiae. Proc.Natl.Acad.Sci.USA90, 11782–11786. 25. Brocard, C., Kragler, F., Simon, M.M., Schuster, T. & Hartig, A. (1994) The tetratricopeptide repeat-domain of the PAS10 protein of Saccharomyces cerevisiae is essential for binding the peroxi- somal targeting signal-SKL. Biochem. Biophys. Res. Commun. 204, 1016–1022. 26. Gould, S.J., Keller, G A. & Subramani, S. (1987) Identification of a peroxisomal targeting signal at the carboxy terminus of firefly luciferase. J. Cell Biol. 105, 2923–2931. 27. Marzioch, M., Erdmann, R., Veenhuis, M. & Kunau, W H. (1994) PAS7 encodes a novel yeast member of the WD-40 protein family essential for import of 3-oxoacyl-CoA thiolase, a PTS2- containing protein, into peroxisomes. EMBO J. 13, 4908–4918. 28. Zhang, J.W. & Lazarow, P.B. (1995) PEB1 (PAS7) in Saccharo- myces cerevisiae encodes a hydrophilic, intra-peroxisomal protein that is a member of the WD repeat family and is essential for the import of thiolase into peroxisomes. J. Cell Biol. 129, 65–80. 29. Albertini, M., Rehling, P., Erdmann, R., Girzalsky, W., Kiel, J.A., Veenhuis, M. & Kunau, W H. (1997) Pex14p, a peroxisomal membrane protein binding both receptors of the two PTS- dependent import pathways. Cell 89, 83–92. 30. Gould, S.J., Kalish, J.E., Morrell, J.C., Bjorkman, J., Urquhart, A.J. & Crane, D.I. (1996) Pex13p is an SH3 protein of the per- oxisome membrane and a docking factor for the predominantly cytoplasmic PTS1 receptor. J. Cell Biol. 135, 85–95. 31. Erdmann, R. & Blobel, G. (1996) Identification of Pex13p a per- oxisomal membrane receptor for the PTS1 recognition factor. J. Cell Biol. 135, 111–121. 32. Elgersma,Y.,Kwast,L.,Klein,A.,Voorn-Brouwer,T.,Vanden Berg,M.,Metzig,B.,America,T.,Tabak,H.F.&Distel,B.(1996) The SH3 domain of the Saccharomyces cerevisiae peroxisomal membrane protein Pex13p functions as a docking site for Pex5p, a mobile receptor for the import PTS1-containing proteins. J. Cell Biol. 135, 97–109. 33. Jones, E.W. (1977) Proteinase mutants of Saccharomyces cerevi- siae. Genetics 85, 23–33. 34. Erdmann, R., Veenhuis, M., Mertens, D. & Kunau, W H. (1989) Isolation of peroxisome-deficient mutants of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 86, 5419–5423. 35. Wach, A., Brachat, A., Pohlmann, R. & Philippsen, P. (1994) New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10, 1793–1808. Ó FEBS 2003 Regulation of PEX25 by Pip2p–Oaf1p in S. cerevisiae (Eur. J. Biochem. 270) 2021 36. Yaffe, M.P. & Schatz, G. (1984) Two nuclear mutations that block mitochondrial protein import in yeast. Proc. Natl Acad. Sci. USA 81, 4819–4823. 37. Girzalsky, W., Rehling, P., Stein, K., Kipper, J., Blank, L., Kunau, W H. & Erdmann, R. (1999) Involvement of Pex13p in Pex14p localization and peroxisomal targeting signal 2-dependent protein import into peroxisomes. J. Cell Biol. 144, 1151–1162. 38. Stein, K., Schell-Steven, A., Erdmann, R. & Rottensteiner, H. (2002) Interactions of Pex7p and Pex18p/Pex21p with the peroxisomal docking machinery: implications for the first steps in PTS2 protein import. Mol. Cell. Biol. 22, 6056–6069. 39. Rose, M.D., Misra, L.M. & Vogel, J.P. (1989) KAR2, a karyo- gamy gene, is the yeast homolog of the mammalian BiP/GRP78 gene. Cell 57, 1211–1221. 40. Palmieri, L., Rottensteiner, H., Girzalsky, W., Scarcia, P., Palmieri, F. & Erdmann, R. (2001) Identification and functional reconstitution of the yeast peroxisomal adenine nucleotide trans- porter. EMBO J. 20, 5049–5059. 41. Myers, A.M., Tzagoloff, A., Kinney, D.M. & Lusty, C.J. (1986) Yeast shuttle and integrative vectors with multiple cloning sites suitable for construction of lacZ. fusions. Gene 45, 299–310. 42. Hill, J.E., Myers, A.M., Koerner, T.J. & Tzagoloff, A. (1986) Yeast/E. coli shuttle vectors with multiple unique restriction sites. Yeast 2, 163–167. 43. Sikorski, R.S. & Hieter, P. (1989) A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122, 19–27. 44. Miller, J.H. (1972) Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA. 45. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA. 46. Chen, D C., Yang, B C. & Kuo, T T. (1992) One-step trans- formation of yeast in stationary phase. Curr. Genet. 21, 83–84. 47. Southern, E.M. (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98, 503–517. 48. Bradford, M.M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. 49. Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685. 50. Gurvitz, A., Hamilton, B., Hartig, A., Ruis, H., Dawes, I.W. & Rottensteiner, H. (1999) A novel element in the promoter of the Saccharomyces cerevisiae gene SPS19 enhances ORE-dependent up-regulation in oleic acid and is essential for de-repression. Mol. Gen. Genet. 262, 481–492. 51. Lawson, J.E. & Douglas, M.G. (1988) Separate genes encode functionally equivalent ADP/ATP carrier proteins in Saccharo- myces cerevisiae. Isolation and analysis of AAC2. J. Biol. Chem. 263, 14812–14818. 52. Gurvitz, A., Mursula, A.M., Firzinger, A., Hamilton, B., Kil- pela ¨ inen, S.H., Hartig, A., Ruis, H., Hiltunen, J.K. & Rotten- steiner, H. (1998) Peroxisomal D 3 -cis-D 2 -trans-enoyl-CoA isomerase encoded by ECI1 is required for growth of the yeast Saccharomyces cerevisiae on unsaturated fatty acids. J. Biol. Chem. 273, 31366–31374. 53. Geisbrecht, B.V., Zhu, D., Schulz, K., Nau, K., Morrell, J.C., Geraghty, M., Schulz, H., Erdmann, R. & Gould, S.J. (1998) Molecular characterization of Saccharomyces cerevisiae D 3 ,D 2 - enoyl-CoA isomerase. J. Biol. Chem. 273, 33184–33191. 54. Geisbrecht, B.V., Schulz, K., Nau, K., Geraghty, M.T., Schulz, H., Erdmann, R. & Gould, S.J. (1999) Preliminary characteriza- tion of Yor180Cp: identification of a novel peroxisomal protein of Saccharomyces cerevisiae involved in fatty acid metabolism. Biochem. Biophys. Res. Commun. 260, 28–34. 55. Gurvitz, A., Mursula, A.M., Yagi, A.I., Hartig, A., Ruis, H., Rottensteiner, H. & Hiltunen, J.K. (1999) Alternatives to the isomerase-dependent pathway for the b-oxidation of oleic acid are dispensable in Saccharomyces cerevisiae. Identification of YOR180c/DCI1 encoding peroxisomal D 3,5 -D 2,4 -dienoyl-CoA isomerase. J. Biol. Chem. 274, 24514–24521. 56. Gurvitz, A., Rottensteiner, H., Kilpela ¨ inen, S.H., Hartig, A., Hiltunen, J.K., Binder, M., Dawes, I.W. & Hamilton, B. (1997) The Saccharomyces cerevisiae peroxisomal 2,4-dienoyl-CoA reductase is encoded by the oleate-inducible gene SPS19. J. Biol. Chem. 272, 22140–22147. 2022 H. Rottensteiner et al.(Eur. J. Biochem. 270) Ó FEBS 2003 . Saccharomyces cerevisiae Pip2p–Oaf1p regulates PEX25 transcription through an adenine-less ORE Hanspeter Rottensteiner 1 , Andreas Hartig 2 ,. involved in upregulating PEX25. Characterization of the adenine-less ORE regulating PEX25 transcription A more detailed analysis of PEX25 transcription was performed