Eur J Biochem 271, 2417–2427 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04164.x Protection of chylomicron remnants from oxidation by incorporation of probucol into the particles enhances their uptake by human macrophages and increases lipid accumulation in the cells Elizabeth H Moore1, Mariarosaria Napolitano2, Michael Avella1, Fatos Bejta1, Keith E Suckling3, Elena Bravo2 and Kathleen M Botham1 Department of Veterinary Basic Sciences, The Royal Veterinary College, London, UK; 2Istituto Superiore di Sanita, Department of Hematology, Oncology and Molecular Medicine, Viale Regina Elena, Rome, Italy; 3Glaxo SmithKline, Medicines Research Centre, Stevenage, Herts., UK The effects of protection of chylomicron remnants from oxidation on their uptake and induction of lipid accumulation in macrophages were investigated using chylomicron remnant-like particles (CRLPs) containing the lipophilic antioxidant drug, probucol, and macrophages derived from the human monocyte cell line, THP-1 The total lipid content of THP-1 macrophages was markedly higher (·2.2) after 48 h of incubation of THP-1 macrophages with CRLPs containing probucol (pCRLPs) when compared to CRLPs without probucol, and this was because of increases in triacylglycerol (·2.3) and cholesterol (·1.8) levels, while cholesteryl ester concentrations were not significantly changed Determination of the uptake of CRLPs and pCRLPs by the cells using particles labelled with the fluorescent probe 1,1¢dioctadecyl-3,3,3¢3¢-tetramethylindo-carbocyanine perchlorate showed that pCRLPs are taken up at a faster rate than CRLPs The synthesis of triacylglycerol, as measured by the incorporation of [3H]oleate and [3H]glycerol, was also increased in macrophages incubated with pCRLPs as Correspondence to K M Botham, Department of Veterinary Basic Sciences, The Royal Veterinary College, Royal College St., London NW1 0TU, UK Fax: + 44 20 7388 1027, Tel.: + 44 20 7468 5274, E-mail: kbotham@rvc.ac.uk Abbreviations: ABCA1, ATP-binding cassette transporter A1; ACAT1, acyl coenzyme A : cholesterol acyltransferase 1; acLDL, acetylated low-density lipoprotein; apoE, apolipoprotein E; CRLPs, chylomicron remnant-like particles; DGAT1, acyl coenzyme A: diacylglycerol acyl transferase 1; DiI, 1,1¢-dioctadecyl-3,3,3¢3¢-tetramethylindo-carbocyanine perchlorate; HMDM, human monocytederived macrophages; HNE, 4-hydroxy-2(E)-nonenal; LDL, lowdensity lipoprotein; LDLr, low-density lipoprotein receptor; LRP, low-density lipoprotein receptor-related protein; lycCRLPs, chylomicron remnant-like particles containing lycopene; MDA, malondialdehyde; oxLDL, oxidized low-density lipoprotein; pCRLPs, chylomicron remnant-like particles containing probucol; PMA, 4b-phorbol 12-myristate 13-acetate; SR-A, scavenger receptor A; SR-B1, scavenger receptor B1; TBARS, thiobarbituric acid reactive substances; VLDL, very-low-density lipoprotein Enzymes: acyl coenzyme A: cholesterol acyltransferase (EC 2.3.1.26); acyl coenzyme A: diacylglycerol acyl transferase (EC 2.3.1.20) (Received 27 February 2004, revised April 2004, accepted 16 April 2004) compared to CRLPs without probucol, but phospholipid and cholesteryl ester formation from [3H]oleate was unaffected In addition, no differences between the effects of CRLPs and pCRLPs on the expression of mRNA for a range of genes believed to be involved in lipoprotein uptake, intracellular lipid metabolism and the efflux of cholesterol from macrophages was detected These results suggest that antioxidants carried in chylomicron remnants enhance lipid accumulation in macrophages by increasing the rate of uptake of the particles and raising the intracellular synthesis of triacylglycerol, but not cholesteryl ester, and that these effects are brought about by changes at the post-transcriptional level Antioxidants carried in chylomicron remnants therefore may promote the development of atherosclerosis, and this is likely to be particularly important in conditions where clearance of remnants from the circulation is delayed Keywords: chylomicron remnants; probucol; macrophages; lipid accumulation; antioxidants Atherosclerotic lesions are intiated by the formation of fatty streaks in the artery, which form when macrophages in the vessel wall take up lipoproteins from the subendothelial space and eventually become so engorged with lipid that they take on a foamy appearance and are termed foam cells [1,2] Evidence from a large number of previous studies has indicated that low density lipoprotein (LDL) has a major role in the generation of foam cells, but it is also clear that oxidation of the lipoprotein particles, a process which can occur within the artery wall, is necessary before extensive lipid accumulation is induced [3], and this has led to the development of the hypothesis that antioxidants have a beneficial effect in the prevention of atherosclerosis and related cardiovascular disease There is considerable epidemiological evidence to indicate that diets rich in fruits and vegetables (for example, the Mediterranean diet), which contain relatively high levels of natural antioxidants such as vitamin E and carotenoids, reduce the risk of heart disease [4–6] A number of prospective studies have also suggested that consumption of antioxidant vitamins, such as vitamin E and b-carotene, may be beneficial [7,8], and randomized clinical trials with vitamin E supplementation have supported this view [9,10] Ó FEBS 2004 2418 E H Moore et al (Eur J Biochem 271) Despite these strong indications of potential benefits, however, a recent review of large-scale trials of dietary supplementation with b-carotene or vitamin E in healthy human populations has concluded that the results fail to confirm any protective effects of these compounds against cardiovascular disease [11] Dietary lipids, including fats, cholesterol and lipid-soluble antioxidants, are absorbed in the intestine and secreted into lymph in chylomicrons, large triacylglycerol-rich lipoproteins which pass into the blood via the thoracic duct and are then rapidly metabolized by lipoprotein lipase in extrahepatic capillary beds, removing some of the triacylglycerol and leaving smaller remnant particles The chylomicron remnants retain all the cholesterol and minor lipid components, such as antioxidants, and deliver them to the liver for processing [12] There is now a large and growing body of evidence indicating that chylomicron remnants are strongly atherogenic They have been shown to be taken up into the artery wall [13–15] as efficiently as LDL [16], and remnantlike particles containing apolipoprotein E (apoE) have been isolated from human aortic intima and atherosclerotic plaque [17,18] In addition, delayed clearance of remnants from the circulation is correlated with the development of atherosclerotic lesions [19,20] Previous work in our laboratory and by others has demonstrated that chylomicron remnants are able to induce foam cell formation in human monocyte-derived macrophages (HMDM) [21] and in human and murine macrophage cell lines [22–24], and that, in striking contrast to LDL, the remnant particles not require prior oxidation to bring about this effect Information about the effects of antioxidants on macrophage foam cell formation has come mainly from studies with vitamin E and the synthetic lipophilic antioxidant drug, probucol, and the results have been inconsistent Vitamin E has been reported to decrease lipid accumulation and/or the uptake of oxidized LDL (oxLDL) or acetylated LDL (acLDL) in HMDM and the murine macrophage cell line J774, both when added to the medium [25,26], or incorporated into the LDL particles [27], but in other studies no effects of pretreatment with the vitamin could be detected in experiments with HMDM [28], or mouse macrophages [29,30] Similarly, Yamamoto et al [31] found that probucol, either in the free form or bound to the lipoprotein, suppressed lipid accumulation and the uptake of acLDL by human macrophage cell lines, while other workers have found either no effect [32,33] or increased lipid accumulation [30,34] with probucol pretreatment in rabbit or mouse peritoneal macrophages Although it is clear that transport in the blood in chylomicron remnants provides dietary lipid-soluble antioxidants with the opportunity to interact directly with the artery wall to influence atheroma development, little is known about how the incorporation of antioxidants into the remnant particles influences their effects on macrophages In the first study in this area, we have demonstrated recently that chylomicron remnant-like particles (CRLPs) containing lycopene cause markedly increased lipid accumulation in macrophages derived from the human monocyte cell line, THP-1, suggesting that, contrary to what might be expected, protection of chylomicron remnants from oxidation enhances, rather than inhibits, their induction of foam cell formation [35] Our experiments, however, could not rule out the possibility that the findings were a result of properties specific to the lycopene molecule, rather than its antioxidant effects In the present work therefore we investigated the effects of the incorporation of the phenolic lipophilic drug, probucol, which is structurally unrelated to lycopene [36], into CRLPs on lipid accumulation in THP-1 macrophages After confirming that the induction of lipid accumulation in the cells by the particles is enhanced when they are protected from oxidation, we investigated the mechanism of this effect by comparing the influence of CRLPs and CRLPs containing probucol (pCRLPs) on the uptake of the particles by the cells, intracellular lipid synthesis, and the expression of mRNA for genes believed to play a part in foam cell formation, including those regulating lipoprotein uptake [such as the LDL receptor (LDLr), the low-density lipoprotein receptor-related protein (LRP), scavenger receptor A (SR-A), and CD36], intracellular lipid metabolism [acyl coenzyme A: cholesterol acyltransferase (ACAT1), acyl coenzyme A: diacylglycerol acyltransferase (DGAT1)], the efflux of cholesterol from the cells [scavenger receptor B1 (SR-B1)], and the ATPbinding cassette transporter A1 (ABCA1) Materials and methods RPMI-1640, fetal bovine serum, L-alanyl-L-glutamine (glutamax), penicillin/streptomycin and 2-mercaptoethanol were obtained from Gibco Fetal bovine serum was heat inactivated by incubation at 56 °C for 30 before use Trypan blue, fatty acid-free BSA, phospholipids, cholesterol, cholesteryl oleate, probucol, lycopene and 4b-phorbol 12-myristate 13-acetate (PMA) were supplied by Sigma The fluorescent probe 1,1¢-dioctadecyl-3,3,3¢3¢-tetramethylindocarbocyanine perchlorate (DiI) was purchased from Cambridge Bioscience The radioisotopes L-3 phosphatidylcholine 1-palmitoyl-2-[114C]linoleoyl and [1(3)-3H]glycerol were purchased NEN Life Science Products Inc., and [9,10(n)-3H]oleate was from Amersham International Preparation of CRLPs CRLPs were prepared by sonication of a lipid mixture containing 70% trilinolein, 2% cholesterol, 5% cholesteryl ester and 25% phospholipids, in Tricine buffer (20 mM, pH 7.4) containing 0.9% NaCl, followed by density-gradient centrifugation and binding to human apoE, as described previously [37] Sonication was performed at 22–24 lm for 20 at 56 °C, and the resulting emulsion was adjusted to a density of 1.21 gỈmL)1 with KBr, layered under a stepwise density gradient, and centrifuged at 17 000 g for 20 at 20 °C The upper layer of grossly emulsified lipids was then removed and replaced with an equal volume of 0.9% NaCl (d ẳ 1.006 gặmL)1) and the tubes were centrifuged at 70 000 g for h (20 °C) Lipid particles harvested from the top layer were incubated with the dialysed (18 h, °C), d > 1.063 gỈmL)1, fraction of human plasma (obtained from the National Blood Service, North London Centre, London, UK) at 37 °C with shaking for h [lipid particles/ plasma, : 1, (v/v)] CRLPs were then isolated by ultracentrifugation (120 000 g, 16 h, 12 °C), harvested from the top layer and stored at °C under argon until required Analysis by SDS–PAGE showed that the particles Ó FEBS 2004 Foam cell induction by chylomicron remnants (Eur J Biochem 271) 2419 contained apoE and no other lipoproteins For the preparation of CRLPs containing antioxidants and/or the DiI fluorescent label, probucol, lycopene and/or DiI was added to the lipid mixture prior to sonication Taking into account the amount of probucol or lycopene added to the lipid mixture for sonication and the percentage recovery of the starting lipids in the CRLPs, we estimate that the concentrations of probucol or lycopene used in our experiments did not exceed 10 lM Culture of THP-1 cells THP-1 monocytes were maintained in suspension in RPMI1640 containing 10% fetal bovine serum, mM glutamine, 100 mL)1 penicillin, 100 mgỈmL)1 streptomycin and 50 mM 2-mercaptoethanol (culture medium), at a density of 3–9 · 105 cells per mL at 37 °C in 5% air/95% CO2 The cells were induced to differentiate into macrophages by incubation for 72 h in the presence of PMA (200 ngỈmL)1) Then, cells adhering to the culture plates, and the medium containing the PMA and any remaining monocytes, were removed Viability of THP-1 macrophages, as assessed by Trypan blue exclusion, was > 95% For studies on lipid accumulation, CRLPs or pCRLPs (30 lgỈmL)1 cholesterol), were added to the macrophages and the incubation was continued for a further 48 h before the cells were harvested and their lipid content determined For uptake studies, DiI-labelled CRLPs or pCRLPs (30 lgỈmL)1 cholesterol) were incubated with THP-1 macrophages for various time-periods and the cells were then viewed with a Zeiss LMS 510 laser-scanning confocal microscope To determine the incorporation of [3H]oleate into cellular lipids, THP-1 macrophages were incubated with CRLPs or pCRLPs (30 lgỈmL)1 cholesterol) for 48 h The medium was then removed and, after washing the cells three times with mL of warm phosphate-buffered saline (NaCl/Pi), replaced with culture medium (1 mL) containing [9,10-3H]oleic acid (37 KBqỈmL)1, 55 000 d.p.m.Ỉlmol)1) and 2% fat-free BSA The incubation was continued for h, the cells were washed three times with mL of NaCl/Pi, and the lipids were extracted with isopropanol/hexane (3 : 2, v/v) (2 mL · 30 min, then mL · 20 repeated four times), separated by TLC (hexane/diethyl ether/formic acid, 80 : 20 : 2, v/v/v) and the bands corresponding to triacylglycerol, diacylglycerol, phospholipid, cholesteryl ester, and nonesterified fatty acids (visualized with iodine vapour) were scraped into vials for determination of the radioactivity by liquid scintillation counting using Lumagelsafe scintillant (Perkin Elmer Life Sciences) Preliminary experiments showed that [3H]oleate incorporation into lipids was linear over a period of h under the conditions used Incorporation of [3H]glycerol into triacylglycerol was determined using a modification of the method described by Davis et al [38] Cells were incubated for h at 37 °C in 95% air/5% CO2 in serum-free medium containing CRLPs or pCRLPs (20 lgỈmL)1 cholesterol) in the presence of [3H]glycerol (148 KBqỈmL)1, 20 lM) After incubation, the cells were washed twice with NaCl/Pi [14C]Phosphatidylcholine (900 d.p.m.) was added to each tube as an internal standard and the lipids were extracted and separated by TLC, as described previously [22] Proteins were harvested from the plates, after extraction of the lipids, by the addition of mL of NaOH (1 M) mRNA analysis The relative abundance of transcripts for the LDLr, LRP, SR-A, SR-B1, CD36, ACAT1, DGAT1, and ABCA1 was determined by RT-PCR Total mRNA was extracted from the cells using a kit from Promega UK, and first-strand synthesis was carried out using Avian myeloblastosis virus reverse transcriptase The primers used and the product sizes for the genes tested are shown in Table Amplification conditions were: initial denaturation at 95 °C for 15 min, followed by 30 cycles (LDLr, ACAT1, DGAT1), 33 cycles (SR-A, SR-B1, CD36, ABCA1) or 34 cycles (LRP) consisting of denaturation at 94 °C for 30 s, annealing at 58 °C for and extension at 72 °C for min, with the final extension at 72 °C for 10 The products were analysed by electrophoresis on an agarose gel [1.2%, (w/v)] containing ethidium bromide (0.5 lgỈmL)1) and the bands were quantified by absorbance volume analysis using values for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) obtained simultaneously in the same system The linearity of the assay for each gene was established in preliminary experiments Analytical methods The total cholesterol (cholesterol + cholesteryl ester), cholesterol, triacylglycerol and phospholipid content of Table Primer sequences and product sizes for RT-PCR ABCA1, ATP-binding cassette transporter A1; ACAT1, acyl coenzyme A: cholesterol acyltransferase 1; DGAT1, acyl coenzyme A: diacylglycerol acyl transferase 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; LDLr, lowdensity lipoprotein receptor; LRP, low-density lipoprotein receptor-related protein; SR-A, scavenger receptor A; SR-B1, scavenger receptor B1 Gene Forward primer Reverse primer Product size (bp) LDLr LRP SR-A CD36 SR-B1 ACAT1 DGAT1 ABCA1 GAPDH AGTTGGCTGCGTTAATGTGAC CCCAGGTGTCTACCATCACAC TTCCTCACACTGGCACTTGTA GGGGTTGTAGAGTTCCAGGTC ATTGCCCTTTACCTCCTCGT AGATGCAGCCTCATTTCCAC ATGAGGTTGGCTTCCATGTC TGGGTTTTCAACTGGAGAGG GAAACTGCAGCTGAGCCTCT ACCTACTTGGCTCCGGATTT CTACAAGGCAGGCAGTATTGG CCTGTGTTGAGGGAGTACCTG TAAGCGTCCTGTTCATTTCGT GGGCGAAACCAATGTATTTCT AACAGTTTGTGGCCCTTTTG AATGACCCCTTCATTGACCTC AGTTCCAGGCTGGGGTACTT GTTCACACCCATGACGAACAT 343 326 248 175 250 334 328 157 309 Ó FEBS 2004 2420 E H Moore et al (Eur J Biochem 271) CRLPs and cell samples was determined by enzymatic analysis using kits supplied by Sigma Cholesteryl ester levels were calculated by subtracting the values for cholesterol from those for total cholesterol The thiobarbituric acid reactive substances (TBARS) content of the preparations was determined as described by Steinbrecher et al [39] Tetraethoxypropane, which yields malondialdehyde (MDA), was used as a standard The levels of MDA and 4-hydroxy-2(E)-nonenal (4-HNE) were assayed using Bioxytech LPO-586 (Oxis International Inc, Portland, OR, USA) For the determination of conjugated diene formation, CRLPs or pCRLPs (50 nmolỈmL)1 triacylglycerol) were incubated at 30 °C in the presence or absence of CuSO4 (50 lM) and the change in absorbance at 234 nm was measured Fluorescence per cell in macrophages treated with DiIlabelled CRLPs or pCRLPs was quantified by absorbance volume analysis The fluorescence for the entire field was assessed, the background deducted and the value divided by the number of cells in the field Two or three fields with approximately equivalent numbers of cells were analysed in each experiment Values were normalized for variations in the fluorescence of different preparations using the fluorescence units per lmol of cholesterol, measured in a fluorimeter Significance limits were calculated using the Student’s t-test, Student’s paired t-test or ANOVA, as indicated Results Characteristics of CRLPs and pCRLPs The lipid content of the CRLPs and pCRLPs used is shown in Table The total cholesterol, triacylglycerol and phospholipid content, and the triacylglycerol/total cholesterol ratio, were not significantly different in the two types of particles TBARS values, however, were significantly lower in pCRLPs than in CRLPs The lipid and TBARS content of the CRLPs and pCRLPs was not affected by the incorporation of the DiI fluorescent label After incubation with CuSO4 (10 lM, 18 h), the levels of the lipid peroxidation products MDA and 4-HNE (pmolỈnmol)1 triacylglycerol) in pCRLPs (7.2 ± 1.7) were also markedly lower (P < 0.05) than those in CRLPs (62.1 ± 15.4) Little conjugated diene formation, as measured by the increase in absorbance at 234 nm, was observed when CRLPs or pCRLPs were incubated at 30 °C for periods of up to 420 min, but on incubation with CuSO4 (50 lM), CRLPs showed a marked rise in diene formation, which was not seen with pCRLPs (Fig 1) Effect of CRLPs containing probucol on lipid accumulation in THP-1 macrophages Exposure of THP-1 macrophages to either CRLPs or pCRLPs caused a considerable increase in the total lipid accumulated in the cells after 48 h (Table 3) Comparison of the effects of the two types of particles, however, showed that pCRLPs had a markedly greater effect The total lipid content in pCRLP-treated cells was 221% that of CRLPtreated macrophages (Table 3), and this was a result of increases in both triacylglycerol (+132%) and total cholesterol (+73%) levels Cholesteryl ester levels, however, were not significantly changed; thus the increase in the total cholesterol fraction was entirely the result of higher cholesterol concentrations (+84%) (Table 3) Uptake of CRLPs and pCRLPs by THP-1 macrophages THP-1 macrophages were incubated with DiI-labelled CRLPs or pCRLPs for periods between and 24 h, and the cells were then viewed by confocal microscopy The amount of fluorescence associated with the cells increased markedly, with time, in experiments with both types of particles, but there was clearly more in pCRLP-treated macrophages, even at early time-points (Fig 2) Quantification of the cell-associated fluorescence (Fig 3) confirmed that the rate of uptake of pCRLPs was considerably higher than that of CRLPs Table Lipid and thiobarbituric acid reactive substances (TBARS) content of chylomicron remnant-like particles (CRLPs) Standard CRLPs, and CRLPs containing probucol (pCRLPs), were prepared as described in the Materials and methods and the triacylglycerol (TG), total cholesterol (TC), phospholipid (PL) and TBARS levels were determined Data shown represent the mean ± SEM from eight preparations MDA, malondialdehyde Parameter CRLPs TC (lmolỈmL)1) TG (lmolỈmL)1) PL (lmolỈmL)1) TG : TC TBARS (nmol of MDA per lmol of TG) 0.97 3.74 0.53 3.98 2.54 a ± ± ± ± ± P < 0.01 vs CRLPs (Student’s t-test) pCRLPs 0.23 0.88 0.12 0.23 1.1 0.93 3.93 0.61 4.33 0.65 ± ± ± ± ± 0.19 0.76 0.11 0.29 0.57a Fig Conjugated diene formation after incubation of CRLPs or pCRLPs in the presence or absence of CuSO4 Chylomicron remnantlike particles (CRLPs) or CRLPs containing probucol (pCRLPs) (50 nmolỈmL21 triacylglycerol) were incubated in the presence or absence of CuSO4 (50 mM) at 30 °C and the absorbance at 234 nm was measured, at the intervals indicated, for 420 n, CRLPs; m, CRLPs + CuSO4; s, pCRLPs; d, pCRLPs + CuSO4 Data are expressed as the change in absorbance with time Each point represents the mean of four experiments performed with separate CRLP preparations, and error bars show the SEM Ó FEBS 2004 Foam cell induction by chylomicron remnants (Eur J Biochem 271) 2421 Table Effect of chylomicron remnant-like particles (CRLPs) and CRLPs containing probucol (pCRLPs) on the cholesterol (C), cholesteryl ester (CE) and triacylglycerol (TG) content of THP-1 macrophages THP-1 macrophages were incubated with CRLPs or pCRLPs (30 lgỈmL)1 of total cholesterol) for 48 h and the TG, C, CE, and total cholesterol (TC) (C + CE) content of the cells was determined Data are expressed as nmolỈmg)1 of cell protein and represent the mean ± SEM from five separate experiments Lipid Control Total lipid (TG + TC) TG TC C CE 164.4 90.6 73.8 72.0 1.8 a ± ± ± ± ± CRLPs 38.3 22.7 15.9 16.4 1.0 556.7 453.7 103.0 83.6 19.4 ± ± ± ± ± pCRLPs 75.0 60.6 17.0 12.2 5.5 1291.5 1117.4 174.1 150.6 23.5 ± ± ± ± ± pCRLPs/CRLPs (%) 311.2a 308.5a 33.3a 25.3a 10.7 221.1 232.4 172.9 183.7 111.1 ± ± ± ± ± 29.7 42.5 27.3 24.6 52.8 P < 0.05 vs CRLPs (Student’s paired t-test) Effect of pCRLPs on lipid synthesis in THP-1 macrophages The effects of CRLPs and pCRLPs on lipid synthesis in THP-1 macrophages were investigated by measuring the incorporation of [3H]oleate into triacylglycerol, diacylglycerol, phospholipid and cholesteryl ester after incubation of the cells with the particles for 48 h (Table 4) The amount of triacylglycerol formed from [3H]oleate was increased by  50% in macrophages exposed to pCRLPs as compared to CRLPs, while the radioactivity found in diacylglycerol was decreased by  40% Incorporation of [3H]oleate into phospholipid and cholesteryl ester, and the amount of radioactivity found in nonesterified fatty acids, however, was not significantly different in experiments with the two types of particles Similar experiments using [3H]glycerol (n ¼ 4) also showed that triacylglycerol formation was increased in macrophages treated with pCRLPs (12.02 ± 1.95 pmol of triacylglycerol formed per minute per mg of cell protein) as compared to CRLPs (9.79 ± 0.94 pmol of triacylglycerol formed per minute per mg of cell protein, P < 0.05) Effect of CRLPs containing probucol or lycopene on mRNA expression in THP-1 macrophages THP-1 macrophages were incubated with CRLPs or pCRLPs for 48 h and the levels of mRNA for nine genes believed to play a role in foam cell formation was measured by RT-PCR The results are shown in Table The relative abundance of transcripts for LDLr, CD36, ACAT1 and ABCA1 was not significantly changed by either type of particle There was a significant decrease, however, in mRNA levels for the LRP ()71 to )78%), SR-A ()33%) and SR-B1 ()20 to )34%) in experiments with both CRLPs and pCRLPs In addition, DGAT1 mRNA concentrations were increased by both types of lipoproteins, but because of the large variation in individual samples, these changes did not reach significance However, all six values from CRLPtreated cells (three for CRLPs and three for pCRLPs) were higher than those from control cells incubated without lipoproteins, with the increases ranging from 35 to 350% No differences were observed between the effects of CRLPs and pCRLPs on any of the genes investigated We have reported the influence of CRLPs containing lycopene (lycCRLPs) on the expression of mRNA for LDLr, LRP, ACAT1 and DGAT1 in THP-1 macrophages in a previous study [35] In order to compare the effects of pCRLPs and lycCRLPs on all the genes tested in the present work, we therefore measured the effects of lycCRLPs on levels of mRNA for SR-A, CD36, SR-B1, adipophilin and ABCA1 The results were generally similar to those obtained with pCRLPs (Table 6), with mRNA levels for CD36 and ABCA1 levels not significantly changed, and decreases of a similar extent observed in those for SR-A ()39%) and SR-B1 ()21%), although, in this case, the change in SR-B1 mRNA did not reach significance Discussion The aim of this study was to investigate the effects of lipophilic antioxidants carried in chylomicron remnants on the induction of lipid accumulation in macrophages However, as it is difficult to obtain chylomicron remnants from human blood uncontaminated with lipoproteins of similar density, such as chylomicrons and very-low-density lipoprotein (VLDL), it was necessary to use model CRLPs to mimic the action of the remnant lipoproteins The size, density and lipid composition of the CRLPs used was similar to that of physiological remnants [40,41], and they also contained human apoE Extensive previous studies in both humans and experimental animals have shown that model particles of this type are cleared from the blood and metabolized in a similar way to the corresponding physiological lipoproteins [42–45], and CRLPs containing apoE from the appropriate species have also been found to have effects which mimic those of physiological remnants in rat hepatocytes and pig endothelial cells [40,46–48] As lipophilic antioxidants can easily be incorporated into the model particles, CRLPs provide a suitable and convenient model for our experiments In previous work, we have demonstrated that CRLPs containing lycopene, a carotenoid with antioxidant properties [6], markedly enhance lipid accumulation in THP-1 cells, suggesting that dietary antioxidants carried in chylomicron remnants may promote, rather than inhibit, macrophage foam cell formation [35] In order to test the hypothesis that this effect was caused by the protection of the remnants from oxidation, rather than a specific effect of lycopene, and to further investigate the mechanisms involved, we used CRLPs containing probucol, a phenolic antioxidant lipophilic drug that is structurally unrelated to lycopene [36] Probucol has been used extensively to study the effects of antioxidants on atherosclerosis [49], and has been shown to bind to VLDL and LDL, and to provide the particles with greater antioxidant protection than vitamin E and many other antioxidants [50] The concentration of 2422 E H Moore et al (Eur J Biochem 271) Ó FEBS 2004 Fig THP-1 macrophages were incubated with 1,1¢-dioctadecyl-3,3,3¢3¢-tetramethylindo-carbocyanine perchlorate (DiI)-labelled chylomicron remnant-like particles (CRLPs) or pCRLPs (30 lgỈmL21 cholesterol) for h (A, CRLPs; B, pCRLPs), h (C, CRLPs; D, pCRLPs) or 24 h (E, CRLPs; F, pCRLPs), and viewed by confocal microscopy In each set of three panels, the top left shows the fluorescence, the top right the cells, and the bottom left the two merged Images shown are from a typical experiment of three performed Ó FEBS 2004 Foam cell induction by chylomicron remnants (Eur J Biochem 271) 2423 Fig THP-1 macrophages were incubated with 1,1¢-dioctadecyl3,3,3939-tetramethylindo-carbocyanine perchlorate (DiI)-labelled chylomicron remnant-like particles (CRLPs) (m) or pCRLPs (d) (30 lgỈmL21 cholesterol) for the times indicated The amount of fluorescence associated with the cells was determined by optical volume density analysis and normalized for variations in the fluorescence in different preparations using the fluorescence units per lmol of cholesterol Each point shows the mean of three separate experiments, and error bars show the SEM The difference between the two curves was highly significant (P < 0.001; ANOVA repeated measures) probucol added to the macrophages (not exceeding 10 lM) in our experiments was comparable to [32,34,51] or lower than [31,33,52,53] the levels used in previous work to study the effects of the drug on foam cell formation in vitro Furthermore, the pCRLPs were significantly more resistant to oxidation than CRLPs, as indicated by the lower concentration of TBARS in the particles (Table 2), the markedly lower levels of MDA and 4-HNE after their exposure to CuSO4, and their resistance to copper-induced conjugated diene formation (Fig 1) In agreement with our previous work on physiological chylomicron remnants and CRLPs [21–23], incubation of macrophages with CRLPs caused a considerable increase in intracellular total lipid accumulation without prior oxidation of the particles (Table 3) When probucol was incorporated into the CRLPs, however, this effect was enhanced by more than twofold, and this was caused by an increase in triacylglycerol (·2.3) and cholesterol (·1.8) levels, while the cholesteryl ester content was unaffected These results are strikingly similar to those obtained in our previous work with CRLPs containing lycopene [35], and thus strongly suggest that the protection of chylomicron remnants from oxidation enhances, rather than inhibits, their induction of lipid accumulation in macrophages The enhancement of lipid accumulation in macrophages by CRLPs containing probucol and lycopene contrasts sharply with the effects of antioxidants on the induction of foam cell formation by acLDL or oxLDL Yamamoto et al [31,52] have found that foam cell formation in response to acLDL in the human cell lines UE-12 and THP-1 is suppressed by probucol, when added to the medium either in its free form or in acLDL prepared from patients given the drug, and vitamin E has also been reported to decrease the induction of lipid accumulation by oxLDL or acLDL in HMDM and in J774 cells in both these conditions [25–27] In other studies, however, no effect on the induction of foam cell formation by acLDL or oxLDL in the presence of probucol or vitamin E was detected [28,29,32], and two investigations have shown an increase in macrophage cholesteryl ester content after incubation with acLDL in the presence of probucol [30,34] Despite this inconsistency, there have been no reports of antioxidants causing massive increases in the induction of lipid accumulation in macrophages by acLDL or oxLDL comparable to those found in the present study with CRLPs containing probucol or lycopene These findings suggest that the effects of dietary lipophilic antioxidants on macrophages differ markedly, depending on the lipoprotein in which they are carried, so that during their transport from the gut to the liver in chylomicron remnants they promote foam cell formation, and their beneficial effects are only apparent after their incorporation into LDL, as oxidation of these particles greatly enhances their atherogenic effects [3] One possible explanation for the raised lipid content of macrophages treated with pCRLPs, as compared to CRLPs, is that protection of the particles from oxidation increases their uptake by the cells We investigated this hypothesis using CRLPs and pCRLPs labelled with the DiI fluorescent probe, and the results clearly demonstrate that the presence of probucol in CRLPs markedly increases their rate of uptake by THP-1 macrophages (Figs and 3) These findings are again in contrast to those on the effects of antioxidants on the uptake of acLDL or oxLDL, which has been reported (in experiments using DiI fluorescencelabelled or radiolabelled lipoproteins) to be decreased after incubation of macrophages pretreated with or in the presence of probucol [31,53], or vitamin E [25,26,53], although Ku et al [33] found no effect of probucol on acLDL uptake in rabbit peritoneal macrophages The mechanisms mediating the uptake of chylomicron remnants in macrophages are not yet clearly defined The LDLr appears to play a role, but other receptors (such as the LRP) and various scavenger receptors (such as SR-A and CD36) may also be involved [54] The faster rate of uptake of pCRLPs suggests that probucol may promote interaction with the receptor protein, or possibly that different receptors mediate their uptake Investigation of the effects of CRLPs and pCRLPs on the expression of mRNA for the LDLr and the LRP in the present work showed that both types of particles suppressed mRNA levels for the LRP, but had no effect on those for the LDLr (Table 5), and this is generally consistent with the results obtained in our previous study with CRLPs containing lycopene [35] In addition, we found that the expression of mRNA for SR-A was decreased by both pCRLPs and lycCRLPs, while that for the class B scavenger receptor, CD36, was essentially unaffected (Table 5) There were no significant differences, however, in mRNA levels for any of the receptors tested in macrophages treated with CRLPs, with or without antioxidants We conclude therefore that the increased rate of uptake of pCRLPs, as compared to CRLPs, unequivocally Ó FEBS 2004 2424 E H Moore et al (Eur J Biochem 271) Table Effect of chylomicron remnant-like particles (CRLPs) and CRLPs containing probucol (pCRLPs) on the incorporation of [3H]oleate into lipids in THP-1 macrophages THP-1 macrophages were incubated with CRLPs or pCRLPs (30 lgỈmL)1 of cholesterol) for 48 h The medium containing lipoproteins was then removed, the cells were incubated with [3H]oleate (37 KBqỈmL)1) for h and the incorporation of radioactivity into triacylglycerol (TG), diacylglycerol (DG), cholesteryl ester (CE) and phospholipid (PL) during a h incubation was determined Data are expressed as pmol lipid formed min)1Ỉmg)1 of cell protein and represent the mean ± SEM from three separate experiments NEFA, nonesterified fatty acids Lipid CRLPs TG DG PL CE NEFA a P < 0.05, 8.73 2.35 14.54 0.84 1.67 b ± ± ± ± ± pCRLPs 0.55 0.12 0.97 0.15 0.28 12.99 1.35 17.29 0.72 1.08 ± ± ± ± ± pCRLPs/CRLPs (%) b 149.1 58.4 116.4 92.7 87.6 0.61 0.08a 4.13 0.02 0.34 ± ± ± ± ± 4.6 5.7 22.8 20.0 11.5 P < 0.01 vs CRLPs (Student’s paired t-test) Table Effects of chylomicron remnant-like particles (CRLPs) and CRLPs containing probucol (pCRLPs) on mRNA levels for genes involved in foam cell formation THP-1 macrophages were incubated with or without CRLPs or pCRLPs (30 lgỈmL)1 of cholesterol) for 48 h, and the levels of mRNA for the genes indicated were determined by RT-PCR The bands were quantified by absorbance (OD) analysis and the values were normalized using those obtained for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in the same system Data are expressed as OD units and as the percentage of the values found with untreated (control) macrophages, and represent the mean ± SEM from three experiments ABCA1, ATP-binding cassette transporter A1; ACAT1, acyl coenzyme A : cholesterol acyltransferase 1; DGAT1, acyl coenzyme A : diacylglycerol acyl transferase 1; LDLr, low-density lipoprotein receptor; LRP, low-density lipoprotein receptor-related protein; SR-A, scavenger receptor A; SR-B1, scavenger receptor B1 Control CRLPs Gene OD units OD units % Control OD units % Control LDLr LRP SR-A CD36 SR-B1 ACAT1 DGAT1 ABCA1 0.41 1.06 1.59 1.75 2.45 0.43 0.34 1.31 0.47 0.33 1.12 1.69 1.55 0.41 0.86 1.35 168.1 28.9 67.9 101.3 63.6 126.2 305.9 108.5 0.48 0.25 1.17 1.89 1.94 0.55 0.90 1.39 86.3 21.8 67.2 122.6 80.2 151.3 290.3 101.5 a ± ± ± ± ± ± ± ± 0.19 0.19 0.44 0.67 0.23 0.15 0.11 0.46 ± ± ± ± ± ± ± ± pCRLPs 0.16 0.11 0.37 0.54 0.14 0.06 0.06 0.35 ± ± ± ± ± ± ± ± 63.5 6.1a 5.9a 7.5 2.2b 49.1 87.1 10.7 ± ± ± ± ± ± ± ± 0.25 0.14 0.49 0.45 0.19 0.08 0.21 0.60 ± ± ± ± ± ± ± ± 48.7 10.2b 11.9a 27.8 7.3a 34.5 85.1 15.3 P < 0.05, bP < 0.01 vs control macrophages (ANOVA) Table Effects of chylomicron remnant-like particles (CRLPs) and CRLPs containing lycopene (lycCRLPs) on mRNA levels of genes involved in foam cell formation THP-1 macrophages were incubated with or without CRLPs or lycCRLPs (30 lgỈmL)1 cholesterol) for 48 h, and mRNA levels of the genes indicated were determined by RT-PCR The bands were quantified by absorbance (OD) analysis and the values were normalized using those obtained for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in the same system Data are expressed as OD units and as the percentage of the values found with untreated (control) macrophages, and represent the mean ± SEM from three experiments ABCA1, ATP-binding cassette transporter A1; SR-A, scavenger receptor A, SR-B1, scavenger receptor B1 Control CRLPs Gene OD units OD units % Control SR-A CD36 SR-B1 ABCA1 1.61 2.19 2.78 1.74 1.03 1.35 2.05 1.01 61.6 61.6 73.2 59.1 a ± ± ± ± 0.18 0.13 0.23 0.20 ± ± ± ± pCRLPs 0.27 0.19 0.24 0.19 ± ± ± ± 9.4a 8.6 3.0 11.6 OD units % Control 1.01 2.13 2.15 1.32 61.3 96.5 79.4 80.6 ± ± ± ± 0.25 0.53 0.58 0.33 ± ± ± ± 11.5a 23.4 25.8 27.6 P < 0.05, vs control macrophages (ANOVA) demonstrated in the experiments with fluorescent-labelled particles, is not caused by regulation of these proteins at the transcriptional level Another mechanism by which antioxidants may influence lipid accumulation in macrophages is by altering intracellular lipid metabolism Pretreatment of J774 macrophages with vitamin E, as well as incorporation of vitamin E into LDL, has been found to decrease cholesteryl ester synthesis from radiolabelled oleate in the presence of oxLDL or acLDL [25,27], although Asmis et al [29] did not detect any effect of the vitamin on cholesteryl ester formation in the murine macrophage cell line, PD388D1 Takemura et al Ó FEBS 2004 Foam cell induction by chylomicron remnants (Eur J Biochem 271) 2425 [34], on the other hand, have reported increased cholesteryl ester production and the activity of ACAT, the enzyme responsible for cholesterol esterification, in mouse peritoneal macrophages exposed to probucol in the presence and absence of acLDL In our experiments, the presence of probucol in CRLPs did not change the rate of formation of cholesteryl ester in THP-1 macrophages (Table 4) In addition, there was no significant effect on the expression of mRNA for ACAT1, the isoform of the enzyme found in macrophages (Table 5), and this is consistent with our previous findings with CRLPs containing lycopene [35] In contrast to the lack of any effect of pCRLPs, as compared to CRLPs, on cholesteryl ester synthesis in macrophages, triacylglycerol synthesis was increased significantly, as demonstrated in experiments with both [3H]oleate (Table 5) and [3H]glycerol The accompanying decrease in the amount of radioactivity from [3H]oleate found in diacylglycerol suggests that the activity of DGAT1, the enzyme which controls the final and only committed step in triacylglycerol synthesis in macrophages, using diacylglycerol as the substrate [55], may be increased The expression of DGAT1 mRNA, however, was raised by both pCRLPs and CRLPs, suggesting that any effect of probucol occurs at a post-transcriptional level The increase in DGAT1 mRNA levels found here differs from our previous study, where we found that CRLPs containing lycopene caused a significant decrease, which was not observed with control CRLPs [35] This is the only major difference we have found, to date, between the effects of CRLPs containing probucol or lycopene, and thus may be related to specific effects of the molecules, rather than their antioxidant properties In general, our findings on intracellular lipid synthesis show that increased triacylglycerol synthesis, but not cholesteryl ester formation, contributes to the enhancement of lipid accumulation by antioxidants carried in chylomicron remnants Cholesterol efflux from macrophages is mediated by the ABCA1 [56], and the scavenger receptor SR-B1, which binds the high-density lipoprotein cholesterol acceptor [57] The expression of mRNA for ABCA1 was not changed by CRLPs or CRLPs containing probucol or lycopene, while that for the SR-B1 was decreased by all three types of particles to a similar extent (Tables and 6) We found no evidence therefore that antioxidants carried in chylomicron remnants influence the transcription of genes involved in the efflux of cholesterol from macrophages Probucol has been used extensively to investigate the effects of antioxidants on atherosclerosis development, and the results generally have provided strong support for the beneficial effects of such compounds A number of studies, however, have shown consistently that probucol promotes atherogenesis in apoE- or LDLr-deficient mice [49] Our findings, that lipid accumulation in macrophages is enhanced by probucol carried in chylomicron remnants, provide a possible explanation for this apparently paradoxical effect, as both apoE and the LDLr have an important role in the removal of chylomicron remnants from the blood, and studies have demonstrated that remnant levels in plasma are raised and clearance is delayed in mice deficient in either of these two proteins [58–60] In conclusion, the experiments reported here demonstrate that antioxidants carried in chylomicron remnants enhance lipid accumulation in macrophages, and that this is caused by a markedly increased rate of uptake of the particles and by a raised intracellular synthesis of triacylglycerol, but not of cholesteryl ester Furthermore, the effect does not appear to be caused by changes in the transcription of genes involved in the regulation of the uptake of the lipoprotein particles, cholesteryl ester or triacylglycerol synthesis, or the efflux of cholesterol from the cells These findings suggest that the type of lipoprotein carrier of dietary antioxidants is crucial for their effects on macrophages Thus, when they are carried in LDL, oxidation and the subsequent detrimental effects of the particles are inhibited, but lipid accumulation is promoted during their transport postprandially in chylomicron remnants This may be particularly important in conditions where the clearance of remnants from the circulation is delayed, and may also provide part of the explanation for the failure to demonstrate beneficial effects of dietary lipophilic antioxidants in large-scale intervention studies [11] Acknowledgements This work was supported by grants from the Istituto Superiore di ` Sanita (ISS Art.524; fasc 2147/RI and C3BP) E H M and F B were supported by BBSRC CASE studentships sponsored by Glaxo SmithKline References Ross, R (1993) The pathogenesis of atherosclerosis: a perspective for the 1990s Nature 362, 801–809 Libby, P., Geng, Y.J., Aikawa, M., Schoenbeck, U., Mach, F., Clinton, S.K., Sukhova, G.K & Lee, R.T (1996) Macrophages and atherosclerotic plaque stability Curr Opin Lipidol 7, 330–335 Steinberg, D (1997) Low density lipoprotein oxidation and its pathobiological significance J Biol Chem 272, 20963–20966 Trichopoulou, A & Vasilopoulou, E (2000) Mediterranean diet and longevity Br J Nutr 84, 205–209 de Lorgeril, M (1998) Mediterranean diet in the prevention of coronary heart disease Nutrition 14, 55–57 Rao, A.V (2002) Lycopene, tomatoes and the prevention of coronary heart disease Exp Biol Med 227, 908–913 Kohlmeier, L., Kark, J.D., Gomez-Garcia, E., Matin, B.C., Steck, S.E., Kardinaal, A.F.M., Ringstad, J., Thamm, M., Masaev, V., Riemersma, R., Martin-Moreno, J.M., Huttunen, J.K & Kok, F (1997) Lycopene and myocardial infarction risk in the EURAMIC study Am J Epidemiol 146, 618–626 Agarwal, S & Rao, A.V (2000) Carotenoids and chronic diseases Drug Metab Drug Interact 17, 189–209 Virtamo, J., Rapola, J.M., Ripatti, S., Heinonen, O.P., Taylor, P.R., Albanes, D & Huttenen, O.P (1998) Effect of vitamin E and beta-carotene on the incidence of primary nonfatal myocardial infarction and fatal coronary heart disease Arch Intern Med 158, 668–675 10 Stephens, N.G., Parsons, A., Schodiel, P.M., Kelly, F., Cheeseman, K & Mitchison, M.J (1996) Radomised controlled trial of vitamin E in patients with coronary disease: Cambridge heart antioxidant study (CHAOS) Lancet 347, 781–786 11 Clarke, R & Armitage, J (2002) Antioxidant vitamins and risk of cardiovascular disease Review of large scale randomised trials Cardiovasc Drugs Ther 16, 411–415 12 Redgrave, T.G (1983) Formation and metabolism of chylomicrons Int Rev Physiol 28, 103–130 2426 E H Moore et al (Eur J Biochem 271) 13 Mamo, J.C., Proctor, S.D & Smith, D (1998) Retention of chylomicron remnants by arterial tissue; importance of an efficient clearance mechanism from plasma Atherosclerosis 141, S63– S69 14 Proctor, S.D & Mamo, J.C.L (1998) Retention of fluorescentlabelled chylomicron remnants within the intima of the artery wall – evidence that plaque cholesterol may be derived from postprandial lipoproteins Eur J Clin Invest 28, 497–503 15 Grieve, D.J., Avella, M.A., Elliott, J & Botham, K.M (1998) Influence of chylomicron remnants on endothelial cell function in the isolated perfused rat aorta Atherosclerosis 139, 273–281 16 Mamo, J.C.L & Wheeler, J.R (1994) Chylomicrons or their remnants penetrate rabbit thoracic aorta as efficiently as smaller macromolecules, including low density lipoprotein, high density lipoprotein and albumin Coronary Artery Dis 5, 695–705 17 Yla-Herttuala, S., Jaakkola, O., Enholm, C., Tikkanen, M.J., Solakivi, T., Sarkioja, T & Nikkari, T (1988) Characterisation of two lipoproteins containing apolipoproteins B and E from lesionfree human aortic intima J Lipid Res 29, 563–572 18 Rapp, J.H., Lespine, A., Hamilton, R.L., Colyvas, N., Chaumeton, A.H., Tweedie-Harman, J., Kotite, L., Kunitake, S.T., Havel, R.J & Kane, J.P (1994) Triglyceride-rich lipoproteins isolated by selective affinity anti-apolipoprotein B immunosorption from human atherosclerotic plaque Arterioscler Thromb 14, 1767–1774 19 Benlian, P., De Gennes, P.L., Foubert, L., Zhang, H., Gagne, S.E & Hayden, M (1996) Premature atherosclerosis in patients with familial chylomicronemia caused by mutations in the lipoprotein lipase gene N Engl J Med 335, 848–854 20 Groot, P.H.E., van Stiphout, W.A.H., Krauss, X.H., Jansen, H., van Tol, A., van Ramshorst, E., Chin-On, S., Hofmann, A., Cresswell, S.R & Havekes, L (1991) Postprandial lipoprotein metabolism in normolipidemic men with and without coronary heart disease Arterioscler Thromb 11, 653–662 21 YUK, C & Mamo, J.C (2000) Chylomicron remnant-induced foam cell formation and cytotoxicity: a possible mechanism of cell death in atherosclerosis Clin Sci (London) 98, 183–192 22 Napolitano, M., Rivabene, R., Avella, M., Botham, K.M & Bravo, E (2001) The internal redox balance of cells influences the metabolism of lipids of dietary origin by J774 macrophages: implications for foam cell formation J Vasc Res 38, 350–360 23 Batt, K.V., Botham, K.M., Jackson, B & Suckling, K.E (2001) Comparison of the effects of low density lipoprotein and chylomicron remnants on foam cell formation in the human monocytic cell line THP-1 Atherosclerosis Suppl 2, 109 24 Napolitano, M., Avella, M., Botham K.M & Bravo, E (2003) Chylomicron remnant induction of lipid accumulation in J774 macrophages is associated with up-regulation of triacylglycerol synthesis which is not dependent on oxidation of the particles Biochim Biophys Acta 1631, 255–264 25 Shige, H., Ishikawa, T., Suzukawa, M., Nishiwaki, M., Yamashita, T., Nakajima, K., Ito, T., Higashi, K., Ayaori, M., Yonemura, A., Nestel, P & Nakamura, H (1998) Vitamin E reduces cholesterol esterification and uptake of acetylated low density lipoprotein in macrophages Lipids 33, 1169–1175 26 Devaraj, S., Hugou, I & Jialal, I (2001) Alpha tocopherol decreases CD36 expression in human monocyte-derived macrophages J Lipid Res 42, 521–527 27 Suzukawa, M., Abbey, M., Clifton, P & Nestel, P.J (1994) Effects of supplementing with vitamin E on the uptake of low density lipoprotein and the stimulation of cholesteryl ester formation in macrophages Atherosclerosis 110, 77–86 28 Asmis, R & Jelk, J (2000) Vitamin E supplementation of human macrophages prevents neither foam cell formation nor increased susceptibility of foam cells to lysis by oxidized LDL Arterioscler Thromb Vasc Biol 20, 2078–2086 Ó FEBS 2004 29 Asmis, R., Llorente, V.C & Gey, K.F (1995) Prevention of cholesteryl ester accumulation in P388D1 macrophage-like cells by increased cellular vitamin E depends on species of extracellular cholesterol Conventional heterologous non-human cell cultures are poor models of human atherosclerotic foam cell formation Eur J Biochem 233, 171–178 30 Trach C.C., Wulfroth P.M., Severs, N.J & Robenek, H (1996) Influence of native and modified lipoproteins on migration of mouse peritoneal macrophages and the effect of the antioxidants vitamin E and probucol Eur J Cell Biol 71, 199–205 31 Yamamoto, A., Hara, H., Takaichi, S., Wakasugi, S & Tomikawa, M (1988) Effect of probucol on macrophages, leading to regression of xanthomas and atheromatous vascular lesions Am J Cardiol 62, 31B–36B 32 Nagano, Y., Kita, T., Yokode, M., Ishii, K., Kume, N., Otani, H., Arai, H & Kawai, C (1989) Probucol does not affect lipoprotein metabolism in macrophages of Watanabe heritable hyperlipidemic rabbits Arteriosclerosis 9, 453–461 33 Ku, G., Schroeder, K., Schmidt, L.F., Jackson, R.L & Doherty, N.S (1990) Probucol does not alter acetylated low density lipoprotein uptake by murine peritoneal macrophages Atherosclerosis 80, 191–197 34 Takemura, T., Sakai, M., Matsuda, H., Matsumura, T., Biwa, T., Anami, Y., Nishikawa, T., Sasahara, T & Shichiri, M (2000) Effects of probucol on cholesterol metabolism in mouse peritoneal macrophages: inhibition of HDL mediated cholesterol efflux Atherosclerosis 152, 347–357 35 Moore, E.H., Napolitano, M., Prosperi, A., Avella, M., Suckling, K.E., Bravo, E & Botham, K.M (2003) Incorporation of lycopene into chylomicron remnant-like particles enhances their induction of lipid accumulation in macrophages Biochem Biophys Res Commun 312, 1216–1219 36 Niguchi, N & Niki, E (2000) Phenolic antioxidants: a rationale for design and evaluation of novel antioxidant drugs for atherosclerosis Free Rad Biol Med 28, 1538–1546 37 Napolitano, M., Batt, K.V., Avella, M., Bravo, E & Botham, K.M (2001) Lipid synthesis in macrophages derived from the human cell line THP-1: modulation of the effects of native and oxidised chylomicron remnant-like particles by estrogen Clin Sci (London) 101, 403–413 38 Davis, R.A., Engelhorn, S.C., Pangburn, S.H., Weinstein, D.B & Steinberg, D (1979) Very low density lipoprotein synthesis and secretion by cultured rat hepatocytes J Biol Chem 254, 2010– 2016 39 Steinbrecher, U.P., Parthasarathy, S., Leake, D.S., Witzum, J.L & Steinberg, D (1984) Modification of low density lipoprotein by endothelial cells involves lipid peroxidation and degradation of low density lipoprotein phospholipids Proc Natl Acad Sci USA 81, 3883–3722 40 Diard, P., Malewiak, M.-I., Lagrange, D & Griglio, S (1994) Hepatic lipase may act as a ligand in the uptake of artificial chylomicron remnant-like particles by isolated rat hepatocytes Biochem J 299, 889–894 41 Redgrave, T.G., Fidge, N.H & Yin, J (1982) Specific, saturable binding and uptake of rat chylomicron remnants by rat skin fibroblasts J Lipid Res 23, 638–644 42 Redgrave, T.G., Ly, H.L., Quintao, C.R., Ramberg, C.F & Boston, R (1993) Clearance from plasma of triacylglycerol and cholesteryl ester after intravenous injection of chylomicron-like lipid emulsions in rats and man Biochem J 290, 843–847 43 Maranhao, R.C., Fers, M.C., Martins, M.T., Mesquita, C.H., Toffoletto, O., Vinagre, C.G.C., Gianinni, S.D & Pileggi, F (1996) Plasma kinetics of a chylomicron-like emulsion in patients with coronary artery disease Atherosclerosis 126, 15–25 44 Oliveira, H.C., Hirata, M.H., Redgrave, T.G & Maranhao, R.C (1988) Competition between chylomicrons and their remnants for Ó FEBS 2004 45 46 47 48 49 50 51 52 53 Foam cell induction by chylomicron remnants (Eur J Biochem 271) 2427 plasma removal: a study with artificial emulsion models of chylomicrons Biochim Biophys Acta 958, 211–217 Martins, I.J., Vermeulen, R & Redgrave, T.G (2002) Relative roles of mitochondrial and peroxisomal fatty acid oxidation in the metabolism of chylomicron remnants in rats and mice as assessed by a stable-isotope breath test Atherosclerosis 150, 13–20 Sultan, F., Lagrange, D., Le Liepvre, X & Griglio, S (1989) Chylomicron remnant uptake by freshly isolated hepatocytes Effects of heparin and of hepatic triacylglycerol lipase Biochem J 258, 587–594 Goulter, A.B., Avella, M.A., Elliott, J & Botham, K.M (2002) Chylomicron remnant-like particles inhibit receptor-mediated endothelium-dependent vasorelaxation in porcine coronary arteries Clin Sci (London) 103, 450–460 Thuren, T., Sisson, P & Waite, M (1991) Hydrolysis of lipid mixtures by rat hepatic lipase Biochim Biophys Acta 1083, 217–220 Stocker, R (1999) Dietary and pharmacological antioxidants in atherosclerosis Curr Opin Lipidol 10, 589–597 Pfuetze, K.D & Dujovne, C.A (2000) Probucol Curr Atheroscler Report 2, 47–57 Liu, G.X., Ou, D.M., Liu, J.H., Huang, H.L & Liao, D.F (2000) Probucol inhibits lipid peroxidation of macrophage and affects its secretory properties Acta Pharmacol Sin 21, 637–640 Yamamoto, A., Takaichi, S., Hara, H., Nishikawa, O., Yokoyama, S., Yamamura, T & Yamaguchi, T (1986) Probucol prevents lipid storage in macrophages Atherosclerosis 62, 209– 217 Selmer, D., Senekowitsch-Schmidtke, R., Schneider, W & Elstner, E.F (1997) Binding and uptake of 125iodine-labelled, oxidized low density lipoprotein by macrophages: comparison of the effects of alpha tocopherol, probucol, pyridoxal-5¢phosphate and magnes- 54 55 56 57 58 59 60 ium-pyridoxal-5¢-phosphate glutamate Z Naturforsch [C] 52, 97–104 Yu, K.C & Cooper, A.D (2001) Postprandial lipoproteins and atherosclerosis Front Biosci 6, D332–D354 Cases, S., Smith, S.J., Zheng, Y.W., Myers, H.M., Lear, S.R., Sande, E., Novak, S., Collins, C., Welch, C.B., Lusis, A.J., Erickson, S.K & Farese, R.V (1998) Identification of a gene encoding an acyl CoA: diacylglycerol acyltransferase, a key enzyme in triacylglycerol synthesis Proc Natl Acad Sci USA 95, 13018–13023 Oram, J.F (2002) ATP-binding cassette transporter A1 and cholesterol trafficking Curr Opin Lipidol 13, 373–381 Chinetti, G., Gbaguidi, F.G., Griglio, S., Mallat, Z., Antonucci, M., Poulain, P., Chapman, J., Fruchart, J.-C., Tedgui, A., NajibFruchart, J & Staels, B (2000) CLA-1/SR-B1 is expressed in atherogenic lesion macrophages and regulated by activators of peroxisome proliferator-activated receptors Circulation 101, 2411–2417 Ishibashi, S., Perrey, S., Chen, Z., Shimada, M., Ohashi, K., Harada, K., Yazaki, Y & Yamada, N (1996) Role of the low density lipoprotein (LDL) receptor pathway in the metabolism of chylomicron remnants A quantitative study in knock-out mice lacking the LDL receptor, apolipoprotein E, or both J Biol Chem 271, 22422–22427 Mortimer, B.C., Martins, I., Zeng, B.J & Redgrave, T (1997) Use of gene manipulated models to study the physiology of lipid transport Clin Exp Pharmacol Physiol 24, 281–285 Zsigmond, E., Fuke, Y., Li, L., Kobayashi, K & Chan, L (1998) Resistance of chylomicron and VLDL remnants to post heparin lipolysis in apoE deficient mice: the role of apoE in lipoprotein lipase mediated lipolysis in vivo and in vitro J Lipid Res 39, 1852–1861  ... from oxidation enhances, rather than inhibits, their induction of lipid accumulation in macrophages The enhancement of lipid accumulation in macrophages by CRLPs containing probucol and lycopene... Effect of pCRLPs on lipid synthesis in THP-1 macrophages The effects of CRLPs and pCRLPs on lipid synthesis in THP-1 macrophages were investigated by measuring the incorporation of [3H]oleate into. .. induction of lipid accumulation in the cells by the particles is enhanced when they are protected from oxidation, we investigated the mechanism of this effect by comparing the in? ??uence of CRLPs and