Protein engineering of pyruvate carboxylase Investigation on the function of acetyl-CoA and the quaternary structure Shinji Sueda, Md. Nurul Islam and Hiroki Kondo Department of Biochemical Engineering and Science, Kyushu Institute of Technology, Japan Pyruvate carboxylase (PC) from Bacillus thermodenitrificans was engineered in such a way that the polypeptide chain was divided into two, between the biotin carboxylase (BC) and carboxyl transferase (CT) domains. The two proteins thus formed, PC-(BC) and PC-(CT+BCCP), retained their catalytic activity as assayed by biotin-dependent ATPase and oxamate-dependent oxalacetate decarboxylation, for the former and the latter, respectively. Neither activity was dependent on acetyl-CoA, in sharp contrast to the complete reaction of intact PC. When assessed by gel filtration chromatography, PC-(BC) was found to exist either in dimers or monomers, depending on the protein concentra- tion, while PC-(CT + BCCP) occurred in dimers for the most part. The two proteins do not associate spontaneously or in the presence of acetyl-CoA. Based on these observa- tions, this paper discusses how the tetrameric structure of PC is built up and how acetyl-CoA modulates the protein structure. Keywords: acetyl-CoA; biotin; biotin-dependent carboxy- lase; protein engineering; pyruvate carboxylase. Pyruvate carboxylase (PC) is a biotin-dependent enzyme and is involved in gluconeogenesis by converting pyruvate to oxalacetate [1–3]. There are two forms of PC, single polypeptide chain type and subunit type, but a large majority belongs to the former class [1,4–7]. This form of PC is made of about 1200 amino acids and is distributed widely in both eukaryotes and some prokaryotes. The reaction of PC is believed to proceed in two steps, just likethose of other biotin-dependent carboxylases such as acetyl-CoA carboxylase: ATP þ HCO À 3 þ enz-biotin Ð enz-biotin-CO À 2 þ ADP þP i Scheme 1 enz-biotin-CO À 2 þ pyruvate Ð enz-biotin þ oxalacetate Scheme 2 In the first step (Scheme 1), the biotin moiety covalently attached to the enzyme is carboxylated by bicarbonate and ATP. In the second step (Scheme 2), the carboxyl group is transferred from carboxybiotin to pyruvate. Thus, PC carries at least three functional domains: a biotin carboxyl carrier protein (BCCP) domain, a biotin carboxylase (BC) domain which mediates the first partial reaction and a carboxyl transferase (CT) domain which catalyzes the second partial reaction. The BC domain is located in the amino terminus of the single polypeptide chainPC,followedbyCTwiththeBCCPdomaininthe carboxyl terminus [Fig. 1]. The activity of PC is activa- ted by acetyl-CoA and inhibited by aspartate [2,8–10]. Because of the lack of a three-dimensional structure, the detailed mechanism of carboxylation and regulation of PC remains obscure. Obviously, elucidation of the three- dimensional structure of PC will unveil much of this uncertainty and in fact such an undertaking is under way in this laboratory. Additionally, a protein engineering approach would be useful to examine the two partial reactions individually. In this study, PC from Bacillus thermodenitrificans (previously Bacillus stearothermophilus) was engineered in such a way as to divide the protein into two at the boundary of the BC and CT domains (Fig. 1). The properties of the resulting two proteins, PC-(BC) and PC-(CT + BCCP), were examined and compared with those of the intact PC in order to gain insight into the domain organization, the function of acetyl-CoA and the reaction mechanism of PC. Experimental procedures Materials Inorganic salts and common organic chemicals were obtained from commercial sources. Acetyl-coenzyme A was from Wako Pure Chemical (Osaka, Japan) and avidin was from ProZyme (San Leandro, CA, USA). Reagents for genetic engineering, such as restriction enzymes, were purchased from Takara (Kyoto, Japan). Oligonucleotides were custom synthesized by Hokkaido Science (Sapporo, Japan). The TOPO TA cloning kit was the product of Invitrogen. Correspondence to S. Sueda, Department of Biochemical Engineering and Science, Kyushu Institute of Technology, Kawazu 680-4, Iizuka 820-8502, Japan. Fax: + 81 948 29 7801, Tel.: + 81 948 29 7834, E-mail: sueda@bse.kyutech.ac.jp Abbreviations: BC, biotin carboxylase; BCCP, biotin carboxyl carrier protein; CT, carboxyl transferase; DTT, dithiothreitol; KP i , potassium phosphate; PC, pyruvate carboxylase. Enzymes: pyruvate carboxylase from Bacillus thermodenitrificans (P94448) (EC 6.4.1.1); biotin carboxylase subunit of acetyl-CoA carboxylase from Escherichia coli (P24182) (EC 6.4.1.2). (Received 15 January 2004, revised 16 February 2004, accepted 24 February 2004) Eur. J. Biochem. 271, 1391–1400 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04051.x Construction of an overexpression plasmid for intact PC Previously, the B. thermodenitrificans PC gene was cloned into pBluescript vector [11]. The resulting recombinant plasmid (pPC) allowed Escherichia coli to express PC,albeit at a relatively low level (data not shown). To enhance expression, the promoter region was replaced with the high expression promoter trc of pTrc99A vector. Thus, the % 800 bp downstream region from the NcoI site containing the trc promoter was amplified with pTrc99A as template and using the following primers: Trc 1, 5¢-TTAGC GG GCCCATTAAGTTCTGTC-3¢ and Trc 2, 5¢-TTGCGA ATTCGTCTTGTCTCCATGGTCTGTTTCCTGTGTG AAAT-3¢ (restriction enzyme sites are underlined). The EcoRI site, present at about 10 bp downstream from the initiating ATG codon of the PC gene, and the ApaIsite, present on pBluescript and pTrc99A, were exploited for gene manipulation. A 19 bp segment of the PC gene (shown above in italics) containing an EcoRI site was incorporated into the reverse primer, Trc 2. The PCR reaction was conducted under the following conditions: The reaction mixture contained 5 units of Ex Taq TM (Takara), 1· Ex Taq buffer, 200 l M each of the four dNTPs, 1 l M each of the primers and 10 ng of pTrc99A in a final volume of 100 lL. After denaturation at 94 °C for 5 min, the samples were subjected to 30 cycles of denaturation (94 °C, 1 min), annealing (58 °C, 1 min) and extension (72 °C, 1 min), and subsequently subjected to additional extension (72 °C, 10 min). The PCR products were TA cloned and sequenced. The plasmid thus prepared was digested with ApaIand EcoRI, and the resulting fragment was ligated into the ApaI/ EcoRI sites of pPC. The second amino acid of native PC is converted to glutamic acid from lysine because of the introduction of the NcoI site into the start codon region of this recombinant. This plasmid allowed E. coli to express PC at a much higher level and the enzyme produced was as active as native PC. Hence, this PC is called intact PC despite the mutation of the second amino acid residue. Construction of over-expression plasmids for PC-(BC) and PC-(CT + BCCP) The boundary of the BC and CT domains of B. thermo- denitrificans PC was estimated to reside at residue 462 on the basis of the reasoning described in the Results section. The polypeptide chain was divided into two at this point by placing a stop codon or an initiation codon for the expres- sion of BC and CT plus BCCP, respectively. Expression plasmids for PC-(BC) and PC-(CT + BCCP) were constructed as follows: For the former, % 440 bp fragment was amplified with pPC as the template using the following primers: BC1, 5¢-ATT GATATCGTCCAGTCG CAAATTTTAATTGCT-3¢ and BC2, 5¢-ATA GGATCC TTAGAACACGAATAGTTCCGGCGTCGTATCGAT-3¢ (restriction enzyme sites are underlined). The forward primer,BC1,harboredtheEcoRV site present on the PC gene, and the reverse primer, BC2, harbored a stop codon (denoted in bold). A BamHI site was introduced for subsequent manipulation. PCR conditions were the same as those for the amplification of the trc promoter, and the PCR product was TA cloned and sequenced. The resulting plasmid was digested with EcoRV and BamHI, and the fragment formed was ligated into the EcoRV/BamHI sites of pPC. The promoter of this plasmid was replaced with the high expression promoter trc inexactlythesamewayasthat of the intact PC. This plasmid, pPC-(BC), allowed E. coli to express the BC domain of PC at a high level. The PC-(CT + BCCP) expression plasmid was con- structed as follows: an % 400 bp fragment was amplified with pPC as template using the following primers: CT1, 5¢-ATAT CCATGGCACGCCGGAAAGACGGAACGA AAATG-3¢ and CT2, 5¢-CCGATCCCAC GGATCCTCT TTTAAAAAGCG-3¢ (restriction enzyme sites are under- lined). The forward primer, CT1, harbored an NcoIsite introduced for placing the start codon and cloning, and the reverse primer, CT2, harbored a BamHI site present on the PC gene. As a result of the engineering, the second amino acid residue is converted from proline to alanine. PCR conditions were the same as those described above, and the PCR product was TA cloned and sequenced. Likewise, a fragment representing the downstream region from the BamHI site to the end of the open reading frame was prepared (S. Sueda, unpublished observation). These two fragments were cloned into pTrc99A through multiple steps to yield a recombinant plasmid, pPC-(CT + BCCP), which allowed E. coli to express the desired CT plus BCCP domain of PC to a high level. Purification of proteins E. coli JM109 transformed with either one of the over- expression plasmids prepared above was grown in Luria- Bertani medium containing 50 lgÆmL )1 ampicillin and 1 lgÆmL )1 D -biotin, where a biotin-binding domain was present. Cells were harvested by centrifugation, suspended in 0.12 M potassium phosphate (KP i ) buffer, pH 7.0, containing 1 m M EDTA, 1 m M dithiothreitol (DTT) and 1m M phenylmethanesulfonyl fluoride, disrupted by soni- cation and then centrifuged. The precipitate that formed was removed by centrifugation, and ammonium sulfate was added to the supernatant to 40–50% saturation for intact PC and PC-(CT + BCCP), and 30–40% saturation for PC-(BC). Again, the precipitate formed was collected by centrifugation, dissolved in buffer A (20 m M KP i buffer, pH 7.0, containing 0.1 m M EDTA and 0.1 m M DTT), and dialyzed against the same buffer. The samples were subjec- ted to anion exchange chromatography on diethylamino- ethyl (DEAE)-cellulose (Whatman). Proteins were eluted by a salt gradient from buffer A to buffer B (buffer A + 0.5 M NaCl). The desired fractions, inspected by SDS/PAGE, were collected and dialyzed against buffer A. The samples were applied to gel filtration chromatography on Super- Fig. 1. Schematic representation of the domain structures of intact PC and engineered proteins, PC-(BC) and PC-(CT + BCCP). 1392 S. Sueda et al.(Eur. J. Biochem. 271) Ó FEBS 2004 dex TM 200 (Amersham), eluted with 50 m M KP i buffer, pH 7.0, containing 0.1 M NaCl, 0.1 m M EDTA and 0.1 m M DTT, and the desired fractions collected. Intact PC and PC- (CT+BCCP) were further purified by monomeric avidin- Sepharose affinity chromatography [12–14] as reported previously [15]. The samples were applied at a flow rate of 0.5 mLÆmin )1 onto the monomeric avidin column equili- brated with running buffer (50 m M KP i buffer, pH 7.0, 0.2 M KCl, 1 m M EDTA, 5 m M 2-mercaptoethanol). The column was washed with several column volumes of running buffer to remove unbound material. Proteins were eluted with 1 mgÆmL )1 biotin in running buffer at a flow rate of 0.2 mLÆmin )1 . The eluted intact PC and PC-(CT+BCCP) were dialyzed against 5 m M KP i buffer, pH 7.0, containing 0.1 m M EDTA and 0.1 m M DTT,andstoredat4°C. In the meantime, PC-(BC) was further purified by anion exchange chromatography on Mono Q TM HR 5/5 (Amersham). Protein was eluted by a salt gradient from buffer C (20 m M Tris/HCl, pH 7.5) to buffer D (buffer C+0.35 M NaCl). The desired fractions were collected and dialyzed against 5m M KP i buffer, pH 7.0, with 0.1 m M EDTA and 0.1 m M DTT, and stored at 4 °C. The specific activity of PC, determined below, was 9.5 UÆmg )1 , where 1 U is defined as the amount of enzyme to produce 1 lmol of oxalacetate per min, and the protein concentration was determined from the amino acid composition. Pyruvate carboxylase assays Pyruvate carboxylase activity was measured by monitoring the oxalacetate formation using the coupled reaction with malate dehydrogenase according to the methods described previously [16–18]. Oxidation of NADH in the malate dehydrogenase reaction was followed spectrophotometri- cally at 340 nm. All assays were carried out at 30 °C, and the reaction mixture contained the following components, unless otherwise stated: 100 m M Tris/HCl (pH 8.0), 2 m M ATP, 5 m M MgCl 2 , 100 m M KCl, 5 m M pyruvate, 50 m M NaHCO 3 ,0.1 m M acetyl-CoA, 0.15 m M NADH and 5 units of malate dehydrogenase. The K m (Michaelis constant) values for ATP, bicarbonate and pyruvate were determined as follows: the K m for ATP was obtained by varying its concentration from 0–5 m M at fixed concentrations of bicarbonate (100 m M ) and pyruvate (5 m M ), where the enzyme was 77% and 92% saturated with them, respectively. In addition, free Mg 2+ concentration was kept constant, with MgCl 2 ,at3m M in excess of ATP; free Mg 2+ concentration was approximated to be its ana- lytical concentration minus that of ATP, as the true concen- tration of free Mg 2+ calculated based on the dissociation constant for MgATP of 0.0143 m M [19] was only 1% different from the approximate value. At high ATP concen- trations, substrate inhibition was evident, and thus two kinds of analysis were applied for the data on ATP. First, the simple Michaelis–Menten equation was fitted to the kinetic data in the low concentration range (0–1 m M )usingthe nonlinear regression analysis program, ENZFITTER (Biosoft, Cambridge, UK). Then, the entire data (from 0–5 m M )were analyzed by Eqn (1), which takes into account substrate inhibition, where v, V max ,[S]andK I represent observed reaction rate, maximum rate, substrate concentration and the substrate inhibition constant, respectively: v ¼ V max  ½S ½SþK m þ½S 2 ½K I   Eqn (1) The K m value for bicarbonate was determined by varying its concentration from 0.5–100 m M at fixed concentrations of ATP (2 m M ) and pyruvate (5 m M ). As the endogenous level of bicarbonate is known to be 0.5 m M at pH 8.0 [20], the concentration of bicarbonate was corrected for this value. Likewise, the K m value for pyruvate was determined by varying its concentration from 0–5 m M at fixed concentrations of ATP (2 m M ) and bicarbonate (100 m M ). The simple Michaelis–Menten equation was used for the analysis of the data for bicarbonate and pyruvate. ATP cleavage assays ATP cleavage activity of intact PC and PC-(BC) was assayed according to the previously reported procedure [21]. The progress of the reaction was followed by monitoring the formation of ADP in the presence of phosphoenolpyru- vate and pyruvate kinase. The pyruvate formed was then reduced to lactate by lactate dehydrogenase with the concomitant oxidation of NADH, and this was measured from a decrease in absorbance at 340 nm. All assays were conducted at 30 °C, and the reaction mixture contained the following components, unless otherwise stated: 100 m M Tris/HCl (pH 8.0), 2 m M ATP, 5 m M MgCl 2 , 100 m M KCl, 50 m M NaHCO 3 ,0.1m M acetyl-CoA, 0.5 m M phos- phoenol pyruvate, 0.15 m M NADH, 5 units of lactate dehydrogenase and 5 units of pyruvate kinase. In the case of the PC-(BC) assay, 50 m M free D -biotin was added to the above reaction mixture. The kinetic parameters, K m and V max ,fortheATPase reaction of PC-(BC) were determined as follows: the kinetic parameters for ATP were obtained by varying its concentration from 0–5 m M at fixed concentrations of biotin (100 m M ) and bicarbonate (100 m M ), where the enzyme is 68% and 62% saturated with them, respect- ively. Obviously, this situation is not ideal for the accurate estimation of kinetic parameters, but concentrations higher than this will deviate too much from those of physiological conditions. Accordingly, experiments were carried out under these subsaturating conditions with respect to biotin and bicarbonate. In the kinetics for ATP, substrate inhibition was manifest at high concentrations just like for intact PC, and thus two kinds of data analysis were also made in this case. The kinetic parameters for bicarbonate were determined by varying its concentration from 0.5–100 m M at fixed concentrations of ATP (2 m M ) and biotin (100 m M ); again, the concen- tration of bicarbonate was corrected for the endogenous bicarbonate at pH 8.0, 0.5 m M . The simple Michaelis– Menten equation was used for the analysis of the data obtained. The kinetic data for biotin were obtained by varying its concentration from 0–100 m M at fixed con- centrations of ATP (2 m M ) and bicarbonate (100 m M ). In the ATPase reaction of PC-(BC), a weak activity (2% of maximum) was observed in the absence of biotin, and thus the data were analyzed by Eqn (2), which takes into account this basal activity (v 0 ): Ó FEBS 2004 Protein engineering of pyruvate carboxylase (Eur. J. Biochem. 271) 1393 v ¼ V max  ½S K m þ½Sþv 0  Eqn ð2Þ Oxalacetate decarboxylase assays Oxalacetate decarboxylase activity of intact PC and PC- (CT + BCCP) was measured with oxamate as the stimu- lant, according to the procedures previously reported [22]. The reactions were monitored by measuring the formation of pyruvate which was then reduced to lactate by lactate dehydrogenase, and the concomitant oxidation of NADH was monitored at 340 nm. All assays were performed at 30 °C, and the reaction mixture contained the following components, unless otherwise stated: 100 m M Tris/HCl (pH 8.0), 5 m M MgCl 2 ,100m M KCl, 0.1 m M oxalacetate, 0.1 m M acetyl-CoA, 1 m M oxamate, 0.15 m M NADH, and 5 units of lactate dehydrogenase. The reactions were started by the addition of intact PC or PC-(CT + BCCP), but prior to the addition, a background rate of oxalacetate decarboxylation was established, and this (2.4% of the maximum) was subtracted from the rate in the presence of enzyme. Avidin-blot analysis and determination of the N-terminal amino acid sequence For avidin-blot analysis, electrophoresed samples were electroblotted onto a nylon membrane (Pall Biosupport, Portsmouth, UK) according to the conventional procedure [23]. The membrane with blotted proteins was blocked with skimmed milk in NaCl/Tris-Tween [20 m M Tris/HCl, pH 7.6, 136 m M NaCl, 0.1% (v/v) Tween] for one hour. The blocked membrane was washed three times with NaCl/ P i -Tween, and then immersed in NaCl/Tris buffer contain- ing 0.4 UÆmL )1 alkaline phosphatase-conjugated streptavi- din (Boehringer Mannheim) for 20 min. The membrane was then washed with NaCl/Tris-Tween three times, before being developed by 0.78 m M 4-nitroblue tetrazolium chlor- ide and 0.40 m M 5-bromo-4-chloro-3-indolylphosphate in 20 m M Tris/HCl, pH 9.5, containing 100 m M NaCl and 50 m M MgCl 2 . For determining the amino-terminal sequence of the proteins, electrophoresed samples were electroblotted onto a poly(vinylidene difluoride) membrane (Atto, Tokyo, Japan) according to the conventional procedure. Pieces of the membrane containing the desired bands, as visualized by ponceau S, were used for sequencing by Edman degradation on a protein sequencer Model 491 (Applied Biosystems). Molecular size determination by HPLC gel-filtration chromatography High performance gel filtration chromatography was carried out on a TSKgel G3000SWXL column (7.8 mm · 30 cm) with TSK guard column SWXL (6.0 mm · 4.0 cm) (Tosoh, Tokyo, Japan) using an HPLC system (Hitachi, Tokyo, Japan). The samples were eluted at a flow rate of 0.5 mLÆmin )1 using a mobile phase of 100 m M KP i buffer (pH 7.0) containing 100 m M Na 2 SO 4 ,andthe eluted samples were monitored at 280 nm. The gel filtration column was calibrated using a set of proteins (Amersham): ribonuclease A (13.7 kDa), chymotrypsinogen A (23 kDa), ovalbumin (43 kDa), albumin (67 kDa), aldolase (158 kDa) and thyroglobulin (669 kDa). The apparent molecular masses of the samples were estimated from the calibration curve obtained. The samples were analyzed at concentrations ranging from 1–100 l M ,and20 lLeachwas applied to the column. Molecular mass determination by mass spectrometry The molecular masses of PC-(BC) and PC-(CT + BCCP) were determined by MALDI TOF mass spectrometry with a Voyager DE-STR mass spectrometer (PerSeptive Bio- systems, Framingham, MA, USA) 7 . 4-Hydroxyazobenzene- 2¢-carboxylic acid (10 mgÆmL )1 in 0.1% (v/v) trifluoroacetic acid in 70 : 30 water/acetonitrile) was used as the MALDI matrix. Samples were prepared by mixing the protein solution with the matrix solution. One microliter of this mixture was deposited on the sample plate, dried at ambient temperature and analyzed. Results Construction and purification of the engineered proteins of PC The boundary of the BC and CT domains of PC was estimated as follows: the BC subunit of E. coli acetyl-CoA carboxylase is catalytically active and the three-dimensional structure is known [24,25]. Its C-terminus appeared to correspond to residue 460 of B. thermodenitrificans PC by sequence alignment [26]. Likewise, the amino acid sequences of PCs from various sources, including those of subunit- type PCs, were aligned to reveal that the N-terminus of CT seemed to reside at residue 470 of B. thermodenitrificans PC. Although there still remains some ambiguity concerning the exact location of the boundary because the C- and N-terminal regions of BC and CT domains, respectively, are barely conserved, it seemed safe to divide the two domains at residue 462 without impairing the two activities (Fig. 1). Based on this assumption, over-expression plasmids for PC-(BC) and PC-(CT + BCCP) which produce BC and the rest of the molecule, respectively, were constructed as detailed in Experimental procedures. The engineered proteins of PC as well as intact PC were purified by methods described under Experimental pro- cedures. Monomeric avidin-Sepharose affinity chromato- graphy was used for the purification of intact PC and PC-(CT + BCCP) carrying the biotin prosthetic group within their structures. Each purified protein was nearly homogeneous as judged by visual inspection of SDS/PAGE (Fig. 2A). The yields were typically 10, 15 and 20 mg, for intact PC, PC-(BC) and PC-(CT + BCCP), respectively, from a 2 L culture. Western blot analysis with alkaline phosphatase-conjugated streptavidin for intact PC and PC-(CT + BCCP) revealed that bands were observed at the positions corresponding to those of SDS/PAGE (Fig. 2B). The amino-terminal sequence of each protein was analyzed by Edman degradation. The amino acid sequences of intact PC and PC-(BC) were determined to be 1394 S. Sueda et al.(Eur. J. Biochem. 271) Ó FEBS 2004 METRRIRKVL, which was consistent with that deduced from the DNA sequences. The correct mutation of the second amino acid residue, arising from the introduction of an NcoI site in the start codon region, to glutamate from the original lysine, was confirmed. Likewise, the amino acid sequence of PC-(CT + BCCP) was determined to be ARRKDRGTKM, and this sequence was consistent with that deduced from its DNA sequence except for the absence of the first amino acid methionine. It was also confirmed that the second residue was properly converted to alanine from original proline, because of the design of the expression plasmid. In SDS/PAGE, the bands of intact PC and PC-(BC) were observed at the positions corresponding to the molecular masses deduced from their sequences, 128.5 and 51.4 kDa, respectively, while that of PC-(CT + BCCP) was observed at a position (65 kDa) considerably smaller than that expected (77.1 kDa). To confirm the integrity of PC- (CT + BCCP), this protein was analyzed by MALDI TOF mass spectrometry together with PC-(BC). The mass (m/z value) obtained was 77 047 ± 76 for PC-(CT + BCCP) and 51 428 ± 53 for PC-(BC) (mean ± SD from three determinations). These values are identical, within experimental error, to the molecular masses deduced from their sequences, 77 082 and 51 438 Da, respectively, prov- ing that the two engineered proteins have the correct structure. Molecular properties of the engineered proteins of PC Association states of the proteins were investigated by high performance gel filtration chromatography. Apparent molecular masses of the samples were estimated on the basis of the calibration curve obtained by using a set of standard proteins (Fig. 3). Typical elution profiles of intact PC, PC-(BC) and PC-(CT + BCCP) are shown in Fig. 4. For intact PC, two peaks were observed at 13.76 min and 17.02 min (Fig. 4A) and the apparent molecular masses estimated from their retention times were 501.3 ± 11.5 kDa and 137.0 ± 4.8 kDa (mean ± SE from three separate experiments), which were considered to be the tetramer and monomer, respectively. The intensity of the tetramer peak was about 10 times greater than that of the monomer and this ratio did not change with protein concentration over the range adopted (1–100 l M ), verifying that intact PC exists mainly as a tetramer, which is typical for single polypeptide type PCs [4,27]. Also for PC- (CT + BCCP), two peaks, major and minor, were observed at 17.17 min and 18.82 min (Fig. 4B) and the apparent molecular masses estimated from them were 128.2 ± 1.8 kDa and 66.2 ± 1.1 kDa, which appeared to represent a dimer and monomer, respectively. Again, the ratio of the intensity of the two peaks (10 : 1), did not change with the protein concentration. By contrast, the behavior of PC-(BC) on gel filtration chromatography was different from those of the above two proteins. Although two peaks were also observed for PC-(BC), the ratio of the intensity of the peaks changed markedly with the protein concentration. At a high concentration (100 l M ), a major peak was observed at 18.28 min (Fig. 4C) and the molecular mass estimated from this peak was 81.9 ± 2.9 kDa, which appeared to represent a dimer. On the other hand, at a low concentration (5 l M ), a major peak was observed at 19.41 min (Fig. 4D) and the molecular mass estimated from it was 66.2 ± 1.1 kDa, which appeared to represent the monomer. Moreover, the mixtures of PC-(BC) and PC-(CT + BCCP) at various ratios were analyzed to study their interaction, but no new peak was observed other than those derived from the constituent proteins, suggesting that Fig. 3. Estimation of the molecular masses of intact and engineered PC by gel filtration chromatography on the TSK G3000SWXL column. The molecular masses of the proteins used for construction of the calib- ration curve (s) were ribonuclease A (13.7 kDa), chymotrypsino- gen A (23 kDa), ovalbumin (43 kDa), albumin (67 kDa), aldolase (158 kDa) and thyroglobulin (669 kDa). Elution times of intact PC and engineered proteins are represented by d, as labelled. Fig. 2. SDS/PAGE (A) and avidin-blot analysis (B) of purified intact PC and engineered proteins. (A) SDS/PAGE was run with 12.5% polyacrylamide and 0.5 lg of proteins: M, marker; lane 1, intact PC; lane 2, PC-(BC); lane 3, PC-(CT + BCCP). (B) SDS/PAGE was run with 0.1 lg of proteins and electroblotted onto the membrane. The proteins carrying biotin were detected by the reaction with alkaline phosphatase-conjugated avidin: lane 1, intact PC; lane 2, PC- (CT + BCCP). Ó FEBS 2004 Protein engineering of pyruvate carboxylase (Eur. J. Biochem. 271) 1395 PC-(BC) and PC-(CT + BCCP) do not interact signifi- cantly under the experimental conditions employed. Acetyl- CoA had almost no effect on the association of the two proteins, as the elution profile was hardly affected by preincubation of the samples with 0.1 m M acetyl-CoA followed by elution with buffer containing the same concentration of acetyl-CoA. Enzymic activity of intact PC Pyruvate carboxylase activity of intact PC was assayed by measuring the oxalacetate production in the presence of malate dehydrogenase and NADH as described under Experimental procedures. The K m values determined for bicarbonate and pyruvate were 29.9 ± 1.4 m M and 0.31 ± 0.03 m M , respectively (estimate ± standard error from the nonlinear regression analysis), which were virtually identical to those of the literature, 28.6 m M for bicarbonate and 0.33 m M for pyruvate [28]. In the kinetic analysis of ATP, substrate inhibition was evident at high ATP concentration, and thus two kinds of data analysis were conducted as described in Experimental procedures. The K m obtained from the data where substrate inhibition is insignificant was 0.46 ± 0.06 m M , while the value obtained from the whole data based on Eqn (1) that takes into account substrate inhibition was 0.87 ± 0.11 m M .TheK m for ATP of PC from the same source, obtained by simple Michaelis–Menten analysis on the data where substrate inhibition is not evident, was reported as 0.38 m M [28], close to the corresponding value of the present work. Also, the effect of acetyl-CoA on the pyruvate carboxylase reaction was nearly the same among the present work and literature; the activity was greatly increased upon addition of acetyl- CoA and the activity in the absence of acetyl-CoA was approximately 0.3% of the maximum (Table 1). PC is known to catalyze the cleavage of ATP in the absence of pyruvate [21]. It is hence possible to study the reaction of BC (Scheme 1) independently of the CT reaction (Scheme 2) by measuring this activity. This activity of PC was determined under essentially the same conditions as the complete reaction except for the omission of pyruvate (Table 1). The rate of the ATP cleavage reaction is about 0.2% of that of the complete reaction of PC, which almost coincides with that reported for chicken liver enzyme [21]. Fig. 4. Typical elution profiles for intact PC (A), PC-(CT + BCCP) (B) and PC-(BC) (C and D) on the TSK G3000SWXL gel filtration column. Proteins were chromatographed over a concentration range of 1–100 l M under the conditions described in Experimental procedures. M, D and T denote monomer, dimer and tetramer, respectively. (A) Two peaks were observed for intact PC at 13.76 and 17.02 min, which correspond to the tetramer and monomer, respectively, and the elution profile did not change over the concentration range examined. (B) Two peaks were also observed for PC-(CT + BCCP) at 17.17 and 18.82 min, which correspond to the dimer and monomer, respectively, and the elution profile was not dependent on the protein concentra- tion. (C) and (D) The elution profile of PC-(BC) was markedly dependent on the protein concentration: at the high concentration [100 l M , (C)], the dimer predominated, while at the low concentration [5 l M , (D)], the monomer predominated. 1396 S. Sueda et al.(Eur. J. Biochem. 271) Ó FEBS 2004 It was found that activity increased about 10-fold by the addition of acetyl-CoA to 0.1 m M , thus this ATP cleavage reaction is also dependent on acetyl-CoA. Similar depend- ence on acetyl-CoA was also observed previously [21]. Enzymic activity of PC-(BC) It was found that the truncated enzyme, PC-(BC), is as capable of mediating ATP cleavage in the presence of free D -biotin as intact PC, suggesting that its three-dimensional structure remains intact even in the absence of other domains. The enzymic activity of PC-(BC) in the presence of various concentrations of biotin, bicarbonate and ATP are depicted in Fig. 5. As expected from the reaction mechan- ism proposed for BC [2,29,30], this enzymic reaction was completely dependent on three substrates; it is worthy of noting that biotin is necessary for this reaction to proceed (the activity in the absence of biotin is about 2% of maximum in its presence). This subject is discussed in more detail below. Kinetic parameters for the three substrates were determined from the data shown in Fig. 5. The K m for bicarbonate was 62.2 ± 5.3 m M , which was comparable to that for the complete reaction of intact PC (29.9±1.4m M ). In the kinetics for ATP, substrate inhi- bition was observed just like in intact PC, and the K m values determined based on the simple Michaelis–Menton equa- tion and Eqn (1), were 0.54 ± 0.04 m M and 1.03 ± 0.15 m M , which were close to those of intact PC (0.46 ± 0.06 m M and 0.87 ± 0.11 m M ). The K m value for biotin of 50.9 ± 5.4 m M is considerably smaller than that of the BC subunit of acetyl-CoA carboxylase from E. coli (135 m M ) [31]. To investigate the effect of acetyl-CoA on this reaction, the assay was carried out under the standard conditions but omitting acetyl-CoA, and the data obtained are shown in Table 1. Unexpectedly, the activity of PC-(BC) in the absence of acetyl-CoA was virtually unchanged from that in its presence. In other words, the ATP cleavage activity of PC-(BC) is not dependent on acetyl-CoA, in sharp contrast to that of intact PC. Enzymic activity of PC-(CT + BCCP) It was reported that oxamate stimulated the decarboxyla- tion of oxalacetate by PC [22]. It is hence possible to study the CT reaction (Scheme 2) of PC separately from the BC reaction (Scheme 1) with this assay [22]. The enzymic activity of PC-(CT + BCCP), investigated by measuring the oxalacetate decarboxylase activity in the presence of oxamate, increased with an increase in oxamate concentra- tion, as expected (Fig. 6A). The activity in the presence of a saturating concentration of oxamate was about 40 times higher than that in its absence (Table 2). The effect of oxalacetate concentration on the decarboxylation reaction at a fixed concentration of oxamate is shown in Fig. 6B. In this case, substrate inhibition at high concentration of oxalacetate is evident from the profile. Such a phenomenon Fig. 5. Kinetic analysis for the ATP cleavage activity of PC-(BC). Activity of PC-(BC) (0.22 mg in 1 mL) was assayed with free biotin as the substrate in 100 m M Tris/HCl (pH 8.0) containing 5 m M MgCl 2 ,100m M KCl, 0.1 m M acetyl-CoA, 0.5 m M phosphoenol pyruvate, 0.15 m M NADH, 5 units of lactate dehydrogenase, 5 units of pyruvate kinase and variable concentrations of ATP, bicarbonate and biotin at 30 °C. (A) Biotin was the variable substrate with 2 m M ATP and 100 m M bicarbonate; the K m for biotin was 50.9 ± 5.4 m M and the V max 2.39 ± 0.12 UÆlmol )1 . Kinetic parameters were determined by fitting Eqn (2) to the data. (B) Bicarbonate was the variable substrate with 2 m M ATP and 100 m M biotin; the K m for bicarbonate was 62.2 ± 5.3 m M and the V max 2.58 ± 0.12 UÆlmol )1 . Kinetic parameters were determined by fitting the simple Michaelis–Menten equation to the data. (C) ATP was the variable substrate with 100 m M bicarbonate and 100 m M biotin. In the kinetics for ATP, substrate inhibition was evident, and thus two different kinds of analysis were made for the obtained data. Kinetic parameters determined with the data from 0–1.0 m M on the basis of simple Michaelis–Menten were as follows: K m 0.54 ± 0.04 m M and V max 2.39 ± 0.10 UÆlmol )1 , while those determined with the data from 0–5.0 m M on the basis of Eqn (1) were as follows: K m 1.03 ± 0.15 m M and V max 3.91 ± 0.40 UÆlmol )1 . The theoretical curve shown in this figure was drawn on the basis of Eqn (1). In each case, the standard errors in V max and K m were determined from the nonlinear regression analysis. Table 1. Effect of 0.1 m M acetyl-CoA on the pyruvate carboxylation of intact PC and on the ATP cleavage reactions of intact PC and PC-(BC). One unit of enzyme activity was defined as the amount of enzyme required to catalyze the formation of 1 lmol of each product per min. Values are the means ± SD from three separate experiments. Protein Activity Enzymic activity (UÆlmol )1 ) With acetyl-CoA Without acetyl-CoA Intact PC Overall 1220 ± 50 4.52 ± 0.36 Intact PC ATP cleavage 2.84 ± 0.21 0.31 ± 0.04 PC-(BC) ATP cleavage 1.02± 0.06 0.99 ± 0.07 Ó FEBS 2004 Protein engineering of pyruvate carboxylase (Eur. J. Biochem. 271) 1397 was observed also for PC from chicken liver and was accounted for by competitive substrate inhibition [22]. The decarboxylation activity of PC-(CT + BCCP) was found to be of similar magnitude to that of PC (Table 2), and thus PC-(CT + BCCP) retains the enzymic activity present in the native structure despite lacking the BC domain. It is noted that the decarboxylation activity of PC- (CT + BCCP) and intact PC was virtually the same in the presence and absence of acetyl-CoA under the standard conditions used in this study. Therefore, the catalytic reaction of the CT domain appears to be independent of acetyl-CoA, just like the ATP-cleavage reaction of PC-(BC). Discussion In general, single polypeptide-type PCs exist in the tetra- meric and subunit-type PCs in octameric form [1,2], but little is known as to how these oligomeric structures are formed. PC consists of three domains, BC, CT and BCCP, but again little is known about how these domains are organized three-dimensionally to generate active enzymes. These are the subjects addressed in this article. It was found that the separated BC and CT + BCCP domains of the former type of PC from B. thermodenitrificans retain their own catalytic activity, demonstrating that these two domains are independent entities as a protein. Moreover, from the elution profiles of gel filtration HPLC, PC- (CT + BCCP) was found to exist mainly as a dimer, while PC-(BC) was found to exist as a monomer or a dimer depending on its concentration. In other words, both engineered proteins associate with themselves to form homodimers, and the association of PC-(CT + BCCP) seems to be stronger than that of PC-(BC). In addition, the association between PC-(BC) and PC-(CT + BCCP) was not observed under the experimental conditions examined, demonstrating that they do not possess strong affinity for each other. Given that the same applies to intact PC as well, it is deduced that the tetrameric form of PC is built up in the following way: first, a dimer of PC is formed through the association of each (CT + BCCP) domain of two proto- mers of PC, and subsequently, individual BC domains of the resulting two dimers associate to form a tetramer. In other words, the tetrameric structure of PC appears to be constructed through the interaction of the same domains, namely BC with BC and (CT + BCCP) with (CT + BCCP). This hypothesis awaits verification by X-ray crystallographic analysis, which is under way in this laboratory. As for the reaction of BC, the following mechanism involving the formation of an enzyme–carboxylphosphate complex seems to be the most plausible one [2,29,30]: ATP þ HCO À 3 þenz-biotin Ðð À2 O 3 POCO À 2 Áenz-biotinÞ þADP Scheme 3 ð À2 O 3 POCO À 2 Áenz-biotinÞÐenz-biotin-CO À 2 þ P i Scheme 4 Apparently biotin is not required in the reaction of bicarbonate with ATP (Scheme 3), but it is essential for the putative carboxylphosphate intermediate to form. Biotin appears to participate indirectly in this step by inducing a conformational change so as to dispose the active site residues in correct orientations 8 for bicarbonate to undergo nucleophilic attack on the c-phosphate of ATP. In the present work, ATP cleavage activity (Scheme 3) of PC-(BC) was investigated with free biotin Fig. 6. Oxalacetate decarboxylation reaction of PC-(CT + BCCP). Activity of PC-(CT + BCCP) (0.39 mg in 1 mL) was assayed in 100 m M Tris/HCl (pH 8.0) containing 5 m M MgCl 2 ,100m M KCl, 0.1 m M acetyl-CoA, 0.15 m M NADH, 5 units of lactate dehydro- genase and variable concentrations of oxalacetate and oxamate at 30 °C. (A) Oxamate was the varied substrate with 0.1 m M oxalacetate. (B) Oxalacetate was the varied substrate with 1.0 m M oxamate. Error bars represent the standard deviations from the mean of three deter- minations. Table 2. Effect of 0.1 m M acetyl-CoA on the oxalacetate decarboxy- lase activity (UÆlmol )1 ) of PC-(CT + BCCP) and intact PC. One unit of enzyme activity was defined as the amount of enzyme required to catalyze the formation of 1 lmol of pyruvate per min. Values are the means ± SD from three separate experiments. Acetyl-CoA PC-(CT + BCCP) Intact PC +Oxamate – Oxamate +Oxamate – Oxamate Present 6.62 ± 0.48 0.18 ± 0.03 3.88 ± 0.32 0.43 ± 0.05 Absent 6.42 ± 0.54 0.19 ± 0.04 3.78 ± 0.37 0.41 ± 0.06 1398 S. Sueda et al.(Eur. J. Biochem. 271) Ó FEBS 2004 as substrate. As the activity of PC-(BC) was completely dependent not only on bicarbonate but also on biotin, it was confirmed that biotin is essential in the reaction of bicarbonate with ATP. Although a large number of studies has been devoted to clarifying the role of acetyl-CoA in the PC reaction [1,2,32–34], little is known about its activation mechanism. It was found that acetyl-CoA did not affect the ATP cleavage activity of PC-(BC), although it is essential in the same reaction of the BC domain of intact PC. Likewise, oxalacetate decarboxylation reactions of PC-(CT + BCCP) and intact PC were not dependent on acetyl- CoA. Taken together, it seems that acetyl-CoA partici- pates in the reaction of BC but not of CT, and judging from the disappearance of acetyl-CoA dependence in the reaction of PC-(BC) with free biotin, acetyl-CoA may act as a regulator in the interaction between the active site of the BC domain and the biotin moiety of the BCCP domain. Based on these arguments, it is tempting to propose the following hypothesis: in the absence of acetyl-CoA, the active site of the BC domain cannot interact with biotin of the BCCP domain due to the spatial separation between the active site and biotin; however, upon binding of acetyl-CoA, a conformational change is induced, so that biotin can reach the active site to carry out the catalytic reaction. In the reaction of PC-(BC) with free biotin, such a steric constraint is absent; as a result, its acetyl-CoA dependence may be lost. Conformation changes of PC induced by acetyl-CoA have been observed by various means such as electron micros- copy [35,36], ultracentrifugation [37] and others [38]. In order to verify the above hypothesis, further investigation is needed and studies using other engineered proteins as well as X-ray crystallographic analysis are under way in this laboratory. Acknowledgements The authors are grateful to Ms Tomoko Ishiguro and Ms Masayo Nonaka for their assistance with construction of the recombinant plasmids. References 1. Jitrapakdee, S. & Wallace, J.C. (1999) Structure, function and regulation of pyruvate carboxylase. Biochem. J. 340, 1–16. 2. Attwood, P.V. (1995) The structure and the mechanism of action of pyruvate carboxylase. Int. J. Biochem. Cell. Biol. 27, 231–249. 3. Wallace, J.C., Jitrapakdee, S. & Chapman-Smith, S. (1998) Pyruvate carboxylase. Int. J. Biochem. Cell. Biol. 30, 1–5. 4. Barden, R.E., Taylor, B.L., Isohashi, F., Frey, W.H., Zander, G., Lee, J.C. & Utter, M.F. (1975) Structural properties of pyruvate carboxylases from chicken liver and other sources. Proc. Natl Acad. Sci. USA 72, 4308–4312. 5.Lim,F.,Morris,P.,Occhiodoro,F.&Wallace,J.C.(1988) Sequence and domain structure of yeast pyruvate carboxylase. J. Biol. Chem. 263, 11493–11497. 6.Cohen,N.D.,Duc,J.A.,Beegen,H.&Utter,M.F.(1979) Quaternary structure of pyruvate carboxylase from Pseudomonas citronellolis. J. Biol. Chem. 254, 9262–9269. 7. Goss, J.A., Cohen, N.D. & Utter, M.F. (1981) Characterization of the subunit structure of pyruvate carboxylase. J. Biol. Chem. 256, 11819–11825. 8. Cazzulo, J.J. & Stoppani, A.O.M. (1968) The regulation of yeast pyruvate carboxylase by acetyl-coenzyme A and L -aspartate. Arch. Biochem. Biophys. 127, 563–567. 9. Libor, S.M., Sundaram, T.K. & Scrutton, M.C. (1978) Pyruvate carboxylase from a thermophilic Bacillus. Studies on the specificity of activation by acyl derivatives of coenzyme A and on the properties of catalysis in the absence of activator. Biochem. J. 169, 543–558. 10. Ashman, L.K., Keech, D.B., Wallace, J.C. & Nielsen, J. (1972) Sheep kidney pyruvate carboxylase. Studies on its activation by acetyl coenzyme A and characterization of its acetyl coenzyme A independent reaction. J. Biol. Chem. 247, 5818–5824. 11. Kondo, H., Kazuta, Y., Saito, A. & Fuji, K. (1997) Cloning and nucleotide sequence of Bacillus stearothermophilus pyruvate carboxylase. Gene 191, 47–50. 12. Henrikson, K.P., Allen, S.H.G. & Maloy, W.L. (1979) An avidin monomer affinity column for the purification of biotin-containing enzymes. Anal. Biochem. 94, 366–370. 13. Kohanski, R.A. & Lane, M.D. (1990) Monovalent avidin affinity column. Methods Enzymol. 184, 194–200. 14. Buckley, J.J., Libor, S. & Sundaram, T.K. (1979) Biotin subunits of acetyl CoA carboxylase and pyruvate carboxylase from a thermophilic Bacillus. Arch. Biochem. Biophys. 192, 396–404. 15. Jitrapakdee, S., Walker, M.E. & Wallace, J.C. (1999) Functional expression, purification, and characterization of recombinant human pyruvate carboxylase. Biochem. Biophys. Res. Commun. 266, 512–517. 16. Modak, H.V. & Kelly, D.J. (1995) Acetyl-CoA-dependent pyru- vate carboxylase from the photosynthetic bacterium Rhodobacter capsulatus: rapid and efficient purification using dye-ligand affinity chromatography. Microbiol. 141, 2619–2628. 17. Mukhopadhyay, B., Stoddard, S.F. & Wolfe, R.S. (1998) Purification, regulation, and molecular and biochemical charac- terization of pyruvate carboxylase from Methanobacterium ther- moautotrophicum strain DH. J. Biol. Chem. 273, 5155–5166. 18. Mukhopadhyay, B. & Purwantini, E. (2000) Pyruvate carboxylase from Mycobacterium smegmatis: stabilization, rapid purification, molecular and biochemical characterization and regulation of the cellular level. Biochim. Biophys. Acta 1475, 191–206. 19. Morrison, J.F. (1979) Approaches to kinetic studies on metal- activated enzymes. Methods Enzymol. 63, 257–294. 20. Levert, K.L., Lloyd, R.B. & Waldrop, G.L. (2000) Do cystein 230 and lysine 238 of biotin carboxylase play a role in the activation of biotin? Biochemistry 39, 4122–4128. 21. Attwood, P.V. & Graneri, B.D.L.A. (1992) Bicarbonate- dependent ATP cleavage catalysed by pyruvate carboxylase in the absence of pyruvate. Biochem. J. 287, 1011–1017. 22. Attwood, P.V. & Cleland, W.W. (1986) Decarboxylation of oxalacetate by pyruvate carboxylase. Biochemistry 25, 8181–8196. 23. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Transfer of proteins from SDS-polyacrylamide gels to solid supports: immunological detection of immobilized proteins (western blot- ting). In Molecular Cloning: a Laboratory Manual, 2nd edn, pp. 18.60–18.75. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 24.Waldrop,G.L.,Rayment,I.&Holden,H.M.(1994)Three- dimensional structure of the biotin carboxylase subunit of acetyl- CoA carboxylase. Biochemistry 33, 10249–10256. 25. Thoden, J.B., Blanchard, C.Z., Holden, H.M. & Waldrop, G.L. (2000) Movement of the biotin carboxylase B-domain as a result of ATP binding. J. Biol. Chem. 275, 16183–16190. 26. Kondo, H., Shiratsuchi, K., Yoshimoto, T., Masuda, T., Kitaz- ono, A., Tsuru, D., Anai, M., Sekiguchi, M. & Tanabe, T. (1991) Acetyl-CoA carboxylase from Escherichia coli: Gene organization and nucleotide sequence of the biotin carboxylase subunit. Proc. NatlAcad.Sci.USA88, 9730–9733. Ó FEBS 2004 Protein engineering of pyruvate carboxylase (Eur. J. Biochem. 271) 1399 27. Libor, S., Sundaram, T.K., Warwick, R., Chapman, J.A. & Grundy, S.M.W. (1979) Pyruvate carboxylase from a thermo- philic Bacillus: some molecular characteristics. Biochemistry 18, 3647–3653. 28. Cazzulo, J.J., Sundaram, T.K. & Kornberg, H.L. (1970) Proper- ties and regulation of pyruvate carboxylase from Bacillus stearo- thermophilus. Proc.R.Soc.Lond.,B,Biol.Sci.176, 1–19. 29. Knowles, J.R. (1989) The mechanism of biotin-dependent enzymes. Annu. Rev. Biochem. 58, 195–221. 30. Lynen, F., Knappe, J., Lorch, E., Jutting, G. & Ringelmann, E. (1959) Die biochemische Funktion des Biotins. Angew. Chem. 71, 481–486. 31. Polakis,S.E.,Guchhait,R.B.,Zwergel,E.E.&Lane,M.D.(1974) Acetyl coenzyme A carboxylase system of Escherichia coli. J. Biol. Chem. 249, 6657–6667. 32. Attwood, P.V. (1993) Locus of action of acetyl CoA in the biotin- carboxylation reaction of pyruvate carboxylase. Biochemistry 32, 12736–12742. 33. Phillips, N.F.B., Sonswell, M.A., Chapman-Smith, A., Keech, D.B. & Wallace, J.C. (1992) Isolation of a carboxylphosphate intermediate and the locus of acetyl-CoA action in the pyruvate carboxylase reaction. Biochemistry 31, 9445–9450. 34. Attwood, P.V. & Wallace, J.C. (1986) The carboxybiotin complex of chicken liver pyruvate carboxylase. A kinetic analysis of the effects of acetyl-CoA, Mg 2+ ions and temperature on its stability and on its reaction with 2-oxobutyrate. Biochem. J. 235, 359–364. 35. Rohde, M., Lim, F. & Wallace, J.C. (1986) Pyruvate carboxylase from Saccharomyces cerevisiae. Quaternary structure, effects of allosteric ligands and binding of avidin. Eur. J. Biochem. 156, 15–22. 36. Attwood, P.V., Mayer, F. & Wallace, J.C. (1986) Avidin as a probe of the conformational changes induced in pyruvate car- boxylase by acetyl-CoA and pyruvate. FEBS Lett. 203, 191–196. 37. Taylor, B.L., Frey, W.H., Barden, R.E., Scrutton, M.C. & Utter, M.F. (1978) The use of the ultracentrifuge to determine the cata- lytically competent forms of enzymes with more than one oligo- meric structure. J. Biol. Chem. 253, 3062–3069. 38. Frey, W.H. & Utter, M.F. (1977) Binding of acetyl-CoA to chicken liver pyruvate carboxylase. J. Biol. Chem. 252, 51–56. 1400 S. Sueda et al.(Eur. J. Biochem. 271) Ó FEBS 2004 . Protein engineering of pyruvate carboxylase Investigation on the function of acetyl-CoA and the quaternary structure Shinji Sueda, Md. Nurul Islam and. close to the corresponding value of the present work. Also, the effect of acetyl-CoA on the pyruvate carboxylase reaction was nearly the same among the present