Membrane type-1 matrix metalloprotease-independent activation of pro-matrix metalloprotease-2 by proprotein convertases Bon-Hun Koo, Hee-Hyun Kim, Michael Y Park, Ok-Hee Jeon and Doo-Sik Kim Department of Biochemistry, College of Life Science and Biotechnology, Yonsei University, Seoul, South Korea Keywords furin; membrane type-1 matrix metalloprotease (MT1-MMP); pro-matrix metalloprotease-2 (pro-MMP-2); pro-MMP-2 activation; proprotein convertases Correspondence B.-H Koo, Department of Biochemistry, College of Life Science and Biotechnology, Yonsei University, 134 Sinchon-Dong Seodaemun-Gu, Seoul 120-749, South Korea Fax: 82 312 6027 Tel: 82 313 2878 E-mail: k4119@yonsei.ac.kr D.-S Kim, Department of Biochemistry, College of Life Science and Biotechnology, Yonsei University, 134 Sinchon-Dong Seodaemun-Gu, Seoul 120-749, South Korea Fax: 82 312 6027 Tel: 82 2123 2700 E-mail: dskim@yonsei.ac.kr (Received 14 July 2009, revised 26 August 2009, accepted 28 August 2009) doi:10.1111/j.1742-4658.2009.07335.x Matrix metalloprotease-2 is implicated in many biological processes and degrades extracellular and non-extracellular matrix molecules Matrix metalloprotease-2 maintains a latent state through a cysteine–zinc ion pairing which, when disrupted, results in full enzyme activation This pairing can be disrupted by a conformational change or cleavage within the propeptide The best known activation mechanism for pro-matrix metalloprotease-2 occurs via cleavage of the propeptide by membrane type-1 matrix metalloprotease However, significant residual activation of pro-matrix metalloprotease-2 is seen in membrane type-1 matrix metalloprotease knockout mice and in fibroblasts treated with metalloprotease inhibitors These findings indicate the presence of a membrane type-1 matrix metalloprotease-independent activation mechanism for pro-matrix metalloprotease-2 in vivo, which prompted us to explore an alternative activation mechanism for pro-matrix metalloprotese-2 In this study, we demonstrate membrane type-1 matrix metalloprotease-independent propeptide processing of matrix metalloprotease-2 in HEK293F and various tumor cell lines, and show that proprotein convertases can mediate the processing intracellularly as well as extracellularly Furthermore, processed matrix metalloprotease-2 exhibits enzymatic activity that is enhanced by intermolecular autolytic cleavage Thus, our experimental data, taken together with the broad expression of proprotein convertases, suggest that the proprotein convertase-mediated processing may be a general activation mechanism for pro-matrix metalloprotease-2 in vivo Introduction Matrix metalloproteases (MMPs) constitute a family of 23 zinc-dependent endopeptidases They are involved in many biological processes and diseases, and catalyze the proteolysis of extracellular and non-extracellular matrix molecules [1] For example, MMP-2 is associated closely with organ growth, endometrial cycling, wound healing, bone remodeling, tumor invasion and metastasis [2] Its functions are executed through the degradation of components of the basement membrane, including type IV collagen, fibronectin, elastin, laminin, aggrecan and fibrillin [1,3] Abbreviations Con A, concanavalin A; dec-RVKR-cmk, dec-Arg-Val-Lys-Arg-chloromethyl ketone; FITC, fluorescein isothiocyanate; GAPDH, glyceraldehyde-3phosphate dehydrogenase; MMP, matrix metalloprotease; MT1-MMP, membrane type-1 matrix metalloprotease; MTT, 3-(4,5-dimethylthiazol2-yl)-2,5-diphenyl-tetrazolium bromide; PC, proprotein convertase; pro-MMP-2, pro-matrix metalloprotease-2; TGN, trans-Golgi network; TIMP, tissue inhibitor of metalloprotease FEBS Journal 276 (2009) 6271–6284 ª 2009 The Authors Journal compilation ª 2009 FEBS 6271 Activation of pro-matrix metalloprotease-2 by proprotein convertases Because of its potential for tissue destruction, MMP-2 activity is regulated at multiple points, such as gene expression, compartmentalization, zymogen activation and enzyme inactivation by extracellular inhibitors [e.g tissue inhibitors of metalloproteases (TIMPs)] [1] Like other MMPs, pro-MMP-2 maintains a latent state via an interaction between a thiol group of a propeptide cysteine residue and the catalytic zinc ion in the active site [4] Disruption of this cysteine–zinc ion pairing, such as through conformational changes [5] or proteolysis within the propeptide [e.g by plasmin, thrombin or membrane type-MMPs (MT-MMPs)] [6–12], is required for the activation of the latent enzyme The most studied activation mechanism for pro-MMP-2 is cleavage of the propeptide by MT1-MMP, which requires cooperative activity between MT1-MMP and TIMP-2 [7,13–15] However, residual activation of pro-MMP-2 is observed in MT1-MMP knockout mice, even though the activation is reduced significantly [16,17] Thus, these data suggest that an MT1-MMP-independent activation mechanism for pro-MMP-2 may also exist in vivo Proprotein convertases (PCs), a family of Ca2+dependent serine proteases of which furin is the most ubiquitous, have a major role in molecular maturation [18–20] Most PCs reside within the trans-Golgi network (TGN), but some are present at the cell surface via a transmembrane domain (e.g furin) [21,22] or the extracellular matrix (e.g PACE4 and PC5A) [23] Like other PCs, furin cleaves its substrates immediately downstream of the consensus sequence Arg-XaaArg ⁄ Lys-Arg (where Xaa is any amino acid) in the TGN [18,19,24] or at the cell surface [25] The significance of furin in many biological processes is attributed to its widespread expression [26] and the developmental lethality of furin knockout mice [27] Furthermore, elevated expression of PCs is frequently observed in various human cancers and tumor cell lines, implicating the importance of PCs in tumor progression [28] The presence of activated MMP-2 in MT1-MMP knockout mice prompted us to explore an MT1MMP-independent activation mechanism for proMMP-2 In this study, we demonstrate MT1-MMPindependent propeptide processing of MMP-2 in HEK293F and various tumor cell lines, where PCs could mediate this processing Furthermore, PC-processed MMP-2 showed enzymatic activity, which was enhanced following intermolecular autolytic cleavage Thus, these results strongly suggest a potential role of PCs in pro-MMP-2 activation in PC-expressing cells 6272 B.-H Koo et al Results MT-MMP-independent processing of pro-MMP-2 Previous studies have shown that MT1-MMP is a major activator of pro-MMP-2 [29–31] Furthermore, TIMP-2 and integrin avb3 have been shown to play important roles in MT1-MMP-mediated pro-MMP-2 activation [13–15,32] Thus, prior to investigating the role of MT1-MMP in pro-MMP-2 activation, expression of MT1-MMP, TIMP-2 and integrin avb3 was characterized in COS-1, HCT116, HEK293F, MCF-7, MDAH 2774, K-562, NCI-H460 and Hep G2 cells MT1-MMP protein was undetectable by immunoblotting with anti-MT1-MMP rabbit polyclonal IgG in all cell types (data not shown), whereas semi-quantitative RT-PCR detected its mRNA in HCT116, K-562, NCIH460 and Hep G2 cells (Fig 1A) Because other MT-MMPs have also been demonstrated to process pro-MMP-2 [8–11], their expression was also examined in these cells Although protein expression was not determined, different levels of MT-MMP mRNA were observed in the cells (Fig 1A) Immunoblotting with mouse anti-TIMP-2 IgG2a showed that COS-1 cells possessed the highest levels of TIMP-2, whereas the expression of this inhibitor was absent or much lower in HCT116, HEK293F, MCF-7, MDAH 2774, K-562, NCI-H460 and Hep G2 cells (Fig 1B) Variable cell surface expression of integrin avb3 was assessed by flow cytometric analysis (Fig 1C), although its expression was undetectable in HCT116, K-562 and Hep G2 cells (data not shown) These data demonstrate that different cell types have different cellular components for MT-MMP-mediated pro-MMP-2 activation To test the MT-MMP-independent processing of pro-MMP-2, cells were incubated with metalloprotease inhibitors (e.g GM6001 and TIMP-2), and the conditioned medium was analyzed by zymography TIMP-2 is a strong inhibitor of MT1-MMP at high concentrations [33], although it activates pro-MMP-2 with MT1MMP at low concentrations [34] Thus, we used a high concentration of TIMP-2 (5 lgỈmL–1) to completely inhibit the enzymatic activities of MT1-MMP and other TIMP-2-sensitive MMPs The data showed that the processed MMP-2 was clearly seen in the conditioned medium of HEK293F, MDAH 2774 and MCF7 cells (Fig 2A) However, processing was not affected by incubation with the inhibitors in these cells (Fig 2A) Likewise, processed MMP-2 was observed in the conditioned medium of K-562, NCI-H460 and Hep G2 cells, and their incubation with the metalloprotease inhibitors did not result in the prevention of processing even though pro-MMP-2 accumulated FEBS Journal 276 (2009) 6271–6284 ª 2009 The Authors Journal compilation ª 2009 FEBS B.-H Koo et al Activation of pro-matrix metalloprotease-2 by proprotein convertases A Fig Cellular expression of MT-MMPs, TIMP-2 and integrin avb3 (A) Analysis of MT-MMP mRNA in various cell lines The data represent semi-quantitative RT-PCR analysis of MT-MMP mRNA in HCT116, HEK293F, MCF-7, MDAH 2774, K-562, NCI-H460 and Hep G2 cells PCR products (25 cycles) were resolved by agarose gel electrophoresis and visualized by ethidium bromide staining Arrowheads indicate PCR products of MT-MMPs or GAPDH (B) Western blotting of conditioned medium with mouse anti-TIMP-2 IgG2a The conditioned medium from the cells on 12-well plates was concentrated prior to SDS-PAGE Arrow indicates TIMP-2 protein (C) Flow cytometric analysis for cell surface expression of integrin avb3 The percentage changes in fluorescence intensity by the presence of integrin avb3 are shown A sample lacking primary antibody was used as a control (n = representative experiments) B C slightly in the conditioned medium of K-562 cells treated with the inhibitors (Fig 2B) As a control, the conditioned medium of concanavalin A (Con A)-treated HT-1080 cells showed that MT1-MMP-mediated processing of pro-MMP-2 was completely inhibited in the presence of the metalloprotease inhibitors (Fig 2C) Unlike HT-1080 cells, endogenous MMP-2 expression in all the cell lines used was low, so that lytic bands could hardly be seen in the zymograms without concentrating the conditioned medium (Fig 2A and not shown in Fig 2B) MT-MMPs cleave pro-MMP-2 at the Asn66–Leu [7–10] or Asn109–Tyr peptide bond [11] Therefore, to further investigate the role of MT-MMP in pro-MMP2 activation, pro-MMP-2 mutants incapable of cleavage by MT1-MMP and ⁄ or autolysis were generated (N66I ⁄ L67V, N109I ⁄ Y110F and N66I ⁄ L67V ⁄ N109I ⁄ Y110F) (Fig 3) In agreement with the data using metalloprotease inhibitors, transient transfection of these mutants into HEK293F, MCF-7 and MDAH 2774 cells did not prevent cleavage, as processing of the mutants persisted (Fig 4A) By contrast, processing was increased significantly in the cells expressing the pro-MMP-2 N66I ⁄ L67V and N66I ⁄ L67V ⁄ N109I ⁄ Y110F mutants by unknown mechanisms (Fig 4A) As a control, COS-1 cells expressing the mutants with MT1-MMP showed that the pro-MMP-2 N66I ⁄ L67V and N66I ⁄ L67V ⁄ N109I ⁄ Y110F mutants were not cleaved by MT1-MMP, and that the pro-MMP-2 N109I ⁄ Y110F mutant was not processed autocatalytically following MT1-MMP cleavage (Fig 4B) Overall, these results suggest the presence of an MT-MMP-independent activation mechanism for pro-MMP-2 in some cell types PCs mediate propeptide processing of MMP-2 To further explore the MT-MMP-independent activation mechanism of pro-MMP-2, cells were incubated with various inhibitors targeted towards serine (e.g aprotinin, chymostatin, and leupeptin) and aspartyl (e.g pepstatin) proteases, and the conditioned medium was analyzed by zymography As shown in Fig 5A, this processing was not affected by effective concentrations of these protease inhibitors in HEK293F, MCF-7 and MDAH 2774 cells These data suggest that pro-MMP-2 processing may be mediated by proteases other than serine and aspartyl proteases in these cells FEBS Journal 276 (2009) 6271–6284 ª 2009 The Authors Journal compilation ª 2009 FEBS 6273 Activation of pro-matrix metalloprotease-2 by proprotein convertases B.-H Koo et al A B Fig Structures of pro-MMP-2 mutants C Fig MT-MMP-independent processing of pro-MMP-2 in various cell types (A) Effect of metalloprotease inhibitors on the propeptide processing of MMP-2 in HEK293F, MDAH 2774 and MCF-7 cells Cells were treated with GM6001 (20 lM) or TIMP-2 (5 lgỈmL–1) in 500 lL of 293 SFM-II medium on 24-well plates After 14 h of incubation, MMP-2 was captured from 500 lL of the conditioned medium using gelatin–Sepharose according to the manufacturer’s recommendations (Amersham Biosciences) and eluted in 30 lL of SDS sample buffer, and the eluted sample was analyzed by zymography; 10 lL of the conditioned medium (pre-column sample, unconcentrated) was loaded on the first lane Arrows indicate pro- and processed MMP-2 (MMP-2) (B) Effect of metalloprotease inhibitors on the processing of pro-MMP-2 in K-562, NCI-H460 and Hep G2 cells Cells were treated as described above MMP-2 was concentrated from 125 lL of the conditioned medium using gelatin–Sepharose and the eluted sample was used for zymographic analysis Conditioned medium from HT-1080 cells was used as a positive control for pro-MMP-2 (C) Validation of the metalloprotease inhibitors to prevent MT1-MMP-mediated processing of pro-MMP-2 HT-1080 cells were treated with Con A (50 lgỈmL–1) in the presence and absence of the metalloprotease inhibitors for 14 h (n = representative experiments) A previous study has shown the furin processing of pro-MMP-2 through cleavage of a consensus PC cleavage site in the propeptide of MMP-2 (Arg98-LysPro-Arg101) [35] We initially examined the enzymatic activities of PCs in various cells using an enzymatic activity assay The results showed PC activities in the cell lysates from HEK293F, MCF-7, MDAH 2774, K-562, NCI-H460 and Hep G2, whereas negligible amounts of PC activity were detected in COS-1 and HCT116 cells (Fig 5B) Next, we investigated whether 6274 PCs play a crucial role in pro-MMP-2 processing by incubating cells with increasing concentrations of the membrane-permeable PC inhibitor dec-Arg-Val-LysArg-chloromethyl ketone (dec-RVKR-cmk) As shown in Fig 5C, D, pro-MMP-2 processing was reduced significantly in the PC inhibitor-treated cells, suggesting that PCs are major processing enzymes for pro-MMP-2 in these cell types The cells did not undergo apoptosis at the doses of inhibitor used, which was confirmed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) assay (data not shown) Next, experiments were performed to identify which PCs associated with the constitutive secretory pathway mediated this processing When pro-MMP-2 was expressed in COS-1 and HCT116 cells, mainly the intact MMP-2 zymogen was detectable, whereas the processed form was negligible in the conditioned medium (Fig 5E) However, processed MMP-2 was seen in the conditioned medium of cells co-expressing pro-MMP-2 and PCs (Fig 5E) Parallel experiments performed in HEK293F and MCF-7 cells showed endogenous processing of proMMP-2, which was enhanced following the transfection of PCs (Fig 5E) The substitution of Arg101 with Ala decreased PC processing significantly, as well as the endogenous processing of pro-MMP-2 However, partially and fully processed MMP-2 was marginally detectable in the conditioned medium of the cells expressing the mutant (Fig 5E) As such, PCs may be the major processing enzymes for pro-MMP-2 in these cells PACE4- and PC5A-expressing cells exhibit intracellular and extracellular processing of pro-MMP-2 Intracellular processing of pro-MMP-2 by furin has been shown previously in COS-1 cells [35] Despite FEBS Journal 276 (2009) 6271–6284 ª 2009 The Authors Journal compilation ª 2009 FEBS B.-H Koo et al Fig (A) Zymograms of conditioned medium from cells expressing pro-MMP-2 (WT), pro-MMP-2 N66I ⁄ L67V mutant (N66I ⁄ L67V), pro-MMP-2 N109I ⁄ Y110F mutant (N109I ⁄ Y110F) and pro-MMP-2 N66I ⁄ L67V ⁄ N109I ⁄ Y110F mutant (N66I ⁄ L67V ⁄ N109I ⁄ Y110F) The conditioned medium was analyzed without concentration The bar graph shows the ratio of processed MMP-2 to unprocessed pro-MMP-2 Arrows indicate pro- and processed MMP-2 (MMP-2) (B) Zymogram of conditioned medium from COS-1 cells expressing pro-MMP-2, pro-MMP-2 N66I ⁄ L67V mutant, pro-MMP-2 N109I ⁄ Y110F mutant and pro-MMP-2 N66I ⁄ L67V ⁄ N109I ⁄ Y110F mutant with or without MT1-MMP Note that COS-1 cells expressing pro-MMP-2 N66I ⁄ L67V and N66I ⁄ L67V ⁄ N109I ⁄ Y110F mutants show prominent processing of the propeptide without MT1-MMP expression Arrows indicate pro-, intermediate and processed MMP-2 (MMP-2) Data are the means and standard deviations of n = experiments *P < 0.05 versus wild-type Activation of pro-matrix metalloprotease-2 by proprotein convertases A B this, the cellular localization of pro-MMP-2 processing by other PCs, including PACE4 and PC5A, remains unknown Therefore, whether PACE4- or PC5A-mediated processing of pro-MMP-2 occurs intracellularly was investigated using a variety of approaches First, we examined the enzymatic activities of PCs in conditioned medium and cell lysates using the enzymatic activity assay The results showed PC activities in the conditioned medium and cell lysates from COS-1 cells expressing PCs (Fig 6A) We further verified whether the activitie cell lysates with the PC inhibitor (1 s shown reflected exclusively the presence of PCs by treating the conditioned medium and 00 lm) The enzymatic activities were almost completely inhibited (more than 98%) in the PC inhibitor-treated samples (data not shown), excluding the enzymatic activities of other proteases in the conditioned medium and cell lysates Next, pro-MMP-2-expressing COS-1 cells were co-cultured with cells expressing furin, PACE4, PC5A or MT1-MMP, and zymographic analysis of the conditioned medium was performed Although soluble furin was detected in the conditioned medium (Fig 6A) and furin cell surface expression was also confirmed by flow cytometry and cell surface biotinylation (Fig 6C), furin-expressing COS-1 cells did not show extracellular processing of pro-MMP-2 (Fig 6B) Moreover, when purified pro-MMP-2 was incubated with purified furin under cell-free conditions, processing did not occur (data not shown) By contrast, the presence of PACE4, PC5A or MT1-MMP resulted in extracellular cleavage of pro-MMP-2 (Fig 6B) Moreover, substitution of Arg101 with Ala abolished the extracellular processing of pro-MMP-2 by PACE4 and PC5A completely (Fig 6B), suggesting the direct cleavage of pro-MMP-2 by these enzymes To further compare PACE4 and PC5A processing of pro-MMP-2 with that of furin, cell lysates from the co-transfected cells were analyzed by zymography, in which cells were pretreated with trypsin ⁄ EDTA to remove MMP-2 from the cell surface (Fig 6E) Cell lysates from furin-expressing cells showed dramatically larger amounts of processed MMP-2 than did those from cells expressing PACE4 or PC5A (Fig 6D) Interestingly, processed MMP-2 was also seen in cell lysates from HEK293F and MCF-7 cells expressing pro-MMP-2 alone (Fig 6D) To further verify the intracellular localization of PC-processed MMP-2, a FLAG-tagged pro-MMP-2 mutant, in which the FLAG epitope was inserted immediately downstream of Arg98-Lys-Pro-Arg101, was generated In these experiments, PC-processed MMP-2 with a free N-terminal FLAG tag was detected by western blotting with mouse anti-FLAG M1 IgG2b The antiFLAG M1 IgG2b only recognizes proteins with a free FEBS Journal 276 (2009) 6271–6284 ª 2009 The Authors Journal compilation ª 2009 FEBS 6275 Activation of pro-matrix metalloprotease-2 by proprotein convertases A C B Fig PC-dependent processing of pro-MMP-2 (A) Effect of various inhibitors on the propeptide processing of MMP-2 in HEK293F, MCF-7 and MDAH 2774 cells Cells were treated with aprotinin (20 lgỈmL–1), chymostatin (10 lgỈmL–1), leupeptin (20 lgỈmL–1) and pepstatin (2 lM) After h of incubation, the conditioned media were analyzed by zymography Arrows indicate pro- and processed MMP-2 (MMP-2) (B) Protease activities of PCs in cell lysates from the cells indicated (C) Inhibition of pro-MMP-2 processing by a PC inhibitor dec-RVKR-cmk in HEK293F, MCF-7 and MDAH 2774 cells Cells were incubated with 0–100 lM of the inhibitor for h, and the conditioned medium was analyzed by zymography The bar graph shows the ratio of processed MMP-2 to pro-MMP-2 in the conditioned medium of cells treated with 100 lM of the PC inhibitor Data are the means and standard deviations of n = experiments *P < 0.05 versus untreated control (D) Inhibition of pro-MMP-2 processing by the PC inhibitor in K-562, NCI-H460 and Hep G2 cells Cells were incubated with 100 lM of the inhibitor Note that almost complete inhibition of pro-MMP2 processing is seen in the conditioned medium of the inhibitor-treated cells (E) Zymograms of conditioned medium from cells expressing pro-MMP-2 or pro-MMP-2 R101A mutant with furin, PACE4 or PC5A (n = representative experiments) D E N-terminal FLAG tag These results demonstrated that furin-processed MMP-2 was recognized specifically by the anti-FLAG M1 antibody (Fig 7B), whereas proMMP-2 and processed MMP-2 were detected by the anti-MMP-2 antibody (Fig 7A) Furthermore, mutation of Arg101 to Ala resulted in the complete loss of FLAG-tagged MMP-2, further supporting the specificity of the anti-FLAG M1 antibody and validating this experimental approach (Fig 7B) Immunofluorescence of fixed and permeabilized COS-1 cells stained with anti-MMP-2 antibody revealed MMP-2 localization to be mostly intracellular (Fig 7C) Staining with antiFLAG M1 antibody also showed the intracellular localization of PC-cleaved MMP-2, even though cells expressing PACE4 or PC5A stained weakly (Fig 7C) Cells expressing MMP-2 alone exhibited little staining 6276 B.-H Koo et al with the anti-FLAG M1 antibody (Fig 7C) Furthermore, no signal was observed in cells expressing the pro-MMP-2-RKPA(101)-FLAG mutant with PCs, providing additional evidence for the specificity of the anti-FLAG M1 antibody (data not shown) Taken together, these results demonstrate that furin-expressing cells undergo exclusive intracellular processing of pro-MMP-2, whereas cells expressing PACE4 or PC5A exhibit both intracellular and extracellular processing of pro-MMP-2 Pro101 regulates excessive PC processing of pro-MMP-2 Because Arg98-Lys-Pro-Arg101 in the propeptide of MMP-2 is a minimal recognition motif for PC cleav- FEBS Journal 276 (2009) 6271–6284 ª 2009 The Authors Journal compilation ª 2009 FEBS B.-H Koo et al Activation of pro-matrix metalloprotease-2 by proprotein convertases A C B Fig Cellular location of PC processing of pro-MMP-2 (A) Protease activities of PCs in conditioned medium and cell lysates from COS-1 cells expressing PCs (B) Co-culture of COS-1 cells expressing pro-MMP-2 or pro-MMP-2 R101A mutant with cells expressing PCs or MT1-MMP The conditioned media were analyzed by zymography Note that processed MMP-2 is faintly seen in the conditioned medium of cells expressing pro-MMP-2 alone Arrows indicate pro-, intermediate and processed MMP-2 (MMP-2) (C) Cell surface localization of furin in the transfected COS-1 cells Flow cytometry and cell surface biotinylation approaches were used to detect cell surface furin Arrowhead indicates furin (D) Zymographic analysis of cell lysates from COS-1, HEK293F and MCF-7 cells co-expressing pro-MMP-2 and PCs Cells were pretreated with 0.05% trypsin ⁄ 0.53 mM EDTA for 30 on ice to remove cell surface proteins (E) Flow cytometric analysis shows the cell surface localization of MMP-2 in COS-1, HEK293F and MCF-7 transfected with pro-MMP-2 Cell surface MMP-2 (dotted line) is absent in the cells treated with trypsin ⁄ EDTA (T ⁄ E) (full line) (n = representative experiments) D age [18,19,24], and Pro100 is highly conserved in the MMP family, we investigated whether this amino acid residue can play a role in regulating the PC cleavage of pro-MMP-2 The conditioned medium of cells expressing the pro-MMP-2 P100K mutant showed highly increased propeptide processing by PCs (PC5A > PACE4 > furin), whereas the PC-mediated intracellular cleavage of the mutant was increased slightly (Fig 8A) Interestingly, the co-culture of COS1 cells expressing individual PCs and cells expressing the mutant showed more robust processing of the E propeptide by extracellular PACE4 and PC5A, but not by extracellular furin (Fig 8B) These experimental data suggest that Pro100 plays a critical role in regulating excessive pro-MMP-2 processing, especially by extracellular PACE4 and PC5A PC-cleaved MMP-2 is further processed to achieve full activation Because PCs cleave pro-MMP-2 immediately upstream of the Cys102 residue that interacts with the catalytic FEBS Journal 276 (2009) 6271–6284 ª 2009 The Authors Journal compilation ª 2009 FEBS 6277 Activation of pro-matrix metalloprotease-2 by proprotein convertases A B.-H Koo et al B C Fig Intracellular localization of PC-cleaved MMP-2 Cell lysate was obtained from COS-1 cells expressing pro-MMP-2-RKPR(101)-FLAG or pro-MMP-2RKPA(101)-FLAG with or without furin Western blotting of cell lysate was performed using anti-MMP-2 (A) and anti-FLAG M1 (B) antibody Arrowheads indicate furin-processed MMP-2, and arrow indicates uncleaved pro-MMP-2 (C) Confocal microscope imaging of fixed and permeabilized COS-1 cells stained with anti-MMP-2 (total MMP-2 staining) or anti-FLAG M1 (MMP-2 or FLAG M1 staining is green) A negative control in which the primary antibody was omitted showed no signal (data not shown) Scale bar, 20 lm domain zinc ion, MMP-2 processed in this manner may not possess catalytic activity Therefore, we investigated whether PC-cleaved MMP-2 exhibits enzymatic activity or whether intermolecular autolytic cleavage at the Asn109–Tyr peptide bond [36] is required for its activity after initial processing The degradation of collagen IV and a fluorescein-conjugated gelatin by 6278 processed MMP-2 from the conditioned medium of HEK293F cells expressing pro-MMP-2, the pro-MMP-2 E404A mutant and the pro-MMP-2 N109I ⁄ Y110F mutant in the presence and absence of furin was compared Because the catalytic glutamic acid residue within the pro-MMP-2 active site is replaced in the E404A mutant, a proteolytically inactive enzyme is FEBS Journal 276 (2009) 6271–6284 ª 2009 The Authors Journal compilation ª 2009 FEBS B.-H Koo et al Activation of pro-matrix metalloprotease-2 by proprotein convertases A A B B Fig Regulation of excessive PC processing of pro-MMP-2 by Pro100 residue (A) PC processing of pro-MMP-2 and pro-MMP-2 P101K mutant Conditioned medium (CM) and cell lysate from co-transfected COS-1 cells were analyzed by zymography Data are the means and standard deviations of n = experiments *P < 0.05 versus wild-type (B) Co-culture of COS-1 cells expressing the pro-MMP-2 P100K mutant with PC-expressing cells The conditioned medium was analyzed by zymography (n = representative experiments) generated Furthermore, the pro-MMP-2 N109I ⁄ Y110F mutant showed complete loss of intermolecular autolytic cleavage following MT1-MMP cleavage (Fig 4B) Because of concerns about possible unwanted structural effects of the processed MMP-2 during purification, these experiments were performed using conditioned medium from cells expressing the various constructs The concentrations of MMP-2 were measured by ELISA Substrates were incubated with an identical amount of MMP-2 and subsequently analyzed by SDS-PAGE or fluorometry Although the substrates were degraded proteolytically by MMP-2 that was processed via endogenous routes, furin-mediated cleavage conferred increased proteolytic activity on MMP-2 (Fig 9) However, the pro-MMP-2 N109I ⁄ Y110F mutant showed less proteolytic activity than the wild-type, even though its enzymatic activity was also increased by furin-mediated cleavage (Fig 9) We also obtained similar results with the conditioned medium from MCF-7 cells expressing the same Fig Furin-processed MMP-2 gains its full activity by intermolecular autolytic cleavage Digestion assay of collagen IV (A) and a fluorescein-conjugated gelatin (B) Conditioned medium was obtained from HEK293F cells expressing pro-MMP-2, pro-MMP-2 E404A mutant and pro-MMP-2 N109I ⁄ Y110F mutant with or without furin The digested substrates were analyzed as described in Materials and methods Zymogram and western blot using anti-MMP-2 show equal amounts of MMP-2 used Arrows indicate pro- and processed MMP-2 (MMP-2) Data are the means and standard deviations of n = experiments ANOVA test indicates statistically significant differences in furin versus control and in the N109I ⁄ Y110F mutant versus the wild-type (P < 0.05) constructs (data not shown) However, furin-processed MMP-2 from the conditioned medium of co-transfected COS-1 cells showed much reduced levels of enzymatic activity (e.g ⁄ 50th to ⁄ 200th of the activity of processed MMP-2 from HEK293F and MCF-7 cells) by unknown mechanisms (data not shown) Taken together, these data suggest that PC-cleaved MMP-2 is further processed for full enzymatic activity Discussion The role of MT1-MMP in pro-MMP-2 activation is well established [7,14], but residual activation of proMMP-2 can also be seen in MT1-MMP) ⁄ ) mouse fibroblasts cultured in collagen gel and lung extract [16,17] The residual activation observed might be caused by the presence of other proteases, including metalloproteases (e.g other MT-MMPs) [8–11] and FEBS Journal 276 (2009) 6271–6284 ª 2009 The Authors Journal compilation ª 2009 FEBS 6279 Activation of pro-matrix metalloprotease-2 by proprotein convertases serine proteases (e.g urokinase ⁄ plasmin, thrombin, chymase, cathepsin G and trypsin-2) [6,12,37,38] Thus, we examined MT1-MMP-independent processing of pro-MMP-2 using various approaches, all of which provided evidence for non-MT1-MMP components within cells MT-MMPs have been shown to process pro-MMP-2 through cleavage of pro-MMP-2 at the Asn66–Leu peptide bond by MT1-, MT2-, MT3- and MT5-MMP, followed by intermolecular autolytic cleavage at the Asn109–Tyr peptide bond [7– 10], or directly at the Asn109–Tyr peptide bond by MT6-MMP [11] Moreover, various MT-MMPs are expressed in the cell types analyzed in this study However, studies using metalloprotease inhibitors and proMMP-2 mutants incapable of cleavage by MT-MMPs excluded MT-MMPs as candidates for pro-MMP-2 processing in these cell lines A previous study has also shown residual MMP-2 activation in fibroblasts treated with a general metalloprotease inhibitor [16] These data, taken together with ours, strongly suggest the existence of non-MT-MMP components for proMMP-2 processing in various cell types In this study, we found that PCs such as furin, PACE4 and PC5A mediate the MT-MMP-independent processing of pro-MMP-2 Furin-mediated cleavage of proMMP-2 immediately downstream of R(98)KPR(101) has been reported previously [35], even though it has a minimal PC recognition motif [18] Moreover, thrombinmediated activation of pro-MMP-2 has been shown to occur in human endothelial cells at a predicted PC recognition motif for cleavage [12] Because other serine proteases, including factor Xa and plasmin, have also been shown to activate pro-MMP-2 [6,39], it would be interesting to investigate whether these proteases can activate pro-MMP-2 by cleavage at the same site If this is the case, the PC recognition motif would be a general cleavage site for pro-MMP-2 activation Although the conditioned medium of cells expressing the PC-uncleavable mutant showed a significant decrease in pro-MMP-2 processing, lower levels of processed MMP-2 were also seen MT-MMP expression may contribute to the residual processing of the mutant in these cells as the mutant can be processed more fully following MT1-MMP overexpression PCs are overexpressed in various cancers, including lung, breast and skin, with a significant role in tumor progression [40] Moreover, our studies using metalloprotease and PC inhibitors showed PCs to be major enzymes for pro-MMP-2 processing in various tumor cell lines Thus, PC-mediated processing may be a major mechanism for the activation of pro-MMP-2 in PC-overexpressing cells (e.g tumor cell lines), whereas PCs are likely to act alongside MT-MMPs for 6280 B.-H Koo et al pro-MMP-2 activation in cells expressing high levels of MT-MMPs Furin is localized predominantly in the TGN, but some is present at the plasma membrane [21,22,25] This enzyme is also secreted by cells and may be functional in the extracellular space [41,42] However, despite numerous attempts, furin-mediated extracellular processing of pro-MMP-2 could not be detected, leading to the conclusion that furin processing of proMMP-2 is exclusively intracellular This finding contradicts that of Cao et al [35], who reported that furin processing was both intracellular and extracellular, with intracellular processing as the predominant mechanism Unlike furin, secreted PACE4 and PC5A are anchored to the cell surface by heparan sulfate proteoglycan in the extracellular space despite their residence in the TGN [23] Likewise, MMP-2 has an affinity for binding heparin via its hemopexin-like domain and anchors to heparan sulfate proteoglycans [43,44] Therefore, the binding property of heparan sulfate proteoglycans may lead to their co-localization to the cell surface, facilitating the extracellular processing of proMMP-2 However, the inability of extracellular furin to bind heparan sulfate proteoglycans may prevent its co-localization with pro-MMP-2 at the cell surface and its extracellular processing of pro-MMP-2 It is also likely that, once exported from the cell, pro-MMP-2 undergoes a conformational change, thereby hampering furin processing Although cells expressing PACE4 or PC5A exhibit both intracellular and extracellular processing of pro-MMP-2, intracellular processing is likely to be predominant because these PCs are concentrated in the TGN to allow more efficient processing of pro-MMP-2 By contrast with previously published data [35], furin-processed MMP-2 showed enzymatic activity However, when furin-processed MMP-2 was obtained from the conditioned medium of COS-1 cells, its enzymatic activity was much lower than that obtained from HEK293F and MCF-7 cells Several reasons can explain this observation TIMP-2 was highly expressed in COS-1 cells Furthermore, TIMP-2 is a strong inhibitor of MMP-2 at high concentrations [45], although it activates pro-MMP-2 with MT1-MMP at low concentrations [34] Therefore, we propose that the lack of enzymatic activity is a result of the presence of a high concentration of TIMP-2 in the conditioned medium of COS-1 cells This was also supported by our observation that autoproteolytic activation of MT1-MMP-processed MMP-2 was detected marginally in COS-1 cells (Fig 4B) In this study, we found that furin-processed MMP-2 was further processed to its fully activated form, but the detailed mechanism FEBS Journal 276 (2009) 6271–6284 ª 2009 The Authors Journal compilation ª 2009 FEBS B.-H Koo et al Activation of pro-matrix metalloprotease-2 by proprotein convertases remains to be established It is possible that TIMP-2 and integrin avb3 may mediate the full activation of PC-processed MMP-2, as they have been suggested to play a role in the maturation of MT1-MMP-cleaved MMP-2 to its fully active form Other plausible candidates are fibronectin and heparan sulfate proteoglycans, which display an affinity for MMP-2 binding [43,44] MMP-2 can be localized and concentrated at the cell surface via these molecules, which may promote intermolecular autolytic cleavage of PC-processed MMP-2 CATGCGGAAGCCACGCGACTACAAAGACGATGACG ACAAGTGCGGCAACCCAGATGTGGC-3¢ (FLAG encoding site in italics) and the reverse primer 5¢-GCCACATC TGGGTTGCCGCACTTGTCGTCATCGTCTTTGTAGTC GCGTGGCTTCCGCATGGTCT-3¢ (FLAG encoding site in italics) Site-directed mutagenesis was performed toprepare all the mutants used for this study Expression plasmids for PACE4, PC5A and furin were kindly provided by Nabil Seidah (Clinical Research Institute of Montreal, Canada), and the human MT1-MMP expression plasmid was kindly provided by Suneel Apte (Lerner Research Institute, Cleveland, OH, USA) Materials and methods Cell culture, transfection, cell treatments and cell viability assay Reagents Mouse anti-MMP-2 IgG1 (sc-13595) and anti-TIMP-2 IgG2a (sc-21735), as well as rabbit anti-MT1-MMP polyclonal IgG (sc-30074), were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA) Mouse anti-FLAG M1 IgG2b, Con A, type IV collagen, aprotinin, trypsin inhibitor, leupeptin and pepstatin were purchased from Sigma-Aldrich (St Louis, MO, USA) Monoclonal antiintegrin avb3 antibody, GM6001 and human TIMP-2 were purchased from Chemicon (Temecula, CA, USA), and decRVKR-cmk was obtained from Calbiochem (San Diego, CA, USA) Monoclonal anti-furin antibody (MON-148) was purchased from Alexis Biochemicals (San Diego, CA, USA) and purified furin from New England BioLabs (Beverly, MA, USA) The EnzChek Gelatinase ⁄ Collagenase Assay Kit was purchased from Molecular Probes (Eugene, OR, USA) and MTT from Amresco (Solon, OH, USA) Expression plasmids and site-directed mutagenesis blast programs from the National Center for Biotechnology Information were used to search for expressed sequence tags Human testis cDNA (Marathon cDNA, Clontech, Palo Alto, CA, USA) was used as a template to amplify the full-length cDNA for MMP-2 (Accession no NM_004530) Oligonucleotide primers 5¢-GCTACGATG GAGGCGCTAATG GCC-3¢ (start codon in italics) and 5¢-TCAGCAGCCTAGC CAGTCGGATTTG-3¢ (stop codon in italics) were used for PCR with Advantage polymerase (Clontech) The 2-kb PCR product was cloned into TOPO cloning vectors (Invitrogen, Carlsbad, CA, USA) and sequenced completely For the full-length MMP-2 expression plasmid, its open reading frame was digested with EcoRI and then re-cloned into the pcDNA3.1 ⁄ myc-His(–) B vector (Invitrogen) digested with EcoRI For FLAG tag insertion between Arg101 and Cys102 in the propeptide of MMP-2, site-directed mutagenesis (Intron Biotechnology, Seongnam, Kyunggi, South Korea) was performed using the forward primer 5¢-AGAC HEK293F, COS-1, HCT116 (human colorectal carcinoma) (ATCC no CCL-247), MDAH 2774 (human ovarian adenocarcinoma) (ATCC no CRL-10303), NCI-H460 (human lung carcinoma) (ATCC no HTB-177) and HT-1080 (human fibrosarcoma) (ATCC no CCL-121) cells were maintained in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum, and MCF-7 (human breast adenocarcinoma) (ATCC no HTB-22), K-562 (human chronic myelogenous leukemia) (ATCC no CCL-243) and Hep G2 (human hepatocellular carcinoma) (ATCC no HB-8065) cells were maintained in RPMI-1640 medium containing 10% fetal bovine serum Transient transfections with various plasmids were performed using Lipofectamine 2000 according to the manufacturer’s recommendations (Invitrogen) For the analysis of secreted protein, transfected cells were cultured and then changed to 293 SFM-II medium (Invitrogen) For comparison of cell viability of the PC inhibitor-treated cells with control cells, cells were cultured confluently in 96-well plates and further incubated in the presence and absence of dec-RVKR-cmk (100 lm) for h The numbers of viable cells were assessed using the MTT assay Semi-quantitative RT-PCR Total RNA was prepared using an RNeasy Mini Kit (Qiagen, Chatsworth, CA, USA) Five micrograms of mRNA was used for the synthesis of first-strand cDNA employing the Superscript III First-Strand Kit (Invitrogen) One microliter of cDNA was used as template for PCR Primer sets were as follows: for MT1-MMP, forward primer 5¢-CGAAGCCTGGCTACAGCAAT-3¢ and reverse primer 5¢-CTCGTATGTGGCATACTCGC-3¢; for MT2MMP, forward primer 5¢-CCTGGACAACTATCCCA TGC-3¢ and reverse primer 5¢-GCCAGACACTGATGGGC TTG-3¢; for MT3-MMP, forward primer 5¢-GACTGACC CCAGAAT GTCAG-3¢ and reverse primer 5¢-CTGCCAC ACATCAAA GGCAC-3¢; for MT5-MMP, forward primer 5¢-GCCGGG CAGAACTGGTTAAA-3¢ and reverse FEBS Journal 276 (2009) 6271–6284 ª 2009 The Authors Journal compilation ª 2009 FEBS 6281 Activation of pro-matrix metalloprotease-2 by proprotein convertases primer 5¢-CGAAA GCCTGGCGAATAGCT-3¢; for MT6MMP, forward primer 5¢-GGCTGACTCGCTATGGTTA C-3¢ and reverse primer 5¢-GCCATCAGGGCATAGCT CAT-3¢; for glyceraldehyde-3-phosphate dehydrogenase (GAPDH), forward primer 5¢-GAAGCTCACTGGCATG GCCTT-3¢ and reverse primer 5¢-CTCTCTTGCTCAGTG TCCTTGCT-3¢ Flow cytometric analysis and immunofluorescence Prior to the analysis of cell surface MMP-2, cells were fixed with 4% paraformaldehyde for 30 For the analysis of cell surface integrin avb3 and furin, the fixation step was omitted Then, detached cells were incubated with monoclonal antibodies against integrin avb3, furin or MMP-2 at °C for h The cells were washed and further incubated with fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG (Chemicon) for h Flow cytometry was performed on a FACSCalibur (Becton Dickinson, San Jose, CA, USA), and data were analyzed using WinMDI software version 2.8 (The Scripps Research Institute, La Jolla, CA, USA) For immunocytochemical staining, transfected COS-1 cells were fixed and permeabilized with methanol at )20 °C for 10 After incubation with monoclonal antiMMP-2 or anti-FLAG M1 antibody, and subsequently with FITC-conjugated goat anti-mouse antibody, optical images were acquired using an LSM 510 META confocal microscope (Carl Zeiss, Thornwood, NY, USA) ELISA, zymography, cell surface biotinylation and western blotting MMP-2 was quantified in the conditioned medium of transfected cells using an MMP-2 ELISA kit according to the manufacturer’s recommendations (Calbiochem) The conditioned medium and cell lysate were analyzed for proteins with gelatinolytic activity by identification of substrate lysis by 8% SDS–PAGE containing mgỈmL–1 gelatin Gels were washed with 1% Triton X-100 for h and incubated for 14–20 h at 37 °C in 50 mm Tris ⁄ HCl, pH 7.5, containing 20 mm CaCl2 Gels were stained with 0.2% Coomassie Brilliant Blue R-250 in 40% methanol and 10% acetic acid Biotinylation of cells was performed on ice to prevent the labeling of intracellular proteins, according to the manufacturer’s recommendations (Pierce, Rockford, IL, USA) Western blotting was performed using reduced or nonreduced cell lysates on SDS–PAGE, and then electroblotted to poly(vinylidene difluoride), followed by detection of bound antibody using enhanced chemiluminescence (Amersham Biosciences, Pittsburgh, PA, USA) The signal intensity of the relevant bands from western blotting was quantified using ImageJ software (National Institutes of Health, Bethesda, MD, USA) 6282 B.-H Koo et al Protease activity of PCs The protease activities of PCs were assayed using a modified method from a previous report [46] Briefly, samples were incubated with 100 lm pyroglutamyl-Arg-Thr-Lys-Arg4-methylcoumaryl 7-amide (pyr-RTKR-MCA, Peptide Institute, Osaka, Japan), mm CaCl2, 10 lgỈmL–1 each of leupeptin, 4-[(2S,3S)-3-carboxyoxiran-2-ylcarbonyl-l-leucylamido]butylguanidine, bestatin and pepstatin, lgỈmL–1 chymostatin and 30 ngỈmL–1 TIMP-2 in 100 mm Tris ⁄ HCl (pH 7.5) at 37 °C for h The amount of MCA released from the substrate was measured in a fluorescence spectrophotometer with a fluorescence microplate reader set for excitation at 380 nm and emission detection at 460 nm One unit of activity is defined as the amount of furin that can release nmol of MCA from the substrate in mL of enzyme Collagen IV and fluorescein-conjugated gelatin digestion assays Substrates were incubated with conditioned medium containing MMP-2 (5 lgỈmL–1 MMP-2 per reaction) at 37 °C for h (5 lg of collagen IV per reaction) or fluoresceinconjugated gelatin for h according to the manufacturer’s recommendations The digested substrates were analyzed by SDS–PAGE or a fluorescence microplate reader set for excitation at 495 nm and emission detection at 515 nm Statistical analysis Data are the means and standard deviations of n experiments Statistical analysis was performed using an unpaired t-test or ANOVA test A P value of less than 0.05 was considered to be statistically significant Acknowledgements We thank Dr Suneel S Apte (Lerner Research Institute, Cleveland, OH, USA) for helpful discussions and critical reading of the manuscript This work was supported by a Korea Science and Engineering Foundation (KOSEF) grant funded by the South Korean government (MOST; nos ROA-2004-000-10297-0 and 2009-0081759) O.-H Jeon and H.-H Kim are fellowship awardees by the Brain Korea 21 (BK21) program References Somerville RP, Oblander SA & Apte SS (2003) Matrix metalloproteinases: old dogs with new tricks Genome Biol 4, 216 Woessner JF Jr (1994) The family of matrix metalloproteinases Ann NY Acad Sci 732, 11–21 FEBS Journal 276 (2009) 6271–6284 ª 2009 The Authors Journal compilation ª 2009 FEBS B.-H Koo et al Activation of pro-matrix metalloprotease-2 by proprotein convertases Okada Y, Morodomi T, Enghild JJ, Suzuki K, Yasui A, Nakanishi I, Salvesen G & Nagase H (1990) Matrix metalloproteinase from human rheumatoid synovial fibroblasts Purification and activation of the precursor and enzymic properties Eur J Biochem 194, 721–730 Ra HJ & Parks WC (2007) Control of matrix metalloproteinase catalytic activity Matrix Biol 26, 587–596 Bescond A, Augier T, Chareyre C, Garcon D, Hornebeck W & Charpiot P (1999) Influence of homocysteine on matrix metalloproteinase-2: activation and activity Biochem Biophys Res Commun 263, 498–503 Baramova EN, Bajou K, Remacle A, L’Hoir C, Krell HW, Weidle UH, Noel A & Foidart JM (1997) Involvement of PA ⁄ plasmin system in the processing of pro-MMP-9 and in the second step of pro-MMP-2 activation FEBS Lett 405, 157–162 Strongin AY, Collier I, Bannikov G, Marmer BL, Grant GA & Goldberg GI (1995) Mechanism of cell surface activation of 72-kDa type IV collagenase Isolation of the activated form of the membrane metalloprotease J Biol Chem 270, 5331–5338 Morrison CJ, Butler GS, Bigg HF, Roberts CR, Soloway PD & Overall CM (2001) Cellular activation of MMP-2 (gelatinase A) by MT2-MMP occurs via a TIMP-2-independent pathway J Biol Chem 276, 47402–47410 Nakada M, Yamada A, Takino T, Miyamori H, Takahashi T, Yamashita J & Sato H (2001) Suppression of membrane-type matrix metalloproteinase (MMP)-mediated MMP-2 activation and tumor invasion by testican and its splicing variant gene product, N-Tes Cancer Res 61, 8896–8902 10 Pei D (1999) Identification and characterization of the fifth membrane-type matrix metalloproteinase MT5-MMP J Biol Chem 274, 8925–8932 11 Nie J & Pei D (2003) Direct activation of pro-matrix metalloproteinase-2 by leukolysin ⁄ membrane-type matrix metalloproteinase ⁄ matrix metalloproteinase 25 at the asn(109)–Tyr bond Cancer Res 63, 6758–6762 12 Lafleur MA, Hollenberg MD, Atkinson SJ, Knauper V, Murphy G & Edwards DR (2001) Activation of pro(matrix metalloproteinase-2) (pro-MMP-2) by thrombin is membrane-type-MMP-dependent in human umbilical vein endothelial cells and generates a distinct 63 kDa active species Biochem J 357, 107–115 13 Caterina JJ, Yamada S, Caterina NC, Longenecker G, Holmback K, Shi J, Yermovsky AE, Engler JA & Birkedal-Hansen H (2000) Inactivating mutation of the mouse tissue inhibitor of metalloproteinases-2 (Timp-2) gene alters proMMP-2 activation J Biol Chem 275, 26416–26422 14 Hernandez-Barrantes S, Toth M, Bernardo MM, Yurkova M, Gervasi DC, Raz Y, Sang QA & Fridman R (2000) Binding of active (57 kDa) membrane type 15 16 17 18 19 20 21 22 23 24 25 26 1-matrix metalloproteinase (MT1-MMP) to tissue inhibitor of metalloproteinase (TIMP)-2 regulates MT1MMP processing and pro-MMP-2 activation J Biol Chem 275, 12080–12089 Wang Z, Juttermann R & Soloway PD (2000) TIMP-2 is required for efficient activation of proMMP-2 in vivo J Biol Chem 275, 26411–26415 Ruangpanit N, Price JT, Holmbeck K, Birkedal-Hansen H, Guenzler V, Huang X, Chan D, Bateman JF & Thompson EW (2002) MT1-MMP-dependent and -independent regulation of gelatinase A activation in long-term, ascorbate-treated fibroblast cultures: regulation by fibrillar collagen Exp Cell Res 272, 109–118 Oblander SA, Zhou Z, Galvez BG, Starcher B, Shannon JM, Durbeej M, Arroyo AG, Tryggvason K & Apte SS (2005) Distinctive functions of membrane type matrix-metalloprotease (MT1-MMP or MMP14) in lung and submandibular gland development are independent of its role in pro-MMP-2 activation Dev Biol 277, 255–269 Bergeron F, Leduc R & Day R (2000) Subtilase-like pro-protein convertases: from molecular specificity to therapeutic applications J Mol Endocrinol 24, 1–22 Nakayama K (1997) Furin: a mammalian subtilisin ⁄ Kex2p-like endoprotease involved in processing of a wide variety of precursor proteins Biochem J 327 (Pt 3), 625–635 Thomas G (2002) Furin at the cutting edge: from protein traffic to embryogenesis and disease Nat Rev Mol Cell Biol 3, 753–766 Mayer G, Boileau G & Bendayan M (2003) Furin interacts with proMT1-MMP and integrin alphaV at specialized domains of renal cell plasma membrane J Cell Sci 116, 1763–1773 Mayer G, Boileau G & Bendayan M (2004) Sorting of furin in polarized epithelial and endothelial cells: expression beyond the Golgi apparatus J Histochem Cytochem 52, 567–579 Tsuji A, Sakurai K, Kiyokage E, Yamazaki T, Koide S, Toida K, Ishimura K & Matsuda Y (2003) Secretory proprotein convertases PACE4 and PC6A are heparinbinding proteins which are localized in the extracellular matrix Potential role of PACE4 in the activation of proproteins in the extracellular matrix Biochim Biophys Acta 1645, 95–104 Seidah NG & Prat A (2002) Precursor convertases in the secretory pathway, cytosol and extracellular milieu Essays Biochem 38, 79–94 Koo BH, Longpre JM, Somerville RP, Alexander JP, Leduc R & Apte SS (2006) Cell-surface processing of pro-ADAMTS9 by furin J Biol Chem 281, 12485– 12494 Zheng M, Streck RD, Scott RE, Seidah NG & Pintar JE (1994) The developmental expression in rat of proteases furin, PC1, PC2, and carboxypeptidase E: implica- FEBS Journal 276 (2009) 6271–6284 ª 2009 The Authors Journal compilation ª 2009 FEBS 6283 Activation of pro-matrix metalloprotease-2 by proprotein convertases 27 28 29 30 31 32 33 34 35 36 37 tions for early maturation of proteolytic processing capacity J Neurosci 14, 4656–4673 Roebroek AJ, Umans L, Pauli IG, Robertson EJ, Van LF, Van DV & Constam DB (1998) Failure of ventral closure and axial rotation in embryos lacking the proprotein convertase furin Development 125, 4863–4876 Khatib AM, Siegfried G, Chretien M, Metrakos P & Seidah NG (2002) Proprotein convertases in tumor progression and malignancy: novel targets in cancer therapy Am J Pathol 160, 1921–1935 Gilles C, Polette M, Piette J, Munaut C, Thompson EW, Birembaut P & Foidart JM (1996) High level of MT-MMP expression is associated with invasiveness of cervical cancer cells Int J Cancer 65, 209–213 Ellerbroek SM, Fishman DA, Kearns AS, Bafetti LM & Stack MS (1999) Ovarian carcinoma regulation of matrix metalloproteinase-2 and membrane type matrix metalloproteinase through beta1 integrin Cancer Res 59, 1635–1641 Hotary K, Allen E, Punturieri A, Yana I & Weiss SJ (2000) Regulation of cell invasion and morphogenesis in a three-dimensional type I collagen matrix by membrane-type matrix metalloproteinases 1, 2, and J Cell Biol 149, 1309–1323 Deryugina EI, Ratnikov B, Monosov E, Postnova TI, DiScipio R, Smith JW & Strongin AY (2001) MT1MMP initiates activation of pro-MMP-2 and integrin alphavbeta3 promotes maturation of MMP-2 in breast carcinoma cells Exp Cell Res 263, 209–223 Will H, Atkinson SJ, Butler GS, Smith B & Murphy G (1996) The soluble catalytic domain of membrane type matrix metalloproteinase cleaves the propeptide of progelatinase A and initiates autoproteolytic activation Regulation by TIMP-2 and TIMP-3 J Biol Chem 271, 17119–17123 Cao J, Rehemtulla A, Bahou W & Zucker S (1996) Membrane type matrix metalloproteinase activates pro-gelatinase A without furin cleavage of the N-terminal domain J Biol Chem 271, 30174–30180 Cao J, Rehemtulla A, Pavlaki M, Kozarekar P & Chiarelli C (2005) Furin directly cleaves proMMP-2 in the trans-Golgi network resulting in a nonfunctioning proteinase J Biol Chem 280, 10974–10980 Strongin AY, Marmer BL, Grant GA & Goldberg GI (1993) Plasma membrane-dependent activation of the 72-kDa type IV collagenase is prevented by complex formation with TIMP-2 J Biol Chem 268, 14033–14039 Shamamian P, Schwartz JD, Pocock BJ, Monea S, Whiting D, Marcus SG & Mignatti P (2001) Activation 6284 38 39 40 41 42 43 44 45 46 B.-H Koo et al of progelatinase A (MMP-2) by neutrophil elastase, cathepsin G, and proteinase-3: a role for inflammatory cells in tumor invasion and angiogenesis J Cell Physiol 189, 197–206 Sorsa T, Salo T, Koivunen E, Tyynela J, Konttinen YT, Bergmann U, Tuuttila A, Niemi E, Teronen O, Heikkila P et al (1997) Activation of type IV procollagenases by human tumor-associated trypsin-2 J Biol Chem 272, 21067–21074 Rauch BH, Bretschneider E, Braun M & Schror K (2002) Factor Xa releases matrix metalloproteinase-2 (MMP-2) from human vascular smooth muscle cells and stimulates the conversion of pro-MMP-2 to MMP2: role of MMP-2 in factor Xa-induced DNA synthesis and matrix invasion Circ Res 90, 1122–1127 Bassi DE, Mahloogi H & Klein-Szanto AJ (2000) The proprotein convertases furin and PACE4 play a significant role in tumor progression Mol Carcinog 28, 63–69 Tsuneoka M, Nakayama K, Hatsuzawa K, Komada M, Kitamura N & Mekada E (1993) Evidence for involvement of furin in cleavage and activation of diphtheria toxin J Biol Chem 268, 26461–26465 Thimon V, Belghazi M, Dacheux JL & Gatti JL (2006) Analysis of furin ectodomain shedding in epididymal fluid of mammals: demonstration that shedding of furin occurs in vivo Reproduction 132, 899–908 Wallon UM & Overall CM (1997) The hemopexin-like domain (C domain) of human gelatinase A (matrix metalloproteinase-2) requires Ca2 + for fibronectin and heparin binding Binding properties of recombinant gelatinase A C domain to extracellular matrix and basement membrane components J Biol Chem 272, 7473–7481 Yu WH & Woessner JF Jr (2000) Heparan sulfate proteoglycans as extracellular docking molecules for matrilysin (matrix metalloproteinase 7) J Biol Chem 275, 4183–4191 Cao J, Sato H, Takino T & Seiki M (1995) The C-terminal region of membrane type matrix metalloproteinase is a functional transmembrane domain required for pro-gelatinase A activation J Biol Chem 270, 801–805 Tsuji A, Hashimoto E, Ikoma T, Taniguchi T, Mori K, Nagahama M & Matsuda Y (1999) Inactivation of proprotein convertase, PACE4, by alpha1-antitrypsin Portland (alpha1-PDX), a blocker of proteolytic activation of bone morphogenetic protein during embryogenesis: evidence that PACE4 is able to form an SDS-stable acyl intermediate with alpha1-PDX J Biochem 126, 591–603 FEBS Journal 276 (2009) 6271–6284 ª 2009 The Authors Journal compilation ª 2009 FEBS ... B.-H Koo et al Activation of pro -matrix metalloprotease-2 by proprotein convertases A A B B Fig Regulation of excessive PC processing of pro-MMP-2 by Pro100 residue (A) PC processing of pro-MMP-2... FEBS B.-H Koo et al Activation of pro -matrix metalloprotease-2 by proprotein convertases A C B Fig Cellular location of PC processing of pro-MMP-2 (A) Protease activities of PCs in conditioned... FEBS 6275 Activation of pro -matrix metalloprotease-2 by proprotein convertases A C B Fig PC-dependent processing of pro-MMP-2 (A) Effect of various inhibitors on the propeptide processing of MMP-2