The role of Tyr71 in Streptomyces trypsin on the recognition mechanism of structural protein substrates Yoshiko Uesugi*, Hirokazu Usuki, Masaki Iwabuchi and Tadashi Hatanaka Research Institute for Biological Sciences, Okayama, Japan Introduction Serine proteases play key roles in physiological and cellular functions, including protein processing, tissue remodelling, immunity, cell differentiation and blood clotting [1]. Serine proteases of clans SA (chymotryp- sin-like) [2], SB (subtilisin-like) [3] and SC (a ⁄ b-hydro- lase fold) [4] maintain a strictly conserved catalytic site geometry comprising serine, histidine and aspartic acid residues. They catalyse peptide bond hydrolysis, which generally proceeds in a three-step mechanism: the formation of an enzyme–substrate complex; acyla- tion of the active site serine; and hydrolysis of the acyl-enzyme intermediate [5]. Substrate recognition, especially the specificity at the S1 site, has been studied extensively. The specificity at this site in the chymotrypsin-like serine proteases has been explained using the structure of the S1 pocket, which comprises three b-sheets (residues 189–192, 214–216 and 224–228) and the oxyanion-binding site Keywords collagenolytic enzyme; repeat-length independent and broad spectrum (RIBS) in vivo DNA shuffling; serine protease; Streptomyces; topological specificity Correspondence T. Hatanaka, Research Institute for Biological Sciences, Okayama, 7549-1 Kibichuo-cho, Kaga-gun, Okayama 716-1241, Japan Fax: +81 866 56 9454 Tel: +81 866 56 9452 E-mail: hatanaka@bio-ribs.com *Present address Department of Biomaterials, Field of Tissue Engineering, Institute for Frontier Medical Sciences, Kyoto University, Japan (Received 7 April 2009, revised 26 July 2009, accepted 4 August 2009) doi:10.1111/j.1742-4658.2009.07256.x Studies of substrate recognition by serine proteases have focused on speci- ficities at the primary S1–Sn sites, but topological specificities (i.e. recogni- tion at distinct three-dimensional structural motifs) have not been established. This is the first report to identify the key amino acid residue conferring topological specificity. A serine protease from Streptomyces omi- yaensis (SOT), which is a trypsin-like enzyme, was chosen as a model enzyme to clarify the recognition mechanism of structural protein sub- strates in serine proteases. We have found previously that the topological specificities of SOT and S. griseus trypsin (SGT) for high molecular mass substrates differ greatly, even though the enzymes have similar primary structures. In this study, we constructed chimeras between SOT and SGT using an in vivo DNA shuffling system and several mutants to identify the key residues involved in topological specificities. By comparing the sub- strate specificities of chimeras and mutants, we found that residue 71 of SOT, which is separate from the catalytic triad, contributes to the topologi- cal specificity. Using site-directed mutagenesis, residue 71 of SOT was also found to be crucial for catalytic efficiency and enzyme conformation. Abbreviations ADAMTS, a disintegrin and metalloproteinase with thrombospondin motifs; ANS, 1-anilinonaphthalene-8-sulfonic acid; CBD, collagen-binding domain; FITC, fluorescein isothiocyanate; LB, Luria–Bertani; MMP, mammalian matrix metalloprotease; RIBS, repeat-length independent and broad spectrum; SGT, Streptomyces griseus trypsin; SOT, Streptomyces omiyaensis serine protease; Z-Gly-Pro-Arg-MCA, benzyloxycarbonylglycyl- L-prolyl-L-arginine-4-methylcoumaryl-7-amide. 5634 FEBS Journal 276 (2009) 5634–5646 ª 2009 The Authors Journal compilation ª 2009 FEBS (Gly193 and Ser195) in the C-terminal b-barrel domain. Specificity is usually determined by the resi- dues at positions 189, 216 and 226 [6,7]. For example, the combination of Ser189, Gly216 and Gly226 creates a deep hydrophobic pocket in the chymotrypsin enzyme that accounts for S1 specificity. Furthermore, Asp189, Gly216 and Gly226 create a negatively charged S1 site that confers specificity of trypsin for substrates containing arginine or lysine at the P1 posi- tion [8,9]. Surface loops 1, 2 and 3 (residues 184–195, 213–228 and 169–175, respectively) are also important for substrate specificity. The specificities of S2–Sn sites have also been investigated using elastase [10]. How- ever, the mechanism by which serine proteases recog- nize the structure of protein substrates is not known. Various structural features govern interactions between protease and substrate, and therefore insight into the mechanism is necessary to explain substrate recogni- tion. Data on the topological specificities are available only for the metalloproteinase ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) and the mammalian matrix metalloproteases (MMP), which were obtained using triple-helical and single- stranded fluorogenic substrates [11]. Recently, serine protease-catalysed degradation of recalcitrant animal proteins, such as collagen [12,13], keratin [14], those involved in blood clotting [15,16] and amyloid prion proteins [17], has been of interest because of potential industrial waste and medical applications. We therefore selected collagens as ‘hard- to-degrade’ substrates for our study of how serine pro- teases recognize protein substrate structure. At least 25 different types of collagen have been identified [18]. For example, collagen types I, II, III, V and IX are classical fibrillar collagens, whereas collagen type IV forms sheet-like networks [19]. Collagen degradation products have biological activities of industrial and medical interest. In addition, from the screening of 2000 soil isolates, we obtained a serine protease from Streptomyces omiyaensis (SOT) with high collagenolyt- ic activity [12]. SOT belongs to the trypsin family and the peptidase family S1 (subfamily S1A). The primary structure of SOT is 77% identical to that of the trypsin from Streptomyces griseus (SGT, EC 3.4.21.4) [20–22], but the topological specificity of the former differs sub- stantially from that of the latter. Therefore, we used SOT as a model for enzymes that hydrolyse hard- to-degrade proteins in order to clarify how serine proteases recognize structural protein substrates. For the identification of the amino acid residues conferring topological specificity of our model serine protease, we first constructed chimeras of SOT with SGT using repeat-length independent and broad spec- trum (RIBS) in vivo DNA shuffling [23], and com- pared their substrate specificities. Using type I and type IV collagens as typical protein substrates with different structures, we identified a key residue on the substrate recognition site that conferred specificity for the substrates. Results and Discussion Construction of chimeras using RIBS in vivo DNA shuffling In a previous study, we demonstrated that SOT had wide substrate specificity for types I and IV collagens, gelatin and casein, whereas SGT only showed high substrate specificity towards type I collagen [12]. To investigate which domain confers the different topolog- ical specificities, we constructed a chimeric gene library between SOT and SGT using RIBS in vivo DNA shuf- fling (Fig. 1A). This system is a method of random chimeragenesis based on the combination of highly fre- quent deletion formation in the Escherichia coli ssb-3 strain with an rpsL-based chimera selection system. We have demonstrated previously the substrate recog- nition mechanism in Streptomyces phospholipase D using this system [23–25]. We obtained various chimeras with recombination sites widely distributed over the entire chimeric gene. The DNA sequences of the parental sot gene and the trypsin gene (sprT) encoding SGT (in S. griseus NBRC 13350) [21] are 82% identical. Therefore, these genes are suitable for chimeragenesis using the RIBS in vivo DNA shuffling system. We chose eight typical chime- ras, as presented in Fig. 1B, for gene expression and protein purification. The purified chimeras appeared as a single band on SDS-PAGE, and the molecular mass (approximately 23 kDa) was similar to that of SOT and SGT (data not shown). Comparison of substrate specificities for chimeras towards protein substrates The substrate specificities of eight chimeras were evalu- ated using fluorogenic bovine skin collagen type I and human placenta collagen type IV as substrates, and these were compared with those of parental SOT and SGT (Fig. 2). In a previous study, we showed that the hydrolytic activities of SOT and SGT towards fluores- cein-labelled collagens agreed well with those towards native collagens [12]. Figure 2A, B shows that the spe- cific activities of chimeras A and B towards type I and IV collagens resemble those of SGT. Chimeras A and B show much lower activities towards type IV collagen Y. Uesugi et al. Substrate recognition mechanism of Streptomyces trypsin FEBS Journal 276 (2009) 5634–5646 ª 2009 The Authors Journal compilation ª 2009 FEBS 5635 than do other chimeras or SOT. Interestingly, the hydrolytic activity of chimera F towards both types of collagen was the highest among the chimeras and higher than that of parental SOT and SGT. These spe- cific activities were used to calculate the ratio of the hydrolytic activity towards type IV collagen relative to that towards type I collagen (collagen IV⁄ I) (Fig. 2C). The ratios of chimeras C–H were comparable with that of SOT. They were, however, significantly different from those of chimeras A, B and SGT. These results suggest that the region between chimeras B and C (corresponding to residues 52–72 of SOT) confers sub- strate specificity. Therefore, we examined this region further. Identification of amino acid residue(s) related to topological specificity Chimera B differed from chimera C in five amino acid residues (Fig. 3A). Therefore, we constructed four chimera B mutants (B-1 to B-4, the primary sequence of which is presented in Fig. 3A) and evaluated their speci- ficities towards two collagen types. For type I collagen, the specific activity of the chimera B mutant increased as substituted residues accumulated (Fig. 3B). In con- trast, the specific activity of the chimera B mutant towards type IV collagen changed considerably between B-3 and B-4 (Fig. 3C). These results were reflected in collagen IV ⁄ I (Fig. 3D). Figure 3A shows that chimeras A P T7 -lac pACTI2b (sot/Gm r rpsL + /sprT) lacl q Cm r E. coli MK1019 ssb-3 Transformation RpsL(Sm r ) RpsL(Sm s ) RpsL(Sm r ) sot sprT Gm r rpsL + P T7 -lac P T7 -lac Cm r Cm r Gm r lacl q lacl q sot sprT rpsL+ SGT 223 aa in vivo DNA shuffling Chimeric genes SOT Chimera A Chimera B Chimera C Chimera D Chimera E Chimera F Chimera G Chimera H 223 aa 223 aa 0 50 100 150 200 B AB CD E 111213141 51 61 71 81 91 E FG H 101 111 121 131 141 151 161 170 180 190 200 220210 Fig. 1. Random chimeragenesis between sot and sprT genes by RIBS in vivo DNA shuffling. The random chimeragenesis strat- egy (A) is detailed in ref. 23. For construc- tion of the shuffling vector, two homologous genes (sot and sprT) were placed in the same direction, and a cassette containing the Gm r and E. coli rpsL + genes was inserted between them. rpsL + encodes the ribosomal protein S12 [23], the target of Sm. The transformation of E. coli MK1019 [ssb-3 rpsL(Sm r )] with pACTI2b (sot ⁄ Gm r - rpsL + ⁄ sprT) altered the phenotype of cells from Sm r to Sm s (and also Gm s to Gm r ) because the Sm s ribosome was reconsti- tuted with the wild-type RpsL protein encoded by the plasmid. The Gm r -rpsL + cassette is simultaneously deleted from the plasmid and the cells reverse their pheno- type from Sm s ⁄ Gm r to Sm r ⁄ Gm s when recombination occurs between two homolo- gous genes. Consequently, the intact form of the chimeric gene is selectable by Sm and Cm without expression. The primary structures of SGT, SOT and the eight chime- ras used in this study are illustrated sche- matically. The recombination sites of chimeras A–H are shown in (B). The primary structures of SOT (upper) and SGT (lower) are shown. The recombination sites of the chimeras are boxed. The names of the chi- meras are indicated in bold capital letters. The catalytic residues are indicated in red. Substrate recognition mechanism of Streptomyces trypsin Y. Uesugi et al. 5636 FEBS Journal 276 (2009) 5634–5646 ª 2009 The Authors Journal compilation ª 2009 FEBS B-3 and B-4 differed in only one amino acid residue: res- idue 71. From these results, we inferred that Tyr71 of SOT (corresponding to residue 89 of a-chymotrypsin numbering) is a key amino acid residue conferring sub- strate specificity. To visualize the location of Tyr71 in SOT, an overall structure of SOT was constructed based on the crystal structure of SGT [22]. Interestingly, the residue is located in the b-sheet separate from the cata- lytic triad of His37, Asp82 and Ser172 (corresponding to residues 57, 102 and 195 of a-chymotrypsin number- ing; Fig. 3E). Effect of mutations on substrate specificity Next, we tried to prepare 11 SGT mutants and an SOT mutant, in which residue 71 was substituted for other amino acids, to investigate the role of Tyr71 of SOT in topological specificity. We obtained mutants as active forms, except for an SGT mutant with proline substituted for Leu71 (SGT-L71P). Figure S1 shows SDS-PAGE data from several culture supernatants of SGT mutants. Unlike other mutants, the band at the molecular mass of SGT-L71P was hardly observed, but many other bands were seen. In addition, the cul- ture supernatant had no activity. In the case of inac- tive SOT and SGT, in which Ser172 of the catalytic triad was substituted with alanine, many high molecu- lar mass bands were observed (data not shown), although these bands were not observed in active forms. It is probable that correctly folded mutants could hydrolyse these high molecular mass proteins. For SGT-L71P, low molecular mass bands were also observed at positions different from the case of active mutants. We speculate that SGT-L71P, which was not folded correctly, was presumably hydrolyzed by other proteases in the culture. These results suggest that residue 71 also affects the folding of SGT. Five purified SGT mutants (substitution of Leu71 with tyrosine, phenylalanine, tryptophan, alanine or histidine) showed higher activity towards type IV colla- gen than did wild-type SGT (Fig. 4B, left). In parti- cular, the collagen IV ⁄ I values of SGT-L71Y and SGT-L71H were twice as high as that of SGT (Fig. 4C, left). Furthermore, mutant SOT-Y71L showed significantly lower specific activity towards type IV collagen than did wild-type SOT, although SOT-Y71L showed high activity towards type I colla- gen, similar to SOT (Fig. 4A, B, right). From these results, it is interesting to note that the substitution with hydrophobic or bulky amino acids in wild-type SGT imparts a significant change in specific activity towards type IV collagen. We further evaluated the effect of mutations on the specificities for native type I collagen substrates from bovine Achilles’ tendon and type IV collagen from human placenta (Fig. 5). The activities of SGT- L71Y (which showed the greatest change in substrate 150 200 250 Collagen type I A 0 50 100 SGT A B C D E F G H SOT Specific activity (U·mg –1 ) SGT A B C D E F G H SOT Specific activity (U·mg –1 ) B 40 60 80 100 120 Collagen type IV 0 20 SGT A B C D E F G H SOT Collagen IV/I 0.4 0.5 0.6 Type IV/I C 0 0.1 0.2 0.3 Fig. 2. Comparison of the specific activities for chimeras A–H, parental SGT and SOT towards different fluorescein-conjugated substrates. The reactions were performed using bovine skin DQ- collagen type I (A) and human placenta DQ-collagen type IV (B) in 50 m M Tris ⁄ HCl (pH 8.0) containing 10 mM CaCl 2 at 37 °C. Enzyme activity was measured by monitoring the fluorescence (FITC) release (excitation, 395 nm; emission, 415 nm). The data are expressed as the means ± SD of three independent experiments. (C) Ratio of the hydrolytic activity towards type IV collagen to that towards type I collagen. Y. Uesugi et al. Substrate recognition mechanism of Streptomyces trypsin FEBS Journal 276 (2009) 5634–5646 ª 2009 The Authors Journal compilation ª 2009 FEBS 5637 specificity among the SGT mutants), SOT-Y71L, wild-type SOT and SGT were compared. The colla- genolytic activity of SGT-L71Y for type IV collagen was 3.3-fold higher than that of SGT (Fig. 5B), although the activity of SGT-L71Y towards type I collagen was somewhat lower than that of SGT (Fig. 5A). In contrast, SOT-Y71L and SOT hydroly- zed type I collagen similarly, but the activity of the former towards type IV collagen was 2.2-fold lower than that of the latter. As shown in Fig. 5C, collagen IV ⁄ I of SGT-L71Y was 4.8-fold higher than that of SGT, whereas it was lower for SOT-Y71L than SOT. These results showed good agreement with those obtained using fluorescein-labelled collagens. There- fore, we conclude that Tyr71 of SOT confers topo- logical specificity. The ability of the mutation to hydrolyze the collagen mimic substrate was determined using benzyloxycarbon- ylglycyl-l-prolyl-l-arginine-4-methylcoumaryl-7-amide (Z-Gly-Pro-Arg-MCA), which is frequently employed as a substrate in studies of the collagenolytic cysteine proteinase, cathepsin K [26,27]. The specific activity was 1.4-fold higher in SGT-L71Y (90.3 lmolÆmin )1 Æmg )1 ) than SGT (66.1 lmolÆmin )1 Æmg )1 ), and 2.6-fold lower in SOT-Y71L (190.2 lmolÆmin )1 Æmg )1 ) than SOT (501.5 lmolÆmin )1 Æmg )1 ). For this short peptide sub- strate, substitution of residue 71 has little effect, unlike the response seen with the structural protein substrates. The k cat value of SGT-L71Y (51.3 s )1 ) was 1.6-fold higher than that of SGT (33.0 s )1 ), although their K m values were equivalent (Table 1). Conversely, both K m and k cat values of SOT-Y71L were approximately three-fold higher than those of SOT, resulting in a dra- matic decrease in the catalytic efficiency (k cat ⁄ K m value) of SOT-Y71L. The value was lower than that of SOT by one order of magnitude. These results suggest D82 Y71 S172 H37 A B C B 52 G GVVDLQSSSAV KVRSTKVLQ 72 B-1 A GVVDLQSSSAV KVRSTKVLQ B-2 A GVVDLQSSSA I KVRSTKVLQ Amino acid sequence B-3 A GVVDLQSSSA I KVRSTK ILQ B-4 A GVVDLQSSSA I KVRSTK IYQ C A GVVDLQSSSA I KVRSTK IYR D E Collagen IV/I 0.2 0.3 0.4 Type IV/I 0 0.1 B B-1 B-2 B-3 B-4 C 120 140 Collagen type I 0 20 40 60 80 100 Specific activity (U·mg –1 ) B B-1 B-2 B-3 B-4 C 50 60 Collagen type IV Specific activity (U·mg –1 ) 0 10 20 30 40 B B-1 B-2 B-3 B-4 C Fig. 3. Identification of an amino acid residue related to topological specificity. Primary structures of chimera B and C mutants (A) and their specific activities towards DQ-collagen type I (B) and DQ-col- lagen type IV (C). These activities were measured in 50 m M Tris ⁄ HCl (pH 8.0) con- taining 10 m M CaCl 2 at 37 °C. The data are expressed as the mean ± SD of three inde- pendent experiments. (D) The ratio of the hydrolytic activity towards type IV collagen to that towards type I collagen. (E) The key residue (Tyr71 of SOT) for the overall structure of SOT is represented using the Swiss-pdb viewer based on the SGT crystal structure. Tyr71 is indicated in pink with the residues in an active site. Substrate recognition mechanism of Streptomyces trypsin Y. Uesugi et al. 5638 FEBS Journal 276 (2009) 5634–5646 ª 2009 The Authors Journal compilation ª 2009 FEBS that residue 71 affects both topological specificity and catalytic efficiency significantly. Conformational change of SOT and SGT induced by the substitution of residue 71 We measured the CD and fluorescence spectra of SGT-L71Y, SOT-Y71L, SOT and SGT to investigate the effect of the mutation at residue 71 on the tertiary and secondary structures of SOT and SGT. Figure 6A shows that the CD spectra of SOT-Y71L and SGT- L71Y were drastically different from those of wild-type SOT and SGT. The spectra of the tryptophan fluores- cence emissions of the wild-type and mutants were also dramatically different (Fig. 6B, C). SOT and SGT have five and four tryptophan residues, respectively, that contributed to their fluorescence emission spectra. Figure 6B, C shows that the emission maximum, A B 60 80 100 120 100 150 200 Collagen type I SGT-L71X 0 20 40 SGT Y F W A G R H D N S Specific activity (U·mg –1 ) Specific activity (U·mg –1 ) 0 50 SOT- Y71L SOT C SGT-L71X SGT Y F W A G R H D N S Specific activity (U·mg –1 ) Specific activity (U·mg –1 ) 30 100 Collagen type IV 10 20 20 40 60 80 0 0 SOT- Y71L SOT SGT-L71X SGT Y F W A G R H D N S Collagen IV/I Collagen IV/I 0.2 0.3 0.4 0.3 0.5 0.6 Type IV/I 0 0.1 0 0.1 0.2 SOT- Y71L SOT Fig. 4. Effects of mutations on topological specificity. Specific activities of SGT-L71X mutants (left) and SOT-Y71L (right) towards DQ-collagen type I (A) and DQ-collagen type IV (B) were measured in 50 m M Tris ⁄ HCl (pH 8.0) containing 10 m M CaCl 2 at 37 °C. The data are expressed as the mean ± SD of three independent experiments. (C) The ratio of hydrolytic activity towards type IV collagen to that towards type I collagen. Y. Uesugi et al. Substrate recognition mechanism of Streptomyces trypsin FEBS Journal 276 (2009) 5634–5646 ª 2009 The Authors Journal compilation ª 2009 FEBS 5639 around 330 nm, was the same for all enzymes. SOT-Y71L showed an extremely low fluorescence emission intensity compared with that of wild-type SOT. In contrast, SGT-L71Y showed a higher fluores- cence emission intensity than did wild-type SGT. Moreover, the CD and fluorescence spectra of SGT- L71F resembled those of SGT-L71Y, and the fluores- cence spectrum of SGT-L71S resembled that of SGT (data not shown). The measurements were performed under the same pH conditions for the above assays (pH 8; optimum pH of SOT and SGT). Of course, the autolysates of the mutants were not observed on SDS- PAGE. Furthermore, we confirmed that these confor- mational changes were not caused by the disruption of the enzyme form using the hydrophobic fluorescence probe 1-anilinonaphthalene-8-sulfonic acid (ANS) (Fig. S2). The fluorescence of ANS increases substan- tially when the hydrophobic core regions of proteins, which are inaccessible to the dye in the native struc- ture, are exposed. The respective fluorescence intensi- ties of ANS with SOT, SGT and their mutants were similar to those without the enzymes, suggesting that the substitution of residue 71 induced conformational changes in the secondary and tertiary structures of wild-type SOT and SGT without disruption of the enzyme form. From these results, we consider that the conformational changes induced by the substitution of residue 71 affect the topological specificity. New insights into substrate recognition The reaction mechanism within the catalytic triad and the specificities of the S1–Sn sites of chymotrypsin-like serine protease have been studied extensively [5–9]. However, the recognition mechanism for structural protein substrates remains unclear. Studies of cathepsin K showed that its unique collagenolytic activity among cathepsins is caused by a preference for arginine and lysine at the P1 position and proline and glycine at the P2 and P3 positions [28]; neither of these residues, espe- cially proline, is preferred by other human cathepsins. Previously, we have studied the residue preferences in SOT and SGT using fluorescence energy transfer A Collagen type I 3000 4000 5000 0 1000 2000 SGT SGT-L71Y SOT-Y71L SOT Specifc activity (U·mg –1 ) B Collagen type IV 30 000 SGT SGT-L71Y SOT-Y71L SOT Specifc activity (U·mg –1 ) 5000 10 000 15 000 20 000 25 000 0 SGT SGT-L71Y SOT-Y71L SOT Collagen IV/I C Type IV/I 4 5 6 7 0 1 2 3 Fig. 5. Hydrolytic activities of SOT, SGT and their mutants towards native collagens. Collagenolytic activity was determined by the fol- lowing method. After preincubation of 2 mg of insoluble type I colla- gen from bovine Achilles’ tendon (A) or type IV collagen from human placenta (B) in 50 m M Tris ⁄ HCl (pH 8.0) containing 10 mM CaCl 2 , enzyme was added and incubated at 37 °C for 30–60 min. Next, the reaction was terminated by the addition of 1 lL of 0.2 M HCl; the rate of increase in free amino groups was measured using the ninhy- drin method. Clostridium histolyticum collagenase type I was also estimated as a reference enzyme. One collagen digestion unit liber- ates peptides from collagen by collagenase type I equivalent in nin- hydrin colour to 1.0 l mol of leucine in 5 h at pH 7.4 at 37 °C in the presence of CaCl 2 . Data are expressed as the mean ± SD of three independent experiments. (C) The ratio of hydrolytic activity towards type IV collagen to that towards type I collagen. Table 1. Kinetic parameters for the hydrolysis of a short peptide substrate by SOT, SGT and their mutants. K m (lM) k cat (s )1 ) k cat ⁄ K m (lM )1 Æs )1 ) SGT 17.7 ± 0.6 33.0 ± 4.1 1.9 SGT-L71Y 17.2 ± 5.7 51.3 ± 7.8 3.2 SOT-Y71L 17.5 ± 2.9 93.0 ± 17.1 5.4 SOT 6.1 ± 1.9 279.5 ± 12.1 49.7 The assay was carried out using 0.03–0.5 m M Z-Gly-Pro-Arg-MCA in 50 m M Tris ⁄ HCl (pH 8.0) containing 10 mM CaCl 2 at 37 °C. The data are expressed as the mean ± SD of three independent experi- ments. Substrate recognition mechanism of Streptomyces trypsin Y. Uesugi et al. 5640 FEBS Journal 276 (2009) 5634–5646 ª 2009 The Authors Journal compilation ª 2009 FEBS substrate (FRETS) combinatorial libraries [29–31], which consist of a total of 475 peptide substrates. In contrast with other studies, we found that the P1, P2 and P3 preferences of SOT resembled those of SGT. However, they showed significantly different specifici- ties towards structural protein substrates [12]. There- fore, the other regions, distinct S1, S2 and S3 sites, are presumed to confer topological specificity. Our previous study showed that the N-terminal region of SOT included a key residue that conferred topological speci- ficity [12]. We now expand these findings using RIBS in vivo DNA shuffling to show that Tyr71 of SOT (cor- responding to residue 89 of a-chymotrypsin numbering) contributes to the topological specificity. This finding has not been inferred from structural information. The crystal structure of SGT consists of 15 b-sheets and two a-helices [22] (Fig. 7A). SGT is divisible into two domains formed by six antiparallel b-sheets with a similar topology. The catalytic triad lies in the cleft between the two domains. Figure 7A shows that resi- due 71 in the b-sheet of the N-terminal b-barrel domain is located adjacent to Trp83, approximately at 3A ˚ (corresponding to residue 103 of a-chymotrypsin numbering). Therefore, we speculate that the substitu- tion of residue 71 affects the interaction between this residue and Trp83, and subsequently causes a change in the local environment around catalytic Asp82. This hypothesis is supported by the dramatic change in cat- alytic efficiency of SOT and SGT when carrying a mutation at residue 71 (Table 1). Compared with other serine proteases for the struc- ture, the positional relationship between residue 71 and the catalytic triad in SOT almost resembles that in bovine trypsin (PDB ID: 1k1n) [32] and a-chymotryp- sin (PDB ID: 5cha) [33]. Ile89 and Phe89 in bovine trypsin and a-chymotrypsin, respectively, correspond to Tyr71 of SOT. Residue 89 in these enzymes is situ- ated a short distance from Ile103, approximately 5 A ˚ (corresponding to Trp83 of SOT). Thus, we speculate that these residues are not able to interact with each other. The topological specificities of these serine pro- teases are assumed to be changed by the substitution of residue 89 with other amino acids in order to allow for an interaction with Ile103. Figure 6 shows that the conformations of SOT and SGT differ, although the enzymes show similar hydro- lytic activity towards type I collagen. The contribution of an induced-fit mechanism to the substrate specificity of aminoacyl-tRNA synthetase and adenylate kinase has been reported recently [34,35]. Moreover, the 60- loop of thrombin lining the upper rim of the active site entrance is rearranged by binding exosite I of throm- bin and the protease-activated receptor PAR3 [36]. A 0 0.5 [θ] × 10 –6 (deg·cm 2 ·d –1 ) Wavelength (nm) 200 220 240 260 –1 –0.5 SOT SOT-Y71L SGT SGT-L71Y C 300 400 500 SGT SGT-L71Y 300 320 340 360 380 0 100 200 Wavelen g th (nm) Fluorescence intensity (arbitrary units) B 500 SOT 100 200 300 400 SOT-Y71L 300 320 340 360 380 0 Wavelength (nm) Fluorescence intensity (arbitrary units) Fig. 6. Conformation of SOT, SGT and their mutants. CD spectra (A) and tryptophan fluorescence emission spectra (B, C) of SOT, SGT and their mutants were measured at room temperature in 10 m M Tris ⁄ HCl (pH 8.0) containing 10 mM CaCl 2 , as described in Materials and methods. Y. Uesugi et al. Substrate recognition mechanism of Streptomyces trypsin FEBS Journal 276 (2009) 5634–5646 ª 2009 The Authors Journal compilation ª 2009 FEBS 5641 Indeed, the 60-loop shifts 3.8 A ˚ upwards and causes a 180° flip of W60d that projects the indole ring into the solvent and opens up the active site fully, when PAR3 binds to exosite I, although the indole ring of W60d partially occludes access to the active site and restricts the specificity towards physiological substrates and inhibitors in free thrombin. Based on these findings, we propose that residue 71 triggers induced fitting when the enzyme–substrate complex is formed in the first step of the reaction mechanism. Consequently, the environment around the active site presumably changes to allow structural protein substrate attachment; it engenders change in topological specificity. Finally, this is the first report to identify the key amino acid residue conferring topological specificity in Streptomyces trypsin. The general collagenases, such as MMP and Clostridium histolyticum collagenase, have a collagen-binding domain (CBD) [37,38], and Tyr994 in this domain is the critical residue for inter- action with collagen [38]. The hydroxyl group of this residue probably forms hydrogen bonds with main- chain atoms to form a protein–collagen complex. Because the molecular size and structure of trypsin- like serine proteases and these collagenases differ, the domain corresponding to the CBD remains elusive. Nevertheless, residue 71 might also contribute to colla- gen-binding. Figure 7B shows that the residue is located in the basic surface charged region. Thus, SOT and SGT might possess other collagen-binding regions that act synergistically with residue 71 to promote the binding of the acidic surface of collagens to the basic surface charged region of the enzyme. Studies are underway using surface plasmon resonance analysis to determine the role of residue 71 in collagen binding. The elucidation of the mechanism of structural protein substrate recognition in serine proteases should help advance therapeutic research into the prevention and treatment of thrombotic and neurodegenerative dis- eases caused by ‘hard-to-degrade’ proteins. Materials and methods Materials A spin column (Vivapure S; Vinascience, Sartorius AG, Aubagne, France) and DQ-collagens (Molecular Probes Inc., Eugene, OR, USA) were used for this study. Type I collagen from bovine Achilles’ tendon, type IV collagen from human placenta and Clostridium histolyticum collage- nase type I were purchased from Sigma-Aldrich Inc. (St Louis, MO, USA). Z-Gly-Pro-Arg-MCA was obtained from Peptide Institute Inc. (Minoh, Osaka, Japan). All other unspecified chemicals were of the highest purity available. Construction of plasmid for RIBS in vivo DNA shuffling The plasmid for RIBS in vivo DNA shuffling was con- structed as described previously [23]. A plasmid containing the sot and sprT genes cloned in tandem was constructed as follows. The sot gene in plasmid pUC18 was digested with NdeI and KpnI. The sprT gene in pCR-Blunt II-TOPO was digested with KpnI and HindIII. Next, the sot and sprT genes were ligated into the NdeI–HindIII gap of plasmid pACTI2b [23], yielding pACTI2b(sot ⁄ sprT). The Gm r - rpsL + cassette from pNC124 [23] was digested with KpnI, and the cassette was inserted into the KpnI site between the sot and sprT genes in pACTI2b(sot ⁄ sprT) to construct pACTI2b(sot ⁄ Gm r -rpsL + ⁄ sprT) (Fig. 1A). The resulting vector was used for RIBS in vivo DNA shuffling. Random chimeragenesis Figure 1 shows the random chimeragenesis strategy. First, E. coli MK1019 [ssb-3 rpsL(Sm r )] was transformed with S172 D166 37H D82 Y71 B S172 D166 W83 37H D82 Y71 A Fig. 7. The amino acid residues related to topological specificity and the conformation of the three-dimensional structures. (A) The overall structure of SOT is portrayed using the Swiss-pdb viewer based on the crystal structure of SGT. The key residue is indi- cated in red (Tyr71 of SOT). The residues in the catalytic site are also shown. (B) The surface charge is represented using the Swiss-pdb viewer. Acidic and basic surface charges of SOT are shown as red and blue, respectively. Substrate recognition mechanism of Streptomyces trypsin Y. Uesugi et al. 5642 FEBS Journal 276 (2009) 5634–5646 ª 2009 The Authors Journal compilation ª 2009 FEBS pACTI2b(sot ⁄ Gm r -rpsL + ⁄ sprT) by electroporation. The transformants were selected using Luria–Bertani (LB) plates containing chloramphenicol and gentamicin. The Cm r ⁄ Gm r transformant sensitivities to streptomycin (Sm s ) were con- firmed on LB plates containing chloramphenicol, gentami- cin and streptomycin. The Sm s transformants from each host were cultivated in LB medium containing chloramphe- nicol. Cultures were spread on LB plates containing chl- oramphenicol and streptomycin. Plasmids isolated from 48 selected Sm r revertants from each host were analysed using agarose gel electrophoresis. The 0.8 kb DNA fragment con- taining the target gene on isolated plasmids was amplified by PCR using LA taq with a GC buffer system (TaKaRa Holdings, Inc.), with primers incorporating the NdeI site of sot (5¢-CATATGCAGAAGAACCGACTCGTCC-3¢) and the HindIII site of sprT (5¢-TGCCGGTACGAAGCTTCA GAGCGTGCG-3¢). Recombination sites were determined in detail using DNA sequencing. Construction of expression vectors To prepare chimeras, we applied a novel expression system [39] using the expression vector (pTONA5a), which included a promoter from Streptomyces metalloendopepti- dase, with Streptomyces lividans 1326 as a host strain. The chimeric gene was digested using NdeI and HindIII and ligated into the NdeI–HindIII gap of pTONA5a to obtain the expression vector. Construction of expression vectors of chimera B and C mutants To identify the amino acid residues related to topological specificity, we constructed chimera B and C mutants using PCR amplification. To prepare the mutants (B-2 and B-3), the following two mutagenic sense primers were synthesized [the XhoI site (in italic type) was substituted with a silent mutation]: 5¢-TCCAGTC(G fi C)TC(C fi G)AGCGCC (G fi A, Val fi Ile)TCAAG-3¢ (corresponding to nucleotides 281–303 from sprT) and 5¢-TC(G fi C)TC(C fi G)AGC GCC(G fi A, Val fi Ile)TCAAGGTCCGCTCCACCAAG (G fi A, Val fi Ile)TC-3¢ (corresponding to nucleotides 286–321 from sprT). The target mutation was introduced with primer sets of 5¢-TGCCGGTACGAAGCTTCA GAGCGTGCG-3¢ (a reverse primer, corresponding to the HindIII site of sprT) and each of the mutagenic primers, using KOD-Plus (version 2, Toyobo Co. Ltd.). The partial sot gene was amplified using PCR with a combination of a forward primer (5¢-CATATGCAGAAGAACCGACTCG TCC-3¢, corresponding to the NdeI site of sot) and a reverse primer [5¢-GATGGCGCT(GCT fi CGA)GGACTGGAG GT-3¢ for silent mutation of the XhoI site (in italic type) and corresponding to nucleotides 284–306 from sot]. The amplified DNA fragments were cloned into pCR-Blunt II-TOPO (Invitrogen Corp.); the resulting plasmids were confirmed by DNA sequencing. The plasmids representing B-2 and B-3 were digested with XhoI and HindIII. The plasmid representing the partial sot gene was digested with NdeI and XhoI. The fragments were ligated into the NdeI–Hin dIII gap of pTONA5a to construct the expression vector. The following mutagenic antisense primer, in which the KpnI site (in italic type) was substituted with a silent muta- tion, was synthesized to prepare the mutant B-4: 5¢-CGG T(G fi A)CCGTTGTAGCCGGGGGCCTGG(AG fi TA, Leu fi Tyr)-3¢ (corresponding to nucleotides 322–349 from sprT). The target mutation was introduced with primer sets of 5¢-CATATGCAGAAGAACCGACTCGTCC-3¢ (a for- ward primer, corresponding to the NdeI site of sot) and the mutagenic primer described above, using KOD-Plus. The partial sprT gene was amplified by PCR with a combina- tion of a forward primer [5¢-CCGGCTACAAC GG(C fi T)ACCGGCAA-3¢ for silent mutation of the KpnI site (in italic type), corresponding to nucleotides 332–353 from sprT] and a reverse primer (5¢-TGCCGGTACGAAGCTT CAGAGCGTGCG-3¢, corresponding to the HindIII site of sprT). The amplified DNA fragments were cloned into pCR-Blunt II-TOPO, and the resulting plasmids were confirmed by DNA sequencing. The plasmid repre- senting B-4 was digested with NdeI and KpnI. The plasmid representing the partial sprT gene was digested with KpnI and HindIII. The fragments were ligated into the NdeI–HindIII gap of pTONA5a to construct the expression vector. To prepare the mutant B-1, the chime- ric gene obtained by RIBS in vivo DNA shuffling was digested using NdeI and HindIII, and ligated into the NdeI–HindIII gap of pTONA5a to construct the expression vector. Construction of SGT-L71X mutants and SOT- Y71L We constructed SGT-L71X mutants and SOT-Y71L to investigate the effect of distinct residues on the recognition of the substrates. To prepare SGT-L71X mutants, the mutagenic gene was amplified using PCR with a combina- tion of a forward primer (5¢-CAACATATGAAGCACT TCCTGCGTGC-3¢, corresponding to the NdeI site of sprT) and a reverse primer [5¢-CGGT(G fi A)CCGTTGTAGC CGGGGGCCTG(GAG fi XXX)GACCTTG-3¢ for silent mutation of the KpnI site (in italic type), corresponding to nucleotides 315–349 from sprT]. When XXX was GTA, GAA, CCA, GGC, GCC, GCG, GTG, GTC, GTT, GGA and GGG, leucine was substituted with tyrosine, phenylala- nine, tryptophan, alanine, glycine, arginine, histidine, aspar- tic acid, asparagine, serine and proline, respectively. The amplified DNA fragments were then cloned, sequenced and digested with NdeI and KpnI. The plasmid representing the partial sprT gene with the KpnI site described above was digested with KpnI and HindIII. The fragments were ligated Y. Uesugi et al. Substrate recognition mechanism of Streptomyces trypsin FEBS Journal 276 (2009) 5634–5646 ª 2009 The Authors Journal compilation ª 2009 FEBS 5643 [...]... 7-amino-4-methylcoumarin In the kinetic assays, the reactions were carried out in a mixture consisting of Z-GlyPro-Arg-MCA at a final concentration of 0.03–0.5 mm in 50 mm Tris ⁄ HCl (pH 8.0) containing 10 mm CaCl2 and the purified enzymes under the assay conditions described above CD spectroscopy The secondary structures of the proteins were estimated by CD spectroscopy (J-720WI; Jasco Inc.) Proteins were dissolved... [12] The reaction velocity was estimated from the standard curve plotted with data obtained using fluorescein isothiocyanate (FITC) One unit of activity was defined as the amount of the enzyme necessary to release 1 nmol of FITC per minute under these assay conditions The collagenolytic activities of the enzymes were determined by the ninhydrin method using native insoluble type I collagen from bovine...Substrate recognition mechanism of Streptomyces trypsin into the NdeI–HindIII gap of pTONA5a to construct the expression vector To prepare the mutant SOT-Y71L, the mutagenic gene was amplified using PCR with a combination of a forward primer (5¢-CATATGCAGAAGAACCGACTCGTCC-3¢, corresponding to the NdeI site of sot) and a reverse primer [5¢-GGGGC(T fi C)CGG(TA fi... phosphate buffer (pH 6.8) containing 1 mm HCl The fluorescence and intensity was monitored at kex = 323 nm kem = 446 nm using a CORONA grating microplate reader SH-8000Lab The active site concentrations were estimated using a standard curve for the fluorescence of 4-methylumbelliferone The concentrations of SOT and SGT were 40.2 and 10.6 lm; their concentrations determined by the Bradford assay were estimated... incubated at 37 °C After preincubation at 37 °C for 5 min, the reaction was started by addition of the enzyme solution; it was subsequently monitored to assess the increase in fluorescence intensity at kex = 390 nm and kem = 460 nm using a grating microplate reader (SH-8000Lab; CORONA Electric Co., Ltd) The reaction velocity was estimated from the standard curve plotted using 7-amino-4-methylcoumarin... to the HindIII site of sot) The amplified DNA fragment was then cloned and sequenced The plasmid representing SOT-Y71L was digested with NdeI and ApaI The plasmid representing the partial sot gene was digested with ApaI and HindIII The fragments were ligated into the NdeI–HindIII gap of pTONA5a to construct the expression vector Expression and purification of the enzymes SOT, SGT, their chimeras and mutants... dissolved to a final concentration of 0.1 mgÆmL)1 in 10 mm Tris ⁄ HCl (pH 8.0) containing 10 mm CaCl2 Spectra were acquired at room temperature using a cuvette (path length, 2 mm) The spectra of the proteins, an average of 10 scans, were corrected by subtracting the spectra of the corresponding background media without protein Fluorescence spectroscopy Fluorescence spectra were obtained using a spectrofluorometer... using the expression vector (pTONA5a) with S lividans 1326 as the host strain, and then purified using a Vivapure S spin column as described previously [12] Chimeras and mutants were purified in a procedure similar to that used for SOT and SGT The resulting enzyme solutions were dialysed against 10 mm Tris ⁄ HCl (pH 8.0), and the purities of the proteins were confirmed using SDS-PAGE [40] The enzyme concentrations... Factorising ligand affinity: a combined thermodynamic and crystallographic study of trypsin and thrombin inhibition J Mol Biol 313, 593–614 33 Blevins RA & Tulinsky A (1985) The refinement and the structure of the dimer of alpha-chymotrypsin at ˚ 1.67-A resolution J Biol Chem 260, 4264–4275 ´ ´ 34 Xiao H, Murakami H, Suga H & Ferre-D’Amare AR (2008) Structural basis of specific tRNA aminoacylation by a... with 0.61 lm proteins in 10 mm Tris ⁄ HCl (pH 8.0) containing 10 mm CaCl2 using a quartz cuvette (path length, 2 mm) The excitation wavelength was 280 nm, and the excitation and emission slits were 5 nm FEBS Journal 276 (2009) 5634–5646 ª 2009 The Authors Journal compilation ª 2009 FEBS Y Uesugi et al The emission was scanned from 290 to 400 nm The spectra of the proteins, an average of four scans, . analysis to determine the role of residue 71 in collagen binding. The elucidation of the mechanism of structural protein substrate recognition in serine proteases. The role of Tyr71 in Streptomyces trypsin on the recognition mechanism of structural protein substrates Yoshiko Uesugi*, Hirokazu