Two independent, light-sensing two-component systems in a filamentous cyanobacterium Helena J. M. M. Jorissen 1 , Benjamin Quest 2 , Anja Remberg 1 ,The ´ re ` se Coursin 3 , Silvia E. Braslavsky 1 , Kurt Schaffner 1 , Nicole Tandeau de Marsac 3 and Wolfgang Ga¨rtner 1,2 1 Max-Planck-Institut fu ¨ r Strahlenchemie, Mu ¨ lheim an der Ruhr, Germany; 2 Max-Planck-Institut fu ¨ r Biochemie, Martinsried, Germany; 3 Unite ´ des Cyanobacte ´ ries, De ´ partement de Microbiologie Fondamentale et Me ´ dicale, Institut Pasteur (URA-CNRS 2172), Paris, France Two ORFs, cphA and cphB, encoding proteins CphA and CphB with strong similarities to plant phytochromes and to the cyanobacterial phytochrome Cph1 of Synechocystis sp. PCC 6803 have been identified in the filamentous cyano- bacterium Calothrix sp. PCC7601. While CphA carries a cysteine within a highly conserved amino-acid sequence motif, to which the chromophore phytochromobilin is co- valently bound in plant phytochromes, in CphB this position is changed into a leucine. Both ORFs are followed by rcpA and rcpB genes encoding response regulator proteins similar to those known from the bacterial two-component signal transduction. In Calothrix, all four genes are expressed under white light irradiation conditions, albeit in low amounts. For heterologous expression and convenient purification, the cloned genes were furnished with His-tag encoding sequences at their 3¢ end and expressed in Escherichia coli. The two recombinant apoproteins CphA and CphB bound the chromophore phycocyanobilin (PCB) in a covalent and a noncovalent manner, respectively, and underwent photo- chromic absorption changes reminiscent of the P r and P fr forms (red and far-red absorbing forms, respectively) of the plant phytochromes and Cph1. A red shift in the absorption maxima of the CphB/PCB complex (k max ¼ 685 and 735 nm for P r and P fr , respectively) is indicative for a noncovalent incorporation of the chromophore (k max of P r , P fr of CphA: 663, 700 nm). A CphB mutant generated at the chromophore-binding position (Leu246 fi Cys) bound the chromophore covalently and showed absorption spectra very similar to its paralog CphA, indicating the noncovalent binding to be the only cause for the unexpected absorption properties of CphB. The kinetics of the light-induced P fr formation of the CphA–PCB chromoprotein, though sim- ilar to that of its ortholog from Synechocystis, showed dif- ferences in the kinetics of the P fr formation. The kinetics were not influenced by ATP (probing for autophosphorylation) or by the response regulator. In contrast, the light-induced kinetics of the CphB–PCB complex was markedly different, clearly due to the noncovalently bound chromophore. Keywords: Calothrix sp. strain PCC 7601; flash photolysis; heterologous expression; phytochrome-like apoproteins CphA and CphB; response regulators RcpA and RcpB. A precise qualitative and quantitative measurement of the surrounding light is essential to photosynthetic organisms in order to either adapt to the environmental light conditions or, in the case of motility, to proceed towards a favorable habitat. Higher plants have developed the phytochromes, a chromoprotein family, which absorb light in the long- wavelength region and regulate numerous photomorpho- genetic processes [1–3]. In cyanobacteria, the presence and molecular structure of comparable sensory system(s) have long been debated. It has been suggested that the photo- synthetic apparatus itself or blue-light- and/or other non- characterized light-absorbing photoreceptors might fulfil these functions [4–7]. The complete sequencing of the genome of the cyano- bacterium Synechocystis sp. [8] has afforded some clues on the components putatively involved in light sensing. Probing this genome with phytochrome consensus sequences has yieldedanORF(slr0473) encoding a protein of  85 kDa (Cph1) that exhibits in its N-terminal part strong homol- ogies to the phytochromes of higher plants [9]. Besides this particular ORF, also others with lower similarities to phytochromes have been identified in Synechocystis sp. [10] and in Fremyella diplosiphon (rcaE) [11], a mutant of Calothrix sp. [12], as well as in other phototrophic and heterotrophic prokaryotes [13–15]. Correspondence to W. Ga ¨ rtner, Max-Planck-Institut fu ¨ r Strahlenchemie, Postfach 10 13 65, D-45413 Mu ¨ lheim an der Ruhr, Germany. Fax: + 49 208 306 39 51, Tel.: + 49 208 3 06 36 93, E-mail: gaertner@mpi-muelheim.mpg.de or N. Tandeau de Marsac, Unite ´ des Cyanobacteries, De ´ partement de Microbiologie Fondamentale et Medicale, Institut Pasteur (URA-CNRS 2172), 28 rue du Docteur Roux, F-75724 Paris Cedex 15, France. Fax: + 33 1 40613042, Tel.: + 33 1456 88415, E-mail: ntmarsac@pasteur.fr Abbreviations: Anabaena sp., Anabaena/Nostoc sp. strain PCC 7120; Calothrix sp., Calothrix sp. strain PCC 7601; CphA and CphB, recombinant phytochrome-like apoproteins of Calothrix sp.; CphA-PCB and CphB/PCB, chromoproteins obtained by covalent binding of CphA to PCB and by noncovalent complexing of CphB to PCB, respectively; PCB, phycocyanobilin; P r and P fr ,redandfar-red absorbing forms of phytochrome, respectively; Synechocystis sp., Synechocystis sp. strain PCC 6803. Note: The sequences reported in this paper have been deposited in the GenBank database (accession nos. AF309559 for cphA-rcpA, AF309560 for cphB-rcpB. (Received 12 November 2001, revised 20 March 2002, accepted 12 April 2002) Eur. J. Biochem. 269, 2662–2671 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.02928.x The strong similarity of slr0473 to the genes of the plant phytochromes is also evident when the amino-acid sequences and properties of the corresponding recombinant proteins are compared. The cyanobacterial apoprotein (Cph1) binds to both the chromophores of the plant phytochromes, phytochromobilin, and to the closely related phycocyanobi- lin (PCB). Moreover, the assembled chromoproteins can be cycled between P r and P fr forms in a way reminiscent of the plant phytochromes [k max 668 nm (P r ) and 717 nm (P fr )with phytochromobilin as a chromophore, and 654 nm (P r )and 706 nm (P fr ) with PCB] [16–18]. This discovery of a new group of light-sensing signal transduction proteins has also raised new questions on their function as putative photo- receptors. In particular, as in the case of the gene product of rcaE of Fremyella diplosiphon, the covalent binding of a chromophore by the recombinant protein is still question- able. Therefore, functional assays [18] were performed which revealed signal transduction in Synechocystis sp. once the photoreceptor is activated by absorption of a photon. While the N-terminal part of the phytochrome-like protein of Synechocystis sp. incorporates the chromophore, its C-terminal part exhibits sequence motifs with a strong similarity to the well-characterized two-component system of other bacteria [19,20]. As found in the bacterial system, this process of signal transduction functions via auto- phosphorylation of a conserved histidinyl residue in the receptor molecule (Cph1) and transphosphorylation to an aspartate of a response regulator (Rcp1). The target amino acids for both reactions, the autophosphorylation and the phosphate transfer could be identified in vitro for the recombinant Synechocystis proteins by site-directed mutagenesis [18]. Extensive search for DNA sequences similar to those found in Synechocystis sp. has revealed further members of this protein family in a number of other cyanobacteria and eubacteria [14,21]. Some of these proteins even lack the covalent-binding forming cysteine, but nevertheless undergo light-induced signal transduction via a Schiff base bonded biliverdin chromophore (covalent bond to a histidine residue) [14]. The widespread presence of this signal transduction principle is further supported by the finding that the ORFs of all these receptors are accompanied by a coding sequence for a response regulator protein capable of transferring the biological signal into the cell interior. Here, we describe the biochemical and spectral charac- terization of two independently functioning, light-sensing receptor proteins and their cognate corresponding response regulators as new members of the two-component signal transduction protein family from the filamentous cyano- bacterium Calothrix sp. PCC 7601. MATERIALS AND METHODS Strain and growth conditions TheaxenicstrainCalothrix sp. strain PCC 7601 (this strain has also been named Fremyella diplosiphon UTEX 481 and Tolypothrix sp., however, in order not to cause confusion we wish to remain with Calothrix sp. PCC 7601 [22]) was grown at 30 °C in liquid BG-11 medium containing 0.4 m M Na 2 CO 3 and supplemented with 10 m M NaHCO 3 .The culture was stirred with a magnetic bar under a continuous stream of air/CO 2 (99 : 1, v/v). White light of fluorescent tubes (Universal White) provided a photosynthetic photon flux density of 50 lmol photonsÆm )2 Æs )1 (measured with a LICOR LI-185B quantum/radiometer/photometer equipped with a LI-190SB quantum sensor). The purity of the cultures was checked on plates of medium BG-11 [22], supplemented with glucose and casamino acids (0.2% and 0.02% w/v, respectively) and solidified with Difco Bacto agar (1% w/v). Plasmids were maintained in the E. coli strain DH5a F¢. Recombinant E. coli strains were grown at 37 °Cina Luria–Bertani medium supplemented with 100 lgÆmL )1 ampicillin. Cloning of phytochrome- and response regulator-encoding DNAs Calothrix sp. genomic DNA was extracted from a culture growntoanD 750 value of 0.8, using the Nucleobond for the isolation of genomic DNA of bacteria (Macherey–Nagel). Total genomic DNA digested with NheIorHindIII gave strong hybridization signals (5.5 and 6 kb, respectively) with the PCR products [21] corresponding to a portion of the cphA and cphB genes, respectively. Two partial libraries were constructed by ligating NheIandHindIII DNA fragments of  6 kb into the dephosphorylated pBluescript SK – vector digested with XbaIandHindIII, respectively, as described previously [23]. Ligated DNA was transformed by electroporation (Bio-Rad, GENE PULSER) into the E. coli strain DH5a F¢ [24]. The clones carrying the proper inserts were selected by colony hybridization with either the cphA or cphB PCR products as probes. The recombinant plasmid DNAs were purified with the QIA filters (Qiagen kit 12262) according to manufactors’ instructions, and they were sequenced ( 3200 nucleotides) on both strands (Genome Express, Paris, France). The full-length DNAs encoding the cyanobacterial phytochrome-like proteins and their respective response regulators were synthesized with an octadecamer oligonu- cleotide at their 3¢ end encoding for six histidine residues and with restriction sites for cloning into the E. coli vector pMEX8 (Medac). For cphB and rcpA the putative trans- lation start codons TTG and GTG, respectively, were replaced by ATG. The cphA gene was cloned between the NcoIandSalI sites of the vector. The cphB, rcpA and rcpB genes were cloned between the EcoRI and SalIsitesofthe vector. The following primers (5¢ to 3¢) were used (restriction sites and sequences coding for a His6 tag are underlined, start and stop codons are given in bold, and gene-specific sequences in italics): cphA:forward,GCGATA CCATGG TATCCGAATTCCAAG and reverse, ACCCGG GTCG ACTCAGTGATGGTGGTGATGGTGTCCTCGACC AAAAAGATC; rcpA:forward,GCGATA GAATTCATG AGCGTAGAAACGGAAGAC and reverse, CGAAGCTT GTCGACTCAGTGATGGTGGTGATGGTGCTCCG ACGGCAATGTCG; cphB:forward,GCGATA GAATTC ATG ACGAATTGCGATCGCGA and reverse, ACCCGG GTCGACTCAGTGATGGTGGTGATGGTGTTTGAC CTCCTGCAATGT; cphBlong:forward,GCGATA GAA TTCATGTTGCAGTTAATTTATAACAATT; the reverse primer was identical to that used for cphB; rcpB:forward, GAGGCT GAATTCATGGTAGGAAACGCTACTCAAC; reverse, CGAAGCTT GTCGACTCAGTGATGGTGGT GATGGTGACCCATCTCAGGAAGTACAAC. Ó FEBS 2002 Light sensing two component systems in Calothrix (Eur. J. Biochem. 269) 2663 Total RNA extraction, cDNA synthesis and specific mRNA detection Total RNA from white light-grown cells from Calothrix PCC 7601 was extracted as described previously [25] with the following modifications: cells were resuspended in BG11 medium to a D 750 of 50 and disrupted in a Mickle desintegrator six times for 1 min at 4 °C. The ethanol- precipitated total RNA pellets were taken up in 50 lLof sterile water containing 0.1% (v/v) DEPC and directly treated with DNAse I ribonuclease-free as follows. A sample of total RNA (300 lg) was resuspended in a buffer containing 50 m M Tris/HCl pH 7.5, 10 m M MgCl 2 ,0.1 m M dithiothreitol and treated twice with 200 U of DNase I ribonuclease-free (Boehringer Mannheim) for 45 min at 37 °C. After two phenol/chloroform treatments, total RNA was ethanol-precipitated for 12 h at 20 °C and resuspended in 50 lL of DEPC-treated water. As a control for RNA purity, a DNase I-treated sample (1 lg) of total RNA was amplified by PCR with the primers used for further cDNA detection. No amplification product was obtained confirm- ing the absence of DNA in the RNA preparations. A pool of total cDNAs was synthesized using random primers with the SuperScript TM First-Strand Synthesis System for reverse transcriptase PCR amplifications (Gibco BRL) as recommended by the manufacturer. A second set of specific cDNAs was synthesized using the following primers specific of the cphA, rcpA, cphB and rcpB genes: cphA primer: 5¢-GGTAGCACCTTCGCCCAGTTGTGA CTC-3¢; rcpA primer: 5¢-GCTGGCTCAGGTTGCGAGA TTTGGTG-3¢; cphB primer: 5¢-CGCGATGGTTAGCCC TGCACCCG-3¢; rcpB primer: 5¢-GTCTGAACCGTCTC GGTGAGACG-3¢. Total RNA (5 lg) was incubated with 120 pmoles of each of the primers specific of the cphA, rcpA, cphB and rcpB genes in 12 lL of DEPC-treated water for 10 min at 70 °C. Samples were cooled down on ice and incubated with the SuperScript TM First-Strand buffer (Gibco BRL) con- taining 10 m M dithiothreitol and 0.5 m M dNTP for 2 min at 42 °C. After addition of 200 U of SuperScript II RNase H – reverse transcriptase and incubation for 50 min at 42 °C, followed by 15 min at 70 °C, 2 lL of cDNA containing samples were used for PCR amplifications in the presence of 5U of rTaq polymerase (Amersham Pharmacia) and different combinations of the following forward and reverse primers (170 pmol of each): cphA gene: primer 1, 5¢-GGTA GAGTGATATTTACAG-3¢ (forward); primer 2, 5¢-CGCT TCATTGGGATTACC-3¢ (reverse); cphB gene: primer 3, 5¢-CCCTATGAAATCCGTAGCG-3¢ (forward); primer 4, 5¢-GGTAGAGATTGTCGCTGCAC-3¢ (reverse); primer 5, 5¢-CAAACAGCCGCGCCTGTAGC-3¢ (reverse); rcpA gene:primer6,5¢-GCTGATATCCGCTTAATCC-3¢ (for- ward); primer 7, 5¢-GACGTGTAAGTCGTAGCTATG-3¢ (reverse); rcpB gene: primer 8, 5¢-GGAAACGCTACTCAA CCGTTGC-3¢ (forward); primer 9, 5¢-TCCCGCCCATCA GTTCCTGG-3¢ (reverse). The program for PCR (Robocycler gradient 40, Strata- gene) was one cycle for 5 min at 95 °C, 1 min at 55 °Cand 30 s at 72 °C, 40 cycles at the same temperatures for 1 min, 1 min 30 s and 1 min, respectively, and one cycle for 1 min, 1 min and 5 min, respectively. The PCR products were analyzed by electrophoresis (1.2% (w/v) agarose gels, Tris/ borate buffer) [23]. Generation of the Leu246 fi Cys mutant of CphB A point mutation was introduced into cphB, converting the leucine-encoding codon into TGT, encoding for cysteine, thus principally allowing covalent chromophore binding. Forward primer: 5¢-CACTCGGTACTCCGCAGCGTTT CGCCGTGTCACATTGAATATTTGCACAATATGG -3¢; reverse primer: 5¢-CCATATTGTGCAAATATTCAA TGTGACACGGCGAAACGCTGCGGAGTACCGAG TG-3¢. Sequences different from the wild-type CphB sequence are given in bold. Expression of (apo)proteins, chromoprotein assembly and affinity purification This followed recently published procedures [26]. In brief, the E. coli strain C600 was used as a host (for expression of CphB L246C mutant, E. coli BL21DE3RIL from Strata- gene was used), and was grown at 37 °C in Luria–Bertani medium [23] containing penicillin (150 lgÆmL )1 )to D 600 ¼ 1.8. BL21DE3RIL cells were induced with IPTG following the instructions of the manufacturer. Cells were harvested by centrifugation (2200 g,10min,4°C) and opened at liquid nitrogen temperature by treatment with an Ultraturrax (Jahnke & Kunkel T25, 10 000 r.p.m.). The cellular debris was pelleted by centrifugation (39 000 g, 30 min, 4 °C). The supernatant was cleared by ultracentrif- ugation (200 000 g,45min,4°C). After readjusting the pH to 8.0, the cleared crude extract was incubated with PCB. The amount of assembled chromoprotein was determined from the difference spectrum (P r ) P fr ), based on the P r absorption coefficient of the recombinant phytochrome-like protein of Synechocystis sp. (e max 85 000 M )1 Æcm )1 at 656 nm [27]). Purification of the assembled chromoproteins was accomplished by affinity chromatography on a Talon metal affinity resin (Clontech). The analysis of protein content and purity was performed by polyacrylamide gel electrophoresis and Western blotting (PHAST system, Pharmacia) employing an anti Penta-His antibody from Qiagen. Assembly kinetics, determination of absorption maxima/ difference spectra, P fr stability, and P r -to-P fr kinetics For the determination of the assembly kinetics, the apoproteins were purified as described for the assembled chromoproteins and were incubated in the dark with a 10-fold excess of PCB. The assembly kinetics was followed at 10 °C and at room temperature. In addition to normal buffer, deuterated buffers were also used for these meas- urements. For CphA–PCB, the absorption rise at 663 (k max of P r ) and 700 nm was recorded. For the CphB/PCB complex, spectra were run from 600 to 750 nm, and the absorption rise at 685 nm (k max of P r ) was determined. The fully assembled chromoproteins were subjected to repetitive red and far-red irradiations [interference filter at 658 ± 7 nm and cut-off filter > 715 nm, Schott] for P fr and P r formation, respectively. Absorption spectra were recorded with a Shimadzu spectrophotometer UV-2102/ 2402PC. For the determination of the thermal stability of the P fr form, the samples were irradiated at 658 nm until a maximum of P fr was formed. Subsequently, the spectral changes of the sample during the storage at room 2664 H. J. M. M. Jorissen et al. (Eur. J. Biochem. 269) Ó FEBS 2002 temperature in the dark were recorded by measuring spectra (500–800 nm) at various time intervals. The laser flash-induced P r -to-P fr formation was followed in the time range from  1 ls to 5 s essentially as described previously [28]. In some experiments, ATP was added to a final concentration of 1.5 m M . When the response regulator was added during the measurements, it was used in about eight-fold molar excess over the amount of phytochrome. Recorded data were averaged and treated by a global fit analysis as described previously [28]. RESULTS Two ORFs of the cyanobacterium Calothrix sp., cphA (2304 nucleotides, GenBank accession number AF309559) and cphB (2298 nucleotides, AF309560), initially cloned in part by using the same PCR primer sets [21], have now been fully characterized. Both ORFs encode proteins with strong sequence similarities to plant phytochromes and to Cph1 of Synechocystis sp., the first phytochrome protein identified in cyanobacteria. However, despite a particularly high sequence degree of similarity in the chromophore region for both the CphA and CphB proteins of Calothrix sp. (Fig. 1), in the latter protein the chromophore-binding cysteine is replaced by a leucyl residue (position 246; Fig. 1). A comparison of their complete amino-acid sequences with those of the cyanobacterial phytochromes available to date (Table 1, see also gene sequences deposited at GenBank) confirms the membership of the new Calothrix proteins to this protein family, the highest score being found between Calothrix sp. CphA and Anabaena sp. AphA (GenBank accession no. AB028873). The translation starting point of cphA is identified by the putative Shine–Dalgarno sequence, GAGGA at nucleotide positions 33–37 (Fig. 2), and the ATG at position 46 indicating the first amino-acid residue. For the cphB gene, there are two possible translation initiation sites. The first one is at position 28 (TTG, coding for leucine and preceded by a stop codon) with a putative Shine–Dalgarno sequence AAGG at positions 18–21. Another one is located at position 118 (TTG) with a putative Shine–Dalgarno sequence GAGG at positions 109–112. In both cases, a leucine is encoded as the first amino acid, which for heterologous expression was replaced by methionine (ATG). In addition to the high sequence similarity to the phytochromes in the N-terminal half, a motif (ASHDL) reminiscent of the histidine kinases of the two-component signal transduction were found in the C-terminal parts of CphA and CphB with the histidinyl residues prone to autophosphorylation (positions 538, CphA, and 526, CphB). The response regulator-encoding genes rcpA and rcpB (447 and 450 nucleotides, respectively, corresponding to 148 and 149 amino acids) were found downstream from cphA and cphB, respectively (Fig. 2). The sequence of rcpA over- laps by more than 50 nucleotides with that of cphA, assuming an operon-like arrangement. In the case of cphB and rcpB, the stop codon of the receptor gene and the ATG of the response regulator gene are separated by four nucleotides. A comparison of the deduced amino-acid sequences of response regulators reveals a high degree of conservation: RcpA is 66% identical with its Synechocystis sp. ortholog and 39% with its Calothrix paralog. All motifs common to the two-component response regulators, in particular those involved in the phosphate transfer from the receptor, are conserved and can readily be identified (Fig. 3). Fig. 1. Sequence alignment of the chromo- phore-binding domain of phytochrome-like proteins of cyanobacteria (Calothrix sp. CphA and -B, Synechocystis sp. Cph1, and Anabaena sp. AphA and AphB, GenBank numbers AB028873 and AB034952), Arabidopsis thali- ana (At phyA and -C) and Solanum tuberosum (St phyA and -B). Grey boxes: amino acids identicalinnomorethaneightofthenine sequences. The position of covalent chromo- phore attachment (in case a cysteinyl residue is present) is indicated by an asterisk. Table 1. Percentage of sequence identity of prokaryotic phytochrome- like apoproteins. 7601CphB 6803Cph1 7120AphA 7120AphB a 7601CphA b 43 58 81 45 7601CphB b –424563 6803Cph1 c ––5942 7120AphA d –––46 Phytochrome-like apoproteins of: a Anabaena sp. (Genebank accession no. AB028873), b Calothrix sp., c Synechocystis sp. [8]., and d Anabaena sp. (GenBank accession no. AB034952). Ó FEBS 2002 Light sensing two component systems in Calothrix (Eur. J. Biochem. 269) 2665 A transcription analysis indicated that both the receptor- and the response regulator-encoding ORFs are expressed, albeit in low yields as the transcripts could not be detected by Northern hybridizations but only by PCR amplification of either pools of total cDNAs or of cDNAs specific of the cphA, rcpA, cphB and rcpB genes. In each case, the size of PCR products obtained were as expected from the combi- nation of the primers used for the amplification (Fig. 4). Moreover, a PCR product was obtained when the specific primers 1 and 2 were used to amplify cphA from the cDNA synthesized with the rcpA primer (Fig. 4). This demonstra- ted that cphA and rcpA form an operon. In contrast, no PCR product was obtained when the specific primers 3 and 4 were used to amplify cphB from the cDNA synthesized with the rcpB primer, suggesting that cphB and rcpB are transcribed independently. Both receptor-encoding ORFs were furnished at their 3¢ end with a His6-encoding octadecanucleotide tail and were cloned into the E. coli vector pMEX8 for heterologous expression. For cphB, two different starting sites were used (Fig. 2). While the expression of cphA was sufficiently high (based on Western blot analysis, and also estimated from incubation experiments with linear tetrapyrrole chromo- phores, see above), the yield of the gene product of cphB was considerably lower, irrespective of which of the two cphB constructs was expressed, and a large amount of the protein was found in inclusion bodies. Fig. 3. Sequence alignment of the cyanobacte- rial response regulators 7601RcpA and -B (of Calothrix sp.), and 6803Rcp1 (of Synechocystis sp.). Grey boxes: amino acids identical in two out of the three sequences. The phosphate- accepting aspartate (Asp69 in RcpA) is indi- cated by an asterisk, and the other amino acids generating the binding site (Glu13, Asp14, Thr99, Lys121) are marked by a diamond. Fig. 4. Expression of the cphA, rcpA, c phB and rcpB genes in Calothrix PCC 7601 cells grown under 50 lmol photonsÆm )2 Æs )1 of white light. PCR products of the cDNA specific of cphA amplified with primers 1 and 2 specific of cphA (450 bp, line 1), of the cDNA specific of cphB with primers 3 and 5 specific of cphB (200 bp, line 4), of the cDNA specific of rcpA amplified with primers 1 and 2 specific of rcpA (450 bp, line 2), of the cDNA specific of rcpB amplified with primers 3 and 4 specific of rcpB (no detectable product, line 5), and of the cDNA pool with primers 6 and 7 specific of rcpA (290 bp, line 3) or primers 8 and 9 specific of rcpB (230 bp, line 6). Fig. 2. Genomic arrangement of phytochrome and response regulator ORFs of Calothrix sp. showing the start and stop regions of the genes. Putative Shine–Dalgarno sequences and start positions of the coding regions are underlined. For cphB both putative starting sequences are indicated. In all cases, the nucleotides encoding leucine/valine at position one of the protein were changed for heterologous expression into methionine (ATG codons). 2666 H. J. M. M. Jorissen et al. (Eur. J. Biochem. 269) Ó FEBS 2002 CphA Incubation of the crude mixture of the recombinant CphA protein obtained from the lysis of the E. coli cells with PCB led to the appearance of an absorption band with k max ¼ 663 nm (Fig. 5). This assembly process was very rapid and primarily afforded an intermediate with a red- shifted absorption maximum at around 700 nm. On the time scale of the observation, more than 50% of this intermediate formed within less than 1 min (at 10 °C), indicating an unresolved, much more rapid primary reac- tion. The 700-nm intermediate then converted into the 660-nm P r -like band. The decay of the 700-nm species and the formation of the 660-nm species remained nearly unchanged when performed in deuterated buffer. The decay of the primary 700-nm species showed, however, a strong temperature dependence (Fig. 5). In order to investigate possible effects of protonation changes on the absorption maximum, the pH stability of the CphA-PCB chromopro- tein in its P r form was determined. The holoprotein proved stable in the broad range of pH 6–10 without showing strong shifts of the absorption maximum, and started to denature irreversibly beyond these pH values. This novel cyanobacterial phytochrome exhibits spectral features similar to those of the plant phytochromes, i.e. irradiation with red light caused formation of a red-shifted absorption band (k max 710 nm), close to the P fr absorption of Synechocystis sp. phytochrome [9]. This photochemical behavior was fully reversible and reproducible. Monitoring of the thermal stability of the P fr form of CphA in the dark revealed practically no spectral change within 10 days. The light-induced P r -to-P fr conversion of CphA was followed by laser flash photolysis (Fig. 6 and Table 2; it should be kept in mind that the data presentation shows decay processes with positive amplitudes, whereas the formation of an absorbance is presented with a negative amplitude). In the time window of up to 1 ms two kinetic processes were identified. The immediate absorbance increase (k max 680 nm), which is not time-resolved, but appears instantaneous on this time scale, decays with a lifetime of 22 ls, and a new absorbance appears at k max 700 nm with a lifetime of 1.0 ms, this one being the major P fr -forming process. The subsequent reaction with a lifetime of 9.4 ms shows the absorbance decrease in the range of the P r form (670 nm), and a concomitant absorbance rise at around 720 nm. Slower processes of very low intensity and Fig. 6. Lifetime-associated difference spectra of the CphA–PCB chro- moprotein. Flash photolysis was performed at 10 °C. Note that pos- itive amplitudes in the difference spectra refer to an absorbance decay related to the process observed, and negative amplitudes indicate an absorbance rise. The solid curve without symbols shows the residual absorbanceattheendoftheobservationtime,i.e.theP r ) P fr differ- ence spectrum. Fig. 5. Assembly kinetics of CphA + PCB at various temperatures and buffer conditions and absorption (difference, P r –P fr ) spectra of the CphA-PCB chromoprotein at ambient temperature. Top: filled squares are H 2 O, ambient temperature; open squares are D 2 O, ambient tem- perature; triangles are D 2 O, 10 °C. Table 2. Lifetimes for the light-induced P r -to-P fr conversion of CphA- PCB. The values in column one are those from Fig. 6. Lifetimes were determined by global analysis. The concentration of ATP was 1.5 m M , and the molar ratio [CphA-PCB]:[RcpA]  1:8. CphA-PCB CphA-PCB + ATP CphA-PCB + RcpA CphA-PCB + ATP + RcpA 22 ls21ls25ls25ls 1.0 ms 0.86 ms 1.2 ms 1.2 ms 9.4 ms 8.0 ms 10 ms 10 ms 42 ms 34 ms 42 ms 41 ms 290 ms 220 ms 256 ms 264 ms 33 s 26 s 10 s 19 s Ó FEBS 2002 Light sensing two component systems in Calothrix (Eur. J. Biochem. 269) 2667 lifetimes of 42 ms, 290 ms and 33 s exhibit almost no absorbance changes in the 660-nm range, but only an increase of absorbance at around 720 nm. As an auto- phosphorylation has been described for the corresponding protein of Synechocystis sp., the measurements were also performed in presence of ATP, and upon addition of the response regulator RcpA. Neither the presence of ATP nor RcpA had any significant effect on the kinetics of P fr formation (Table 2), although the light-induced phospho- relay between receptor and their cognate response regulator had recently been demonstrated for these proteins [29]. It should be taken into account that these experiments were not performed under quantitative conditions, i.e. no proof was performed for the extent of phosphorylation. CphB Incubation of the soluble amounts of CphB apoprotein with PCB, as described for the CphA, surprisingly yielded also a P r -like absorption spectrum (k max 685 nm) as found for its paralog, despite the absence of the chromophore-binding cysteinyl residue contained in phytochrome (-like proteins) (Fig. 7, top). A biexponential kinetics with lifetimes of 15 and 103 s was determined, but no instantaneous formation of an initial red-shifted intermediate analogous to the 700-nm species was observed as in the assembly of CphA with PCB. Irradiation of the CphB/PCB complex led to the formation of a far-red shifted species with an absorption maximum at 735 nm, reminiscent of a P fr state (Fig. 7 middle, trace A). The incorporation of the chromophore without covalent binding became evident upon the purifi- cation via metal-affinity chromatography. The elution of the affinity-bound protein from the resin resulted in the collection of only the apoprotein, i.e. in a complete loss of the chromophore (Fig. 7 middle, trace B). Yet, when PCB was added to this eluted protein, the P r -like absorption appeared again and photoreversibility identical to that of the unpurified complex was re-established (Fig. 7, middle, trace C). The time-resolved measurement of P r -to-P fr photoconver- sion of the CphB/PCB complex followed only biexponential kinetics with lifetimes of 1.9 and 12.8 ms, both reactions showing a decrease in absorption at 680–690 nm and a concomitant increase at around 730 nm (Fig. 8). Contrary to Fig. 7. Assembly kinetics of CphB + PCB at 10 °C, determined at 685 nm (top), and proof of noncovalent binding of PCB by CphB (middle and bottom). Middle, CphB + PCB assembly probe: (A) incubation of the crude lysate after cell harvest, (B) after elution of the CphB/PCB complex from the affinity column, (C) after addition of fresh PCB to eluate (B). Note the different total volumes for the various spectra. Bottom, difference absorption spectra at various stages of purification of the L246C mutant of CphB: affinity chromatography before (solid lines) and after addition of PCB (dashed lines). The dashed curves show the spectra after addition of PCB to the assembled chromprotein. The apparent rise of the absorbances is due to the underlying broad absorbance of unbound PCB (see for comparison the identical dif- ference spectra). Fig. 8. Lifetime-associated difference spectra of the CphB/PCB com- plex. For details see caption to Fig. 6. 2668 H. J. M. M. Jorissen et al. (Eur. J. Biochem. 269) Ó FEBS 2002 CphA-PCB and other phytochromes, microsecond and longer millisecond-to-second kinetics do not appear. In addition to the above recombinant CphB, another construct with the earliest possible translation starting site was cloned and expressed in E. coli (Fig. 2). This ÔlongÕ CphB apoprotein exhibited no differences to the results discussed above regarding expression level, noncovalent assembly with PCB, and P r and P fr absorption spectra (data not shown). The capability of apo-CphB to induce a phytochrome- like photochemistry in noncovalently bound tetrapyrrole chromophores prompted us to generate a point mutation introducing a potentially covalently binding cysteinyl resi- due. This mutant apoprotein (CphB L246C), when incuba- ted with PCB, formed a P r -like absorption band with an absorption maximum at 653 nm, and showed photochem- ical reactivity with the formation of a P fr -like absorption band with k max at 697 nm, very similar to the absorption maxima of CphA (Fig. 7, bottom, solid lines). Also similar to the behavior of CphA and different to the CphB/PCB complex, the mutant protein, when assembled with PCB, did not loose the chromophore upon affinity chromatogra- phy. Accordingly, no absorbance increase could be observed when additional PCB was added to the eluted protein (dashed curves in Fig. 7, bottom). DISCUSSION Initially based on sequence alignments, and followed by the characterization of recombinant proteins, a new type of signal transduction components has been identified in cyanobacteria and other, nonphotosynthetic prokaryotes. The discovery of proteins with sequence similarity and the capability to bind tetrapyrrole chromophores in a manner reminiscent of the plant phytochromes, and their interac- tion, via autophosphorylation upon an incoming stimulus and phosphate transfer to a response regulator, connects the light perception known from plants to the well characterized two-component signal transduction of bacteria [19]. The similarities of the prokaryotic photoreceptors with plant phytochromes relate to the kinase motifs in the C-terminal domain and to large portions of the proteins in the N-terminal part that include the chromophore-binding domain [8–11,13,14,16,21]. The interesting case in the results presented here is the finding that Calothrix comprises two bacterial phyto- chromes, one binding the chromophore covalently, and the other, only tested under in vitro conditions, incorporates the chromophore noncovalently. Yet, as shown by func- tional studies, both chromoproteins undergo light-induced auto- and trans-phosphorylation. One of the new proteins (CphA of Calothrix sp.) and the previously characterized photoreceptor of the cyanobacterium Synechocystis sp. [9] exhibit strong sequence similarities. In contrast, its paralog, CphB, lacks the chromophore-binding cysteinyl residue, carrying a leucyl residue instead, and it shows lower sequence similarities. The same codon change occurs also in the sequence of the phytochrome-like protein AphB of the cyanobacterium Anabaena sp., the genome of which has recently been sequenced completely (GenBank accession no. AB034952). It is not yet known whether these phyto- chrome-like proteins in the cyanobacterial cell contain any chromophore at all or, if not, whether they would be capable of covalently binding a chromophore (of the linear tetrapyrrole type or of any other structure) if incubated in vitro. This is of particular interest in conjunction with some other phytochrome-like proteins, the chromophore- protein binding domains of which also deviate markedly from the plant phytochromes. Several groups [11,13,14] have reported naturally occurring phytochrome-like chromoproteins which lack the cysteinyl and/or other amino-acid residues close to the binding site essential in plant phytochromes for the covalent chromophore attach- ment. In fact, the investigation of factors being essential for inducing a phytochrome-like photochemistry is currently performed with strong activity [14,15,30]. These studies become of even stronger interest after the recent demon- stration that this induction of photochemistry is apparently not restricted to the prokaryotic phytochromes, but also a plant phytochrome apoprotein (apo-phyA of oat) can incorporate a PCB-like chromophore with photochemical activity, even when the binding capability of the chromo- phore has been inactivated chemically [31]. The lack of the chromophore-binding cysteine in some of the above-men- tioned phytochrome-like proteins has triggered investiga- tions on the type of interaction between chromophore and protein. Based on studies on D. radiodurans [14,15], also lacking the cysteinyl residue for covalent binding of a tetrapyrrole, but carrying a histidine at a position similar to that of CphB, a covalent bond formation between the biliverdin and the histidinyl residue via a Schiff base has been proposed. Similar experiments performed with CphB, which was incubated with biliverdin IXa, show that no stable bond formation can be detected, yet, a photochem- istry similar to that of the phytochromes can be induced [30]. Nevertheless, the possibility that, despite their sequence similarities to the chromophore-binding domain of other receptors of this class, AphB and CphB may monitor a different type of external stimulus, can apriorinot be excluded. The fact that both the cphA and cphB genes are expressed in Calothrix sp., the sequence similarity throughout the total ORFs, and the similar genome structure (i.e. the presence of a response regulator directly downstream from the receptor gene) strongly suggest, however, that the two gene products of Calothrix sp. and the Synechocystis chromoprotein belong indeed to the same two-component signal-transduc- ing receptor category. In the experiments reported here, both recombinant apoproteins, CphA and CphB, were able to incorporate PCB as a chromophore, and to undergo reversible P r -to-P fr photoconversions. The question whether either of these proteins is associated also in vivo with a chromophore, and with which type of chromophore, however, remains open at this time, and is currently very difficult to answer due to the low concentration of these proteins in the cyanobacterial cells, although in the case of Cph1 from Synechocystis, PCB could be identified as the in vivo incorporated chromophore [32]. For the in vitro generated CphB/PCB complex one should note several distinct differences to other cyanobac- terial phytochrome-like chromoproteins with respect to the red shifts of the P r -and P fr -like absorption maxima, kinetics of chromophore incorporation and P fr formation upon irradiation (Figs 7 and 8), evidently reflecting the altered chromophore–protein interactions. The results from the Ó FEBS 2002 Light sensing two component systems in Calothrix (Eur. J. Biochem. 269) 2669 CphB L246C mutant that shows spectra very similar to those from CphA give strong evidence that the exchange of solely the covalently binding residue converts CphB into a ÔnormalÕ cyanobacterial phytochrome. The loss of the phytochrome-like absorbance during affinity chromatogra- phy of the CphB/PCB complex, taken together with the absolute stability of the point-mutated (L246C) protein under the same experimental conditions, is a clear proof for the unstability, or noncovalent character, of the chromo- phore–protein interactions. In contrast, the CphA–PCB chromoprotein and its Synechocystis ortholog Cph1–PCB [16,17] are remarkably similar to each other with respect to assembly kinetics, P r and P fr absorption maxima positions, and even P r -to-P fr conversion kinetics. In fact, the similar formation of a far- red shifted intermediate during the assembly process (found in both cyanobacterial proteins, Cph1 and CphA) has not been found in any plant-derived phytochrome on that time scale. The strong red shift of this intermediate points to a protonation of the protein-adsorbed chromophore prior to or during the incorporation into the protein binding site. It is worth noting that this assembly intermediate is not observed in the formation of the CphB/PCB complex, another indication for the different chromophore–protein interaction in this peculiar protein. The thermal stability of the P fr form of CphA in the dark, which is nearly identical to that of the recombinant Synechocystis protein, is greater than that for any plant phytochrome studied so far [28]. However, a process of protonation/deprotonation, evident from a strong isotope effect in the Synechocystis phytochrome photoconversion [17], could not be detected in CphA. The finding that the P r - to-P fr conversion is not affected by addition of ATP and/or response regulator does not contradict a protein–protein interaction during the phosphotransfer between receptor and response regulator [29]. The fact that the kinetics remain undisturbed upon the addition of ATP or the interacting response regulator allows to suggest that this protein–protein interaction occurs in the P fr state of the CphA or CphB. With the finding of two new receptor proteins in Calothrix sp., associated with two response regulators, the principle of detection and response to external stimuli is farther extended into the prokaryotic phylum and illustrates the broad spread of light-driven two-component signal transduction. ACKNOWLEDGEMENTS We thank Tanja Berndsen, Gu ¨ l Koc and Helene Steffen, Max-Planck- Institut fu ¨ r Strahlenchemie, Mu ¨ lheim an der Ruhr, for their technical assistance. This work was financially supported by the Institut Pasteur and the CNRS URA 1129 and by the Fonds der Chemischen Industrie (B. Q.). REFERENCES 1. Kendrick, R.E. & Kronenberg, G.H.M., eds (1994) Photo- morphogenesis in Plants, 2nd edn. Kluwer Academic Publishers, Dordrecht, the Netherlands. 2. Quail, P.H. (1997) The phytochromes: a biochemical mechanism of signaling in sight? Bioessays 19, 571–579. 3. Braslavsky, S.E., Ga ¨ rtner, W. & Schaffner, K. (1997) Phyto- chrome photoconversion. Plant Cell Env. 20, 700–706. 4. Tandeau de Marsac, N. (1983) Phycobilisomes and complement- ary chromatic adaptation in cyanobacteria. Bull. Inst Pasteur 81, 201–254. 5. Tandeau de Marsac, N. & Houmard, J. (1993) Adaptation of cyanobacteria to environmental stimuli – new steps towards molecular mechansims. FEMS Microbiol. Rev. 104, 119–190. 6. Grossman, A.R., Schaefer, M.R., Chiang, G.G. & Collier, J.L. (1994) The responses of cyanobacteria to environmental condi- tions: light and nutritients. In The Molecular Biology of Cyano- bacteria (Bryant, D.A., ed.), pp. 641–675. Kluwer Academic Publishers, New York. 7. Fujita, Y., Murakami, A., Aizawa, K. & Ohki, K. (1994) Short- term and long-term adaptation of the photosynthetic apparatus: homeostatic properties of thylakoids. In The Molecular Biology of Cyanobacteria (Bryant, D.A., ed.), pp. 677–692. Kluwer Academic Publishers, New York. 8. Kaneko, T., Sato, S., Kotani, H., Tanaka, A., Asamizu, E., Nakamura, Y., Miyajima, N., Hirosawa, M., Sugiura, M., Sasa- moto, S., Kimura, T. et al. (1996) Sequence analysis of the genome of the unicellular cyanobacterium Synechocystis sp. strain PCC6803. II. Sequence determination of the entire genome and assignment of potential protein-coding regions. DNA Res. 3, 109–136. 9. Hughes, J., Mittmann, F., Wilde, A., Ga ¨ rtner, W., Bo ¨ rner, T., Hartmann, E. & Lamparter, T. (1997) A prokaryotic phyto- chrome. Nature 386, 663. 10. Park, C M., Shim, J Y., Yang, S S., Kang, J G., Kim, J I., Luka, Z.A. & Song, P S. (2000) Chromophore–apoprotein interactions in Synechocystis sp PCC6803 phytochrome Cph1. Biochemistry 39, 1409–1412. 11. Kehoe, D.M. & Grossmann, A.R. (1996) Similarity of a chromatic adaptation sensor to phytochrome and ethylene receptors. Science 273, 1409–1412. 12. Cobley, J.G., Zerweck, E., Reyes, R., Mody, A., Seludo-Unson, J.R., Jaeger, H., Weerasuriya, S. & Navankasattusas, S. (1993) Construction of shuttle plasmids which can be effectively mobi- lized from Escherichia coli into the chromatically adapting cya- nobacterium, Fremyella diplosiphon. Plasmid 30, 90–105. 13. Jiang, Z.Y., Swem, L.R., Rushing, B.G., Devanathan, S., Tollin, G. & Bauer, C.E. (1999) Bacterial photoreceptor with similarity to photoactive yellow protein and plant phytochromes. Science 285, 406–409. 14. Davis, S.J., Vener, A.V. & Vierstra, R.D. (1999) Bacter- iophytochromes: Phytochrome-like photoreceptors from non- photosynthetic eubacteria. Science 286, 2517–2520. 15. Bhoo, S.H., Davis, S.J., Walker, J.M., Karniol, B. & Vierstra, R.D. (2001) Bacteriophytochromes are photochromic histidine kinases using a biliverdin chromophore. Nature 414, 776–779. 16. Lamparter, T., Mittmann, F., Ga ¨ rtner, W., Bo ¨ rner, T., Hart- mann, E. & Hughes, J. (1997) Characterization of recombinant phytochrome from the cyanobacterium Synechocystis. Proc. Natl Acad. Sci. USA 94, 11792–11797. 17. Remberg,A.,Lindner,I.,Lamparter,T.,Hughes,J.,Kneip,C., Hildebrandt, P., Braslavsky, S.E., Ga ¨ rtner, W. & Schaffner, K. (1997) Raman spectroscopic and light-induced kinetic character- ization of a recombinant phytochrome of the cyanobacterium Synechocystis. Biochemistry 36, 13389–13395. 18. Yeh, K C., Wu, S H., Murphy, J.T. & Lagarias, J.C. (1997) A cyanobacterial phytochrome two-component light sensory system. Science 277, 1505–1508. 19. Parkinson, J.S. & Kofoid, E.C. (1992) Communication modules in bacterial signaling proteins. Annu. Rev. Genet. 26, 71–112. 20. Wurgler-Murphy, S.M. & Saito, H. (1997) Two-component signal transducers and MAPK cascades. Trends Biochem. Sci. 22, 172–176. 2670 H. J. M. M. Jorissen et al. (Eur. J. Biochem. 269) Ó FEBS 2002 21. Herdman, M., Coursin, T., Rippka, R., Houmard, J. & Tandeau de Marsac, N. (2000) A new appraisal of the prokaryotic origin of eukaryotic phytochromes. J. Mol. Evol. 51, 205–213. 22. Rippka, R., Deruelles, J., Waterbury, J.B., Herdman, M. & Stanier, R.Y. (1979) Generic assignments, strain histories and properties of pure cultures of cyanobacteria. J. Gen. Microbiol. 111, 1–61. 23. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular Cloning, 2nd edn. Cold Spring Harbor Laboratory Press, New York. 24. Dower, W.J., Miller, J.F. & Ragsdale, C.W. (1988) High efficiency transformation of E. coli by high voltage electroporation. Nucleic Acids Res. 16, 6127–6145. 25. Mazel,D.,Guglielmi,G.,Houmard,J.,Sidler,W.,Bryant,D.A. & Tandeau de Marsac, N. (1986) Green light induces transcription of the phycoerythrin operon in the cyanobacterium Calothrix 7601. Nucleic Acids Res. 14, 8279–8290. 26. Remberg, A., Schmidt, P., Braslavsky, S.E., Ga ¨ rtner, W. & Schaffner, K. (1999) Differential effects of mutations in the chro- mophore pocket of recombinant phytochrome on chromoprotein assembly and P r -to-P fr photoconversion. Eur. J. Biochem. 266, 201–208. 27. Lamparter, T., Esteban, B. & Hughes, J. (2001) Phytochrome Cph1 from the cyanobacterium Synechocystis PCC6803 – purifi- cation, assembly, and quaternary structure. Eur. J. Biochem. 268, 4720–4730. 28. Schmidt,P.,Gensch,T.,Remberg,A.,Ga ¨ rtner, W., Braslavsky, S.E. & Schaffner, K. (1998) The complexity of the P r fi P fr phototransformation kinetics is an intrinsic property of homo- geneous native phytochrome. Photochem. Photobiol. 68, 754–761. 29. Hu ¨ bschmann, T., Jorissen, H.J.M.M., Bo ¨ rner, T., Ga ¨ rtner, W. & Tandeau de Marsac, N. (2001) Phosphorylation of proteins in the light-dependent signalling pathway of a filamentous cyano- bacterium. Eur. J. Biochem. 268, 3383–3389. 30. Jorissen, H.J.M.M., Quest, B., Lindner, I., Tandeau de Marsac, N. & Ga ¨ rtner, W. (2002) Phytochromes with non- covalently bound chromophores: The capability of apophyto- chromes to direct tetrapyrrole photoisomerization. Photochem. Photobiol. 75, 554–559. 31. Lindner, I., Braslavsky, S.E., Schaffner, K. & Ga ¨ rtner, W. (2000) Model studies of phytochrome photochromism: Protein- mediated photoisomerization of a linear tetrapyrrole in the absence of covalent binding. Angew. Chem. Int., ed. Engl. 39, 3269–3271. 32. Hu ¨ bschmann, T., Bo ¨ rner,T.,Hartmann,E.&Lamparter,T. (2001) Characterization of the Cph1 holo-phytochrome from Synechocystis sp. PCC 6803. Eur. J. Biochem. 268, 2055–2063. Ó FEBS 2002 Light sensing two component systems in Calothrix (Eur. J. Biochem. 269) 2671 . cphA:forward,GCGATA CCATGG TATCCGAATTCCAAG and reverse, ACCCGG GTCG ACTCAGTGATGGTGGTGATGGTGTCCTCGACC AAAAAGATC; rcpA:forward,GCGATA GAATTCATG AGCGTAGAAACGGAAGAC and reverse, CGAAGCTT GTCGACTCAGTGATGGTGGTGATGGTGCTCCG ACGGCAATGTCG;. cphBlong:forward,GCGATA GAA TTCATGTTGCAGTTAATTTATAACAATT; the reverse primer was identical to that used for cphB; rcpB:forward, GAGGCT GAATTCATGGTAGGAAACGCTACTCAAC; reverse,