2-Hydroxyisocaproyl-CoA dehydratase and its activator from Clostridium difficile Jihoe Kim, Daniel Darley and Wolfgang Buckel Laboratorium fu ¨ r Mikrobiologie, Fachbereich Biologie, Philipps-Universita ¨ t, Marburg, Germany 2-Hydroxyacyl-CoA dehydratases are the key enzymes in the fermentation pathways of 12 proteinogenous amino acids to ammonia, CO 2 , short chain fatty acids and in some cases molecular hydrogen [1]. In Acidami- nococcus fermentans (Clostridiales), Clostridium sym- biosum and Fusobacterium nucleatum glutamate is oxidized to 2-oxoglutarate and ammonia, reduced to (R)-2-hydroxyglutarate and transformed to (R)-2-hy- droxyglutaryl-CoA, which is reversibly dehydrated to (E)-glutaconyl-CoA. Subsequent decarboxylation leads to crotonyl-CoA, which disproportionates to acetate, butyrate and H 2 [2]. The 2-hydroxyglutaryl-CoA dehy- dratase, also called component D, requires activation by component A, the activator or initiator, which transfers one electron to the dehydratase concomitant with hydrolysis of ATP. It has been postulated that further transfer of the electron to the substrate initiates the syn-elimination of water via radical intermediates [3,4]. Upon completion of the catalytic cycle the elec- tron is thought to be recycled to the next incoming substrate enabling many turnovers without further ATP hydrolysis. The extremely oxygen-sensitive com- ponent A from both, A. fermentans [5] and F. nuclea- tum [6], are homodimeric enzymes with one [4Fe )4S] cluster bound between the two subunits, with each capable of binding one ATP. The dehydratases also contain [4Fe)4S] clusters; the enzymes from A. fermen- tans [7] and F. nucleatum [8] contain one, whereas in the enzyme from C. symbiosum two such clusters have been detected [9]. Components D from A. fermentans and C. symbiosum are heterodimers and contain in addition to the [4Fe)4S] cluster about one mole of riboflavin-5¢-phosphate (FMN) as well as small amounts of riboflavin and molybdenum [7,9]. In con- trast, the dehydratase from F. nucleatum lacks FMN and molybdenum but contains riboflavin and is Keywords ATP; iron–sulfur; leucine fermentation; electron recycling; radical mechanism Correspondence W. Buckel, Laboratorium fu ¨ r Mikrobiologie, Fachbereich Biologie, Philipps-Universita ¨ t, 35032 Marburg, Germany Fax: +49 6421 28 28979 Tel: +49 6421 28 21527 E-mail: buckel@staff.uni-marburg.de (Received 4 August 2004, revised 12 November 2004, accepted 22 November 2004) doi:10.1111/j.1742-4658.2004.04498.x The hadBC and hadI genes from Clostridium difficile were functionally expressed in Escherichia coli and shown to encode the novel 2-hydroxyiso- caproyl-CoA dehydratase HadBC and its activator HadI. The activated enzyme catalyses the dehydration of (R)-2-hydroxyisocaproyl-CoA to isocaprenoyl-CoA in the pathway of leucine fermentation. The extremely oxygen-sensitive homodimeric activator as well as the heterodimeric dehy- dratase, contain iron and inorganic sulfur; besides varying amounts of zinc, other metal ions, particularly molybdenum, were not detected in the dehy- dratase. The reduced activator transfers one electron to the dehydratase concomitant with hydrolysis of ATP, a process similar to that observed with the unrelated nitrogenase. The thus activated dehydratase was separ- ated from the activator and ATP; it catalyzed about 10 4 dehydration turn- overs until the enzyme became inactive. Adding activator, ATP, MgCl 2 , dithionite and dithioerythritol reactivated the enzyme. This is the first demonstration with a 2-hydroxyacyl-CoA dehydratase that the catalytic electron is recycled after each turnover. In agreement with this observation, only substoichiometric amounts of activator (dehydratase ⁄ activator ¼ 10 mol ⁄ mol) were required to generate full activity. Abbreviations FldA, CoA-transferase; FldBC, phenyllactyl-CoA dehydratase; FMN, riboflavin-5¢-phosphate; HadBC, 2-hydroxyisocaproyl-CoA dehydratase; HadI, initiator, activator or archerase of HadBC; ICP-AES, inductively coupled plasma-atomic emission spectroscopy. 550 FEBS Journal 272 (2005) 550–561 ª 2004 FEBS composed of three subunits [8]; the extra subunit is not related to any known protein [10]. Besides 2-hydroxyglutaryl-CoA dehydratases, enz- ymes catalyzing the dehydration of lactyl-CoA to acry- loyl-CoA from Clostridium propionicum [11,12] and phenyllactyl-CoA to cinnamoyl-CoA from Clostridium sporogenes [13] have also been purified. Whereas the lactyl-CoA dehydratase system resembles that of 2-hy- droxyglutaryl-CoA dehydratase from C. symbiosum, phenyllactyl-CoA dehydratase (FldBC) forms a com- plex with a highly specific class III CoA-transferase (FldA). The complex FldABC catalyses the overall dehydration of (R)-phenyllactate to cinnamate in the presence of catalytic amounts of cinnamoyl-CoA after activation by ATP, MgCl 2 and a reducing agent medi- ated by FldI [13,14]. Our studies with phenyllactate dehydratase revealed a similar arrangement of homo- logous genes in the genome of Clostridium difficile, designated as hadA, hadI, hadB and hadC, for hydroxy- acyl-CoA dehydratase [13]. Upstream of hadA an open reading frame in the opposite direction (ldhA) was detec- ted encoding a putative d-2-hydroxy acid dehydrogenase (Fig. 1). We speculated that these genes could be involved in the fermentation of leucine, the pre- ferred substrate of C. difficile [14,15]. Three moles of leucine are fermented by this organism to a mixture of fatty acids; two moles of leucine are reduced to isocaproate, whereas one mole is oxidized to isovalerate and CO 2 (Eqn 1) ([16,17]; for structures, see Fig. 2). 3 lÀLeucine þ 2H 2 O ¼ 3NH þ 4 þ CO 2 þ isovalerate À þ 2 isocaproate À Eqnð1Þ DG°¢ ¼ )146 kJÆreaction )1 [18]. A proposed pathway is shown in Fig. 2. The forma- tion of isocaproate should proceed via the dehydration of (R)-2-hydroxyisocaproyl-CoA to 2-isocaprenoyl- CoA. In this paper we describe the expression of hadI and hadBC in Escherichia coli and characterize the respective gene products as functional activator ⁄ initiator and 2-hydroxyisocaproyl-CoA dehydratase, respectively. Fig. 1. Gene arrangement for the 2-hydroxyisocaproyl-CoA dehydra- tase system of C. difficile. ldhA, hydroxyisocaproate dehydroge- nase; hadA, isocaproyl-CoA: 2-hydroxyisocaproate CoA-transferase; hadI, activator of the dehydratase; hadBC, dehydratase, acdB; acyl- CoA dehydrogenase; etfBA, electron transferring flavoprotein Fig. 2. Proposed L-leucine fermentation pathway of C. difficile. LdhA, (R)-2-hydroxy- isocaproate dehydrogenase; HadA, isocaproyl-CoA: 2-hydroxyisocaproate CoA-transferase; HadI, activator of dehydra- tase; HadBC, 2-hydroxyisocaproyl-CoA dehydratase; Fd – , reduced ferredoxin. J. Kim et al. 2-Hydroxyisocaproyl-CoA dehydratase FEBS Journal 272 (2005) 550–561 ª 2004 FEBS 551 Results Cloning of the genes, hadI and hadBC The genes, hadI for activator or initiator and hadBC for the two subunits of the dehydratase, were identified in the gene cluster of the putative 2-hydroxyisocap- royl-CoA dehydratase system of C. difficile as des- cribed earlier [14]. For gene cloning, PCR primers were designed on the basis of identified ORFs. In the case of hadI and hadB the second in frame ATG start codons were chosen, because their distance of nine and seven nucleotides, respectively, from the Shine–Dal- garno sequences [19] were similar to those in the ldhA, hadA and hadC genes (Fig. 3). The primers for cloning into the expression vectors (pASK-IBA7 or 3) con- tained a cleavage site for the restriction enzyme BsaI and provided an 8-amino acid Strep-tag II peptide (Trp-Ser-His-Pro-Gln-Phe-Glu-Lys) on the C-terminal ends of the proteins for one-step purification. The nuc- leotide sequence (810 bp) of the cloned hadI showed two nucleotide substitutions at C303fiT and A645fiG, but the encoded 266 amino acids were 100% identical to those of the sequence from the Sanger Center (see acknowledgement), GenBank acces- sion number AY772815. The genes hadB and hadC encoding the two subunits of the dehydratase were amplified as one fragment and cloned into pASK- IBA3 giving Np3 BC. The nucleotide sequence of the cloned hadBC was composed of 2354 bp encoding 783 amino acids; three silent nucleotide substitutions were found at G285fiA, T870fiC and T2003fiC, GenBank accession number AY772816. Activator of 2-hydroxyisocaproyl-CoA dehydratase, HadI HadI was identified by homology analysis with the known activators of C. sporogenes (FldI) and A. fermentans (HgdC) showing 55 and 51% amino acid sequence identities, respectively. Similar to HgdC [7] and FldI [14], HadI was produced in E. coli through gene expression and purified by affinity chromatography, because these activators are extre- mely sensitive against oxygen and difficult to purify in sufficient amounts from the original organism. In order to produce the activator of 2-hydroxyisocaproyl- CoA dehydratase HadI from C. difficile, E. coli cells harbouring the Np3I plasmid were grown and induced under anaerobic conditions. The harvested cells were opened by a French Press to avoid heating the sensi- tive enzyme by sonication and the produced protein fused with a C-terminal Strep-tag II peptide was puri- fied by one-step affinity column. The pure activator was eluted in buffer (see Experimental procedures) containing 1 mm ADP and 10 mm MgCl 2 to maintain stability (Fig. 4). By chemical analysis, 4 ± 0.5 nonh- eme iron and 2 ± 0.1 acid-labile sulfur were detected indicating one [4Fe)4S] cluster in the isolated protein. The low observed sulfur content presumably resulted from loss of H 2 S during storage of the extremely labile [4Fe)4S] protein. The UV-visible spectrum of the puri- fied activator as isolated showed a maximum around 370 nm (Fig. 5). Reduction of the [4Fe)4S] 2+ cluster with 11 equivalents of dithionite gave a shoulder around 420 nm concomitant with a 20% decrease in Fig. 3. Nucleotide sequences around the ribosome binding site and start codons of the genes. The ribosome binding sites and the start codons are shown in bold letters. Abbreviations of the genes are as described in Fig. 1. The number of nucleotides shows the nucleotide space between ribosome binding site and start codon. By using the italicized start codons no active proteins could be obtained. Fig. 4. Purification of recombinant HadI, activator of dehydratase. SDS ⁄ PAGE (15%) stained with Coomassie brilliant blue. M, molecular mass marker; CFE, cell-free extract induced with anhydrotetracycline, 200 lgÆL )1 ; FT, flow through from the column; Ac, purified activator. 2-Hydroxyisocaproyl-CoA dehydratase J. Kim et al. 552 FEBS Journal 272 (2005) 550–561 ª 2004 FEBS absorbance and the appearance of second shoulder between 500 and 600 nm. A 10-fold excess of thionine oxidized HadI (as isolated) with a maximum around 400 nm. Oxidized (% 1s )1 ) well as reduced HadI (% 2s )1 ) showed low ATPase activities. But in the presence of the dehydratase (20 lg HadBC ⁄ mL) reduced HadI (1.0 lgÆmL )1 ) catalyzed the hydrolysis of ATP very efficiently (50 s )1 ), almost independent of whether the substrate was added (45 s )1 ). 2-Hydroxyisocaproyl-CoA dehydratase (HadBC) An E. coli cell-free extract containing the recombinant dehydratase produced from the hadBC genes showed by SDS ⁄ PAGE thick protein bands around the 43-kDa molecular mass marker, which were not seen in the extract of noninduced E. coli cells. A dehydra- tase activity of 9 UÆmg )1 , equal to that in the C. difficile cell-free extract, was obtained. Unfortu- nately, the produced protein could not be purified using the affinity column, probably because the Strep- tag II peptide at the C-terminus of the HadC subunit was buried inside the protein and could not bind to the column. The dehydratase was therefore purified from C. difficile cell-free extracts by three chromatog- raphy columns (Table 1). SDS ⁄ PAGE of the purified enzyme showed two protein bands (calculated masses of two subunits, HadB ¼ 46 578 Da and HadC ¼ 42 350 Da) just below the 43 kDa protein molecular mass marker (Fig. 6). On a gel filtration column, the enzyme eluted at a size (% 90 kDa) corresponding to the heterodimer (89 kDa). The N-terminal amino acid sequences of two subunits determined by the Edman degradation method revealed that the upper band was the slightly smaller HadC (MEAILSKMKE) and the lower band the somewhat larger HadB (SEKKE ARVVI) confirming the correct start codon. The UV- visible spectrum of purified 2-hydroxyisocaproyl-CoA dehydratase showed a typical spectrum of iron–sulfur Fig. 5. UV-visible spectra of purified activator of the dehydratase, HadI. Solid line, as isolated (4.2 mgÆmL )1 ); dotted line, reduced with a 10-fold excess of dithionite in 50 m M Mops pH 7.0, 10 mM MgCl 2 ,1mM ADP and 5 mM dithiothreitol (0.5 mgÆmL )1 ; eightfold amplified); dashed line, oxidized with a 10-fold excess of thionine in the same buffer condition (0.5 mgÆmL )1 ; eightfold amplified). Excess reductant or oxidant was removed by desalting through Sephadex G-25 columns. Table 1. Purification of 2-hydroxyisocaproyl-CoA dehydratase from C. difficile and E. coli. Step Protein (mg) Activity (U) Specific activity (UÆmg )1 ) Enrichment (fold) Yield (%) C. difficile cell-free extract a 700 6300 9 1 100 DEAE Sepharose 140 3220 23 3 51 Phenyl Sepharose 50 2250 45 5 36 Q-Sepharose 17 2210 130 15 35 E. coli cell-free extract b 153 1363 9 1 100 DEAE Sepharose 43 887 21 2 65 Phenyl Sepharose 6 593 99 11 44 a Starting from 15 g wet cell paste; b 6 g wet cell paste. Fig. 6. SDS ⁄ PAGE of purified 2-hydroxyisocaproyl-CoA dehydratase (HadBC). The gel was (8%) stained with Coomassie brilliant blue. M, molecular mass marker; lanes 1–3, purified protein. J. Kim et al. 2-Hydroxyisocaproyl-CoA dehydratase FEBS Journal 272 (2005) 550–561 ª 2004 FEBS 553 cluster(s) (Fig. 7). Chemical analysis revealed 5.7 ± 0.1 nonheme iron and 6.1 ± 0.5 acid-labile sul- fur. Metal contents were also estimated by inductively coupled plasma atomic emission spectroscopy (ICP- AES, model Optima 3000, PerkinElmer, Rodgau-Ju ¨ ge- sheim, Germany). Two preparations of the dehydratase were analyzed. The iron content was estimated as 3.8 and 4.1 mol ⁄ mol homodimer; cobalt, nickel and molybdenum were absent (< 0.01), but surprisingly stoichiometric amounts of zinc were found in the pre- parations, 1.1 and 1.9 molÆmol )1 , respectively. The supernatant of the enzyme after treatment with anoxic 0.2 m trichloroacetic acid showed a characteristic UV- visible spectrum of oxidized flavin (peaks at 370 nm and 450 nm), but no significant flavin content (< 5% of the dehydratase) was detected by HPLC comparing with FMN, FAD and riboflavin standards. After oxi- dation with air the UV-visible spectrum of the super- natant showed a new peak at 300 nm and a shoulder around 325 nm, which could not be assigned to any known cofactor. Probably this absorption was due to oxidized iron sulfide. Using the same method as applied for the purifica- tion of the 2-hydroxyisocaproyl-CoA dehydratase from cell-free extracts of C. difficile, the recombinant enzyme with a nonfunctional Strep-tag at the C-termi- nus of the C-subunit could be also obtained in pure form from E. coli. The properties of the recombinant dehydratase (V max and K m , see below) were identical to those of the enzyme from C. difficile. ICP-AES analysis revealed 5.3 iron, 3.2 zinc, 0.2 nickel and 0.08 cobalt mol ⁄ mol enzyme, but no molybdenum (< 0.01). (R)-2-Hydroxyisocaproyl-CoA dehydratase activity 2-Hydroxyisocaproyl-CoA dehydratase activity was measured in the presence of ATP, MgCl 2 , dithionite, dithiothreitol, serum albumin and activator. Addition of (R)-2-hydroxyisocaproyl-CoA started this assay and the formation of isocaprenoyl-CoA was followed at 290 nm (De ¼ 2.2 mm )1 Æcm )1 ). Due to the high absorbance of the adenine moiety of CoA, the absorb- ance maximum at 263 nm was not used. The product isocaprenoyl-CoA was identified by MALDI-TOF mass spectrometry (M r ¼ 865) and by comparison with the chemically synthesized compound. The enzyme accepted only (R)-2-hydroxyisocaproyl-CoA with the S-isomer showing less than 10% activity, which might be due to a contamination of the R-iso- mer. As an equal mixture of (R)- and (S)-2-hydroxy- isocaproyl-CoA gave only one-half of the enzymatic activity, we assume that that the S-isomer was also able to bind at the active site of the enzyme but could not be dehydrated. The apparent K m value for (R)-2-hydroxyisocaproyl-CoA was 50–80 lm and V max was determined as 110–150 UÆmg )1 (160–220 s )1 ) using different dehydratase preparations. In assays using (E)-isocaprenoyl-CoA as substrate, no activity could be observed suggesting that the dehydration is irrevers- ible under these conditions or the Z-isomer is the cor- rect product. (E)-Isocaprenoyl-CoA (400 lm) was shown to decompose slowly (5 nmolÆmin )1 ) under the assay conditions regardless whether the dehydratase was present (compare Fig. 9, in which an absorbance maximum is observed after addition 3). The product could not be identified by MALDI-TOF spectrometry. Recombinant HadI activated the dehydratase in the presence of ATP, MgCl 2 and a one-electron reducing agent titanium(III) citrate or dithionite, but the initial experiments revealed a dependence of the activity on the applied amount of activator (Fig. 8). Hence, it appeared that each dehydratase molecule required one activator molecule and ATP is hydrolyzed during every turnover. A true activator, however, should act catalyt- ically; it should be able to serve many dehydratase molecules, each of which catalyses many turnovers without further hydrolysis of ATP. Subsequent experi- ments indicated that the low dehydratase ⁄ activator ratio £ 1 required to get high activity was due to the instability of the activator in the assay mixture. The activator HadI could be stabilized with 5 mm dithio- threitol and 1 lm bovine serum albumin, probably by removing trace amounts of oxygen and preventing dis- sociation into subunits. Under these conditions a dehy- dratase ⁄ activator ratio of 10 gave an even higher dehydratase activity than a ratio of 0.2 in the absence Fig. 7. UV-visible spectra of 2-hydroxyisocaproyl-CoA dehydratase. Solid line, as isolated (1.2 mgÆmL )1 ); activated dehydratase separ- ated from activator (1.2 mgÆmL )1 ). The insert shows the difference spectrum of activated dehydratase (dashed line) minus isolated de- hydratase. The peak at 320 nm stems from dithionite. 2-Hydroxyisocaproyl-CoA dehydratase J. Kim et al. 554 FEBS Journal 272 (2005) 550–561 ª 2004 FEBS of the stabilisators (Fig. 8). The experiments indicate, however, that at a dehydratase ⁄ activator ratio of 10 a preincubation time of at least 40 min is required to reach full activity. Immediate activation was only obtained by using dehydratase⁄ activator ratios £ 0.1 (Fig. 8). In a critical experiment, 4.4 mg dehydratase was activated for 30 min in the presence of 1.0 mg activa- tor (dehydratase ⁄ activator ¼ 3), 0.4 mm ATP, 10 mm MgCl 2 ,5mm dithiothreitol and 0.1 mm dithionite in 50 mm Mops pH 7.0 (total volume 2 mL). Dehydra- tase activity was assayed by diluting a 1.0 lL sample into 0.5 mL 0.4 mm (R)-2-hydroxyisocaproyl-CoA in 50 mm Tris ⁄ HCl pH 8.0 (139 s )1 ). The active dehy- dratase was separated from its activator through a Strep-Tactin column. The tagged activator bound to the column, while the active dehydratase passed through. A 2.0 lL sample of the flow-through was assayed in the same manner as above (69 s )1 ); after two successive substrate additions the activity was almost completely lost (Fig. 9). SDS ⁄ PAGE revealed the double band of the dehydratase around 43 kDa but no band at 30 kDa indicating that > 95% of activator was removed. Activation by 0.4 mm ATP, 0.1 mm dithionite and a > 10-fold molar excess of activator immediately restored the complete activity (68 s )1 ). Hence the activated dehydratase irreversibly lost 50% of its activity during passage through the Strep-Tactin column; the remaining 13.5 pmol active enzyme dehydrated 103 nmol (R)-2-hydroxyisocap- royl-CoA (7600 turnovers) until activity ceased. After- wards by addition of activator and ATP the enzyme regained the same activity, which was measured after the passage through the affinity column. This experi- ment showed that the activated dehydratase retained its activity (a) in the absence of 0.4 mm ATP, which was diluted in the assay prior to the affinity chroma- tography to 0.8 lm; (b) after affinity chromatography at < 0.8 lm ATP and in the absence of at least 95% of the activator (dehydratase ⁄ activator > 60 and absence of stabilisators); (c) turnover causes rapid inactivation; and (d) activator and ATP recovered the activity, which was lost during turnover. The UV-vis- ible spectra between 300 and 700 nm of the dehydra- tase as isolated and after activation and affinity chromatography revealed the absorbance of a [4Fe)4S] 2+ cluster around 400 nm (Fig. 7). In the difference spectrum (insert of Fig. 7) the peak at 320 nm stems from dithionite, whereas the increase in absorbance around 400 nm may be caused by the irreversible inactivation of 50% of the dehydratase during affinity chromatography. In another experiment, in which the Strep-Tactin column was not treated with dithionite prior to the affinity chromatography (see below), the yield of active dehydratase was only 10%, but the absorbance increase around 400 nm was higher. In contrast to that expected for a reduction of a [4Fe)4S] 2+ cluster, no decrease in absorbance was observed. Fig. 8. Activation of the dehydratase by its activator. Dehydratase activities were measured in 50 m M Tris ⁄ HCl pH 8.0, 5 mM MgCl 2 , 0.1 m M dithionite, and 0.4 mM ATP, and the reactions were started by adding 200 l M (R)-2-hydroxyisocproyl-CoA at the indicated pre- incubation times. The molar ratios of dehydratase ⁄ activator were: 0.2, n; 1.0, h;10,s; 10 in the presence of 5 m M dithiothreitol and 1 l M bovine serum albumin, d. Fig. 9. The activity assay of activated dehydratase separated from the activator by passage through a Strep-Tactin column. The assay (total volume 500 lL) contained 27 pmol active dehydratase in 50 m M Tris ⁄ HCl pH 8.0 in absence of ATP, MgCl 2 , dithionite and di- thiothreitol. The reaction was started by adding 0.2 lmol of the substrate (R)-2-hydroxyisocaproyl-CoA (arrow 1). After the substrate was consumed (DA 290nm ¼ 0.455), further 2 · 0.2 lmol substrate was added at arrows 1 and 2. The activity was recovered by addi- tion of an excess amount of activator (> 10-fold), 0.4 m M ATP, 5m M MgCl 2 ,5mM dithiothreitol and 0.1 mM dithionite (arrow 3). The decrease in absorbance after 20 min was due to the instability of the product isocaprenoyl-CoA. J. Kim et al. 2-Hydroxyisocaproyl-CoA dehydratase FEBS Journal 272 (2005) 550–561 ª 2004 FEBS 555 It was suggested that 2-hydroxyisocaproyl-CoA dehydratase could be the most sensitive target of met- ronidazole [14], which has been used as an antibiotic for C. difficile infections in the human body [20]. Met- ronidazole inhibited effectively cell growth (50% inhi- bition at 10 lm) and the dehydratase activity was completely abolished at 20 lm, probably by oxidation of the activated enzyme by the nitro group of the inac- tivator [21]. Discussion The experiments described in this work clearly show that the hadIBC-genes of C. difficile encode a novel 2-hydroxyacyl-CoA dehydratase (HadBC) and its acti- vator (HadI), probably specific for the dehydration of (R)-2-hydroxyisocaproyl-CoA to isocaprenoyl-CoA, but besides the S-isomer no other substrate was tested. As the known enzymatic eliminations of water from (R)-2-hydroxyacyl-CoA to (E)-2-enoyl-CoA (R)-2-hydroxyglutaryl-CoA to (E)-glutaconyl-CoA [22] (R)-lactyl-CoA to acryloyl-CoA [23] and (R)-phenyllac- tyl-CoA to (E)-cinnamoyl-CoA [24] all occur in a syn- fashion, we assume that this will also be the case for (R)-2-hydroxyisocaproyl-CoA to (E)-2-isocaprenoyl- CoA, which, however, remains to be determined. The inability to measure the hydration of the chemically synthesized (E)-2-isocaprenoyl-CoA could be either due to the unfavourable equilibrium or due to the Z-isomer being the correct substrate. It has been shown that 2-hydroxyglutaryl-CoA dehydratase indeed catalyzed the reverse reaction. The conditions, how- ever, were different; this experiment was performed in the cell-free extract using (E)-glutaconate in the pres- ence of acetyl-CoA as substrate and the formed (R)-2- hydroxyglutarate was determined enzymatically [22]. The 2-hydroxyisocaproyl-CoA dehydratase fits well into the proposed pathway of leucine fermentation by C. difficile. In addition we showed that ldhA encodes a fairly specific NAD-dependent (R)-2-hydroxyisocapro- ate dehydrogenase (GenBank accession number AY772817) and hadA a highly specific class III [25] 2-hydroxyisocaproate CoA-transferase using (R)-2-hy- droxyisocaproyl-CoA and (E)-isocaprenoate, probably as well as isocaproate as substrates (GenBank acces- sion number AY772818) [26]. The genes acdB, etfB and etfA, downstream of hadBC, are related to those of an acyl-CoA dehydrogenease and an electron-trans- ferring flavoprotein, which most likely are involved in the reduction of isocaprenoyl-CoA to isocaproyl-CoA. Finally the CoA-transferase HadA may liberate the product isocaproate (Figs 1 and 2). An ambiguous step is the conversion of leucine to 2-oxoisocaproate, which may proceed via amino transfer to 2-oxoglutarate fol- lowed by dehydrogenation of the formed glutamate (Fig. 2) or by a direct one-step oxidative deamination of leucine. Although the arrangement of the hadAIBC genes are very similar to those involved in the dehy- dration of (R)-phenyllactate to (E)-cinnamate [13], a stable complex of the 2-hydroxyisocaproyl-CoA dehy- dratase (HadBC) with the CoA-transferase (HadA) could not be detected, as both enzymes separate during purification. The requirement of activator (HadI), dehydratase (HadBC), ATP, Mg 2+ , dithiothreitol and dithionite for the activity of 2-hydroxyisocaproyl-CoA dehydra- tase indicates that this enzyme acts by the same mech- anism as that proposed for 2-hydroxyglutaryl-CoA dehydratase [27] (Fig. 10). The reduced activator trans- fers one electron to the dehydratase concomitant with hydrolysis of ATP. Although the stoichiometry of 1 or 2 ATP ⁄ electron remains to be determined, the homo- dimeric structure of the activator with one [4Fe)4S] cluster and two ATP binding sites strongly suggests 2 ATP ⁄ electron as observed with nitrogenase [28]. The reduced dehydratase transfers the electron further to the substrate to generate the ketyl radical anion I, which expels the adjacent hydroxyl group. The formed enoxy radical can now be deprotonated at the b-posi- tion to the product-related ketyl radical anion II, which is oxidized to isocaprenoyl-CoA by the next incoming substrate 2-hydroxyisocaproyl-CoA, whereby the electron is recycled. It has been calculated that the extremely high pK of the b-protons of 2-hydroxyiso- caproyl-CoA (% 40), is lowered by 26 units to pK ¼ 14 in the enoxy radical [29]. This fairly low pK could be even further decreased to about 7 by hydrogen Fig. 10. Proposed mechanism of dehydration from (R)-2-hydroxyiso- caproyl-CoA to (E)-2-isocaprenoyl-CoA. For protein abbreviations, see Fig. 2. 2-Hydroxyisocaproyl-CoA dehydratase J. Kim et al. 556 FEBS Journal 272 (2005) 550–561 ª 2004 FEBS bonds from backbone amides of the enzyme to the carbonyl oxygen and thus gets into the range of the pK of carboxylates or imidazolyl residues of the enzyme [30]. One major support for this mechanism comes from experiments described in this work. For the first time it has been shown that catalytic amounts of activator (HadBC ⁄ HadI ¼ 10 mol ⁄ mol) are sufficient to get maximum dehydratase activity. This important finding was due to the development of a direct spectrophoto- metric assay of the dehydratase and to the improved stability of HadI through the addition of serum albu- min and dithiothreitol. In previous work an assay with six auxiliary enzymes was used and hence gave only qualitative data [8,31]. Furthermore, the activated dehydratase could be separated from the activator and retained its activity for almost 10 4 turnovers. This experiment clearly demonstrated that ATP and Mg 2+ are only required for activation and ATP is not used to phosphorylate the hydroxyl group in order to facili- tate the elimination as suggested in the early work on lactyl-CoA dehydratase. The authors Anderson and Wood [32] have already addressed the energetic enigma if each dehydration would require one ATP, this means in the case of C. difficile that generation of one ATP by substrate-level phosphorylation consumes two ATP (Fig. 2 and Eqn 1). Therefore it was proposed that one ATP must be sufficient to activate the dehy- dratase for at least 100 turnovers [1], which has now been experimentally verified. The activated enzyme may become inactivated simply by one-electron oxida- tion with traces of oxygen or by a second electron transfer to a radical intermediate, which would result in isocaproyl-CoA rather than isocaprenoyl-CoA as product, but according to the measured turnover only one in 10 4 . The inactivation by substrate is reminiscent of coenzyme B 12 -dependent mutases. The suicide inac- tivation of b-lysine 5,6-aminomutase is caused by the substrate-induced one electron transfer from cob(II)alamin to the 5¢-deoxadenosyl radical resulting in the inactive pair of cob(III)alamin and 5¢-deoxyadenosine [33]. In our publications on 2-hydroxyglutaryl-CoA dehy- dratase [1,3,4], the terms component A and component D were used, A for activator and D for dehydratase, implicating that only both components together are able to form an active enzyme. The important result that even in the absence of activator the activated 2-hydroxyisocaproyl-CoA dehydratase is catalytically active has consequences for the nomenclature. From this paper onward we will call component A just activator or archerase [1] and component D just dehydratase. Previous work on 2-hydroxyglutaryl-CoA dehydra- tase showed that the activator alone had ATPase activ- ity (4–6 s )1 ) but only in the oxidized state [3]. The results in this work, which revealed low ATPase activ- ities of the activator HadI regardless of its oxidation state, question those data. Therefore the original data obtained with the activator of 2-hydroxyglutaryl-CoA dehydratase have been re-calculated and found too high by a factor of 10. Furthermore, repetition of the ATPase measurements with the activator from A. fer- mentans by applying the conditions used in this work also gave only low activities (M Hetzel & W Buckel, unpublished results). Addition of dehydratase to the corresponding reduced activator, however, gave high ATPase activities; in case of HadI + HadBC up to 50 UÆmg )1 activator was achieved. These results fit much better to the proposed mechanism, as the elec- tron should only be transferred in a complex of both proteins driven by ATP hydrolysis. Another important result of this work is the finding that 2-hydroxyisocaproyl-CoA dehydratase, the 2-hyd- roxyacyl-CoA dehydratase with highest ever-observed activity (up to 220 s )1 ), contains no molybdenum and hardly any flavin. Therefore these two cofactors seem not to play important roles also in t he other 2 -hydroxy- acyl-CoA dehydratases. Molybdenum may be an impurity that could not be separated from 2-hydroxy- glutaryl-CoA dehydratase and flavin (FMN and ⁄ or riboflavin) could bind fortuitously. Interestingly, crude preparations of 2-hydroxyisocaproyl-CoA dehydratase obtained from C. difficile do contain molybdenum, which is removed during further purification without decreasing the activity. The only prosthetic group of the dehydratase, which after activation could carry the catalytic electron, is a putative [4Fe)4S] cluster, whose structure remains to be determined by spectroscopic and crystallographic methods. The failure to see the reduction of the cluster in the active dehydratase by a decrease in absorbance at 400 nm may be due to the concomitant increase in absorbance of half of the dehydratase irreversibly inactivated during separation from its activator. This cluster must have a very negat- ive redox potential (E 0 ¢ ¼ <) 600 mV), as no activity could be observed after treatment of the inactive dehy- dratase with excess dithionite or titanium(III) citrate in the absence of the activator HadI and ATP. On the other hand this cluster cannot be very unusual, as it is synthesized by enzymes not only present in C. difficile but also in E. coli [34] as shown by the functional heterologous expression of the hadBC genes. The role of zinc, if any, remains to be established. Hence, 2-hydroxyisocaproyl-CoA dehydratase and its activator appear as simple iron–sulfur proteins without any J. Kim et al. 2-Hydroxyisocaproyl-CoA dehydratase FEBS Journal 272 (2005) 550–561 ª 2004 FEBS 557 special cofactors or rare elements. Owing to this sim- plicity, one may conclude that 2-hydroxyacyl-CoA de- hydratases have evolved very early during the emergence of life [35], probably with an unknown ana- bolic rather than a catabolic function. Experimental procedures Materials C. difficile (DSMZ 1296 T ) was purchased from the Deut- sche Sammlung fu ¨ r Mikroorganismen und Zellkulturen (DMSZ, Braunschweig, Germany) and E. coli, BL21-Co- donPlus(DE3)-RIL strain for gene expression was obtained from Stratagene (Heidelberg, Germany). The affinity col- umn, Strep-Tactin MacroPrep was purchased from IBA GmbH (Go ¨ ttingen, Germany). The enzymes for molecular biology were obtained from New England Biolabs (Frank- furt am Main, Germany), ABgene (Hamburg, Germany) and Amersham Biosciences (Freiburg, Germany). Primers were purchased from MWG (Ebersberg, Germany). Protein molecular mass markers and DNA size markers were obtained from Amersham Biosciences. Experiments under anoxic conditions Purification of the activator and 2-hydroxyisocaproyl-CoA dehydratase were performed at 15–20 °C in an ‘Anaerobic Chamber’ (Coy Laboratories, Ann Arbor, MI, USA) under a nitrogen atmosphere containing 5% H 2 . Oxygen was removed from buffers for enzyme purification by boiling and cooling under vacuum. Afterwards the buffers were flushed with nitrogen, transferred to the anaerobic chamber, and stirred overnight. In the chamber, 2 mm dithiothreitol was added to each buffer. Enzyme activity was determined inside the anaerobic chamber with an Ultrospec 4000 spec- trophotometer from Amersham Biosciences. Chemicals and synthesis of CoA-esters (R)-2-Hydroxyisocaproate and (S)-2-hydroxyisocaproate were obtained from d- and l-leucine, respectively, by treat- ment of the corresponding amino acids with sodium nitrite in dilute sulfuric acid [36]. (E)-2-Isocaprenoate (4-methyl- trans-2-pentenoic acid) was synthesized from isobutyralde- hyde and malonic acid in pyridine-piperidine [37]. (R)- and (S)-2-Hydroxyisocaproyl-CoA and (E)-2-isocaprenoyl-CoA were prepared from the corresponding acids following the modified anhydrous 1,1¢-carbonyldiimidazole synthesis [38]. Gene cloning Routine manipulation of plasmid DNA, PCR, the construc- tion of recombinant plasmids and isolation of chromosomal DNA from C. difficile were performed using standard techniques [39]. The ORF hadI was amplified with follow- ing primers: FhadI, 5¢-ATGGTAGGTCTCAAATGTACA CAATGGGATTAGATATAGGTTC-3¢; RhadI, 5¢-ATGG TAGGTCTCAGCGCTTATATTTTTCACTTCTTTTTGT GATTCT-3¢. PCR was performed using proof reading polymerase, Extensor Hi-Fidelity PCR Enzyme Mix (ABgeneÒ, Ham- burg, Germany) and the amplified fragment was cloned into the BsaI restriction site [GGTCTC(N) 1 ] of the expression vector pASK-IBA3 providing a C-terminal Strep-tag II pep- tide (Trp-Ser-His-Pro-Gln-Phe-Glu-Lys) fused protein. The plasmid construct, pASK-IBA3::hadI, was named Np3I. The ORF hadBC was amplified with following primers: FhadBC, 5¢-ATGGTAGGTCTCAAATGTCTGAAAAAAAAGAAG CTAGAGTAGT-3¢; RhadBC, 5¢-ATGGTAGGTCTCAG CGCTCGCTAAACTCATCATCTCAGCAAA-3¢. The amplified fragment using proofreading polymerase was cloned into the BsaI restriction site of pASK-IBA3 giv- ing Np3 bc. In order to exclude reading errors of the polymerase, three different clones from three different PCR products were sequenced. The sequencing primers labelled at their 5¢ end with the infrared dye IRD-41 were obtained from MWG-Biotech (Ebersberg, Germany). Gene expression and purification of the activator Plasmid constructs, Np3I or Np3 BC, were transformed into E. coli BL21-CodonPlus(DE3)-RIL harbouring addi- tional rare codon tRNA genes (arg, ileY and leuW), in order to express the relevant genes. An overnight preculture (100 mL) of a fresh single colony was used to inoculate 2 L Standard I medium (Merck, Darmstadt, Germany) contain- ing antibiotics (ampicillin, 100 lgÆmL )1 , and chlorampheni- col, 50 lgÆmL )1 )at30°C (or room temperature for Np3 BC) under anoxic conditions. When the culture reached the mid-exponential phase, A 590 ¼ 0.5–0.7, gene expression was induced with anhydrotetracycline (200 lgÆL )1 ). After another 3 h growth, the culture was transferred to the anaerobic chamber. Cells were harvested by centrifugation in airtight bottles, washed and suspended in 50 mm Mops pH 7.0, 300 mm NaCl, 10 mm MgCl 2 , and 5mm dithiothreitol. Cells in serum bottles tightly closed with rubber stoppers were transferred through a needle into the French Press operating at 140 MPa. After the cell deb- ris had been removed by ultracentrifugation at 100 000 g for 1 h, the supernatant was loaded on a 5 mL Strep-Tactin MacroPrep column, which was equilibrated with the buffer used for suspending the cells. After loading, the column was washed with at least 10 column volumes of equilibra- tion buffer and the enzyme was eluted with equilibration buffer containing 3 mm d-desthiobiotin and 1 mm ADP. Afterwards d-desthiobiotin was removed by gel filtration on Sephadex G-25 equilibrated with 50 mm Mops pH 7.0, 1mm ADP, 10 mm MgCl 2 and 5 mm dithiothreitol. 2-Hydroxyisocaproyl-CoA dehydratase J. Kim et al. 558 FEBS Journal 272 (2005) 550–561 ª 2004 FEBS Purification of 2-hydroxyisocaproyl-CoA dehydratase from C. difficile C. difficile cells were cultivated as described before [40] in 2 L tightly closed bottles containing anoxic defined medium [41] supplemented with l-leucine (1 gÆL )1 ; 7.6 mm). Cells were harvested, washed and suspended in buffer A contain- ing 50 mm Mops pH 7.0 and 2 mm dithiothreitol, yield 3 g wet cell paste. The preparation of the cell free extract was performed as that described in the activator purification. The cell free extract was filtered (0.45 lm pore size) and loaded a DEAE-Sepharose fast-flow column (3 · 10 cm) equilibrated with buffer A. The column was washed with 70 mL buffer A and the proteins were eluted at a rate of 3mLÆmin )1 with a linear gradient of 0–1.0 m NaCl in buf- fer A. The active brown fractions were eluted around 0.4 m NaCl. An equal volume of 2.0 m (NH 4 ) 2 SO 4 in buffer A was added to the pooled fractions from the first column, which were then loaded on a phenyl-Sepharose column (3 · 10 cm) equilibrated with buffer B, 50 mm Mops pH 7.0, 1.0 m (NH 4 ) 2 SO 4 ,2mm dithiothreitol. After wash- ing the column with 70 mL buffer B, the active brown dehydratase eluted around 0.1 m (NH 4 ) 2 SO 4 with a linear gradient of 1.0–0 m (NH 4 ) 2 SO 4 in buffer B at a rate of 3mLÆmin )1 . The dehydratase fractions were concentrated on an Amicon PM 30 cell and desalted against buffer A, then loaded on a Q-Sepharose column (1.8 · 10 cm) equili- brated with buffer A. After a washing step with 60 mL buf- fer A, the dehydratase was eluted around 0.5 m NaCl with a linear gradient of 0–1.0 m NaCl in buffer A at a rate of 3mLÆmin )1 . The dehydratase was finally concentrated with an Amicon Ultra-4 PLTK Ultracel-Pl (30 kDa cut-off). The recombinant 2-hydroxyisocaproyl-CoA dehydratase from E. coli was purified by the same method, as the enzyme was not absorbed at the Strep-Tactin MacroPrep column. After the phenyl-Sepharose column the enzyme was already pure and therefore the Q-Sepharose column could be omitted. Determination of enzyme activity 2-Hydroxyisocaproyl-CoA dehydratase activity was meas- ured using a continuous direct assay based on the difference between the extinction coefficients of 2-hydroxyisocaproyl- CoA and 2-isocaprenoyl-CoA at 290 nm (De ¼ 2.2 mm )1 Æ cm )1 ). The dehydratase was incubated for 5 min with an equal molar amount of recombinant activator in the presence of 50 mm Tris ⁄ HCl pH 8.0, 5 mm MgCl 2 , 0.4 mm ATP, 0.1 mm dithionite or titanium(III) citrate, 5 mm dithiothreitol and 1 lm bovine serum albumin in a total volume of 0.5 mL. The assay was started by the addition of 200 lm (R)-2-hydroxyisocaproyl-CoA and the absorbance increase was followed at 290 nm. The ATPase activity of the activator was measured using a coupled assay with pyruvate kinase and lactate dehydrogenase [42]. The cuvette, total volume 0.5 mL, contained 50 mm Tris ⁄ HCl pH 8.0, 1 mm phosphoenolpyruvate, 10 mm MgCl 2 ,1mm ATP, 0.2 mm NADH, 2 U pyruvate kinase and 2 U lactate dehydrogenase. After adding the activator, the absorbance decrease of NADH was followed at 340 nm (e ¼ 6.3 mm )1 Æcm )1 [43]). Analysis of CoA-thiol esters by MALDI-TOF mass spectrometry The molecular mass of a CoA ester produced in an enzymatic or chemical reaction was confirmed by MALDI-TOF mass spectrometry. The reaction was acidified with 1 m HCl to pH < 4.0 and loaded on Sep-pak Ò C 18 cartridge (Waters, Eschborn, Germany), which was equilibrated with 0.1% tri- fluoroacetic acid. The column was washed with five column- volumes of 0.1% trifluoroacetic acid and the CoA-thiol ester was eluted with 5 mL 1% trifluoroacetic acid in 50% aceto- nitrile. After evaporation of the acetonitrile under vacuum, a drop of the CoA-thiol ester solution was applied on a thin layer of indole-2-carboxylic acid on a golden plate prepared from a solution of 300 mm indole-2-carboxylic acid in acet- one and measured under the described conditions [44]. Separation of activated dehydratase from its activator Dehydratase (4.4 mg) was activated by 1.0 mg activator in the presence of 50 mm Mops pH 7.0, 0.4 mm ATP, 5 mm MgCl 2 ,5mm dithiothreitol, and 0.1 mm dithionite (total volume 2.0 mL) as described in activity assay but in the absence of bovine serum albumin. After 30-min incubation at room temperature, 1.0 lL was assayed for activity with- out further activation and the reaction mixture was loaded on a 5 mL Strep-Tactin MacroPrep column, previously reduced with 50 mm Mops pH 7.0, 5 mm dithiothreitol and 0.1 mm dithionite and equilibrated with 50 mm Mops pH 7.0, 300 mm NaCl, 10 mm MgCl 2 and 5 mm dithiothre- itol. The tagged activator was bound to the column while the dehydratase-containing flow through was collected in 1 mL fractions. An UV-visible spectrum was taken from the peak fraction (1.2 mg dehydrataseÆmL )1 ), which was also analyzed for activity. Therefore a 2 lL aliquot was added to 50 mm Tris ⁄ HCl pH 8.0 and the reaction was started with 0.2 lmol (R)-2-hydroxyisocaproyl-CoA, total volume 0.5 mL, d ¼ 1 cm. After the reaction had ceased, two additional 0.2 lmol (R)-2-hydroxyisocaproyl-CoA aliquots were added. Finally the enzyme was reactivated by 0.1 mm dithionite, 0.4 mm ATP, 5 mm MgCl 2 and 5 mm dithiothreitol and 30 lg activator (added last). On an SDS ⁄ polyacrylamide gel, to which 20 lL of the separated dehydratase were applied, the double band of the dehydra- tase (40 kDa) but no trace of the activator (30 kDa) was visible. J. Kim et al. 2-Hydroxyisocaproyl-CoA dehydratase FEBS Journal 272 (2005) 550–561 ª 2004 FEBS 559 [...]... Molecular characterization of phenyllactate dehydratase and its initiator from Clostridium sporogenes Mol Microbiol 44, 49–60 15 Bader J, Rauschenbach P & Simon H (1982) On a hitherto unknown fermentation path of several amino acids by proteolytic clostridia FEBS Lett 140, 67–72 16 Elsden SR & Hilton MG (1978) Volatile acid production from threonine, valine, leucine and isoleucine by clostridia Arch Microbiol... Harbor, NY Selmer T & Andrei PI (2001) p-Hydroxyphenylacetate decarboxylase from Clostridium difficile: a novel glycyl radical enzyme catalysing the formation of p-cresol Eur J Biochem 268, 1363–1372 Karasawa T, Ikoma S, Yamakawa K & Nakamura S (1995) A defined growth medium for Clostridium difficile Microbiology 141, 371–375 Jaworek D & Welsch J (1985) Adenosine 5¢-diphosphate and adenosine 5¢-monophosphate.. .2-Hydroxyisocaproyl-CoA dehydratase Determination of the molecular mass The apparent molecular masses of the enzymes were determined by gel filtration on a Superdex 200 column (1 · 30 cm) in 150 mm NaCl and 50 mm Tris ⁄ HCl, pH 8.0 at a flow rate of 0.5 mLÆmin)1 Amylase, aldolase, bovine serum albumin, catalase and cytochrome c were used for calibration The molecular mass standards were obtained from. .. lactyl-CoA dehydratase Bioorganic Chem 21, 118–126 24 Pitsch C & Simon H (1982) The stereochemical course of the water elimination from (2R)-phenyllactate in the amino acid fermentation of Clostridium sporogenes, Hoppe Seyler’s Z Physiol Chem 363, 1253–1257 25 Heider J (2001) A new family of CoA-transferases FEBS Lett 509, 345–349 26 Kim J (2004) On the enzymatic mechanism of 2-hydroxyisocaproyl-CoA dehydratase. .. 2-Hydroxyglutaryl-CoA -Dehydratase aus Fusobacterium nucleatum, Diploma Thesis, PhilippsUniversitat Marburg, Germany ¨ 7 Hans M, Buckel W & Bill E (2000) The iron–sulfur clusters in 2-hydroxyglutaryl-CoA dehydratase from Acidaminococcus fermentans: biochemical and spectroscopic investigations Eur J Biochem 267, 7082–7093 8 Klees AG, Linder D & Buckel W (1992) 2-Hydroxyglutaryl-CoA dehydratase from Fusobacterium... reduction in Clostridium propionicum: purification and properties of lactyl-CoA dehydratase J Biol Chem 260, 13181–13189 12 Kuchta RD, Hanson GR, Holmquist B & Abeles RH (1986) Fe–S centers in lactyl-CoA dehydratase Biochemistry 25, 7301–7307 13 Dickert S, Pierik AJ, Linder D & Buckel W (2000) The involvement of coenzyme A esters in the dehydration of (R)-phenyllactate to (E)-cinnamate by Clostridium. .. (Universitat Bay¨ reuth, Germany) for metal analysis by ICP-AES (Bitok, ¨ BMBF project 0339476 D) Part of the DNA sequence data was produced by the Clostridium difficile Sequencing group at the Sanger Centre and can be obtained from http://www.sanger.ac.uk/Projects/C _difficile/ Several major improvements of the manuscript are due to the very helpful advice of two anonymous reviewers References 1 Kim J, Hetzel... concentration was determined with the Bio-Rad Protein Assay Bovine serum albumin was used as standard SDS ⁄ polyacrylamide gels were stained with Coomassie brilliant blue The subunits of the dehydratase were separated by SDS ⁄ PAGE, blotted and their N-termini were sequenced by Edman degradation [45] Non-heme iron [46] and acid labile sulfur [47] were determined as described Absorption spectra were recorded... purification and reconstitution of glutaconyl-CoA decarboxylase from Acidaminococcus fermentans Methods Enzymol 125, 547–558 32 Anderson RL & Wood WA (1969) Carbohydrate metabolism in microorganisms Annu Rev Microbiol 23, 539–578 33 Tang KH, Chang CH & Frey PA (2001) Electron transfer in the substrate-dependent suicide inactivation FEBS Journal 272 (2005) 550–561 ª 2004 FEBS 2-Hydroxyisocaproyl-CoA dehydratase. .. 2-Hydroxyglutaryl-CoA dehydratase from Clostridium symbiosum Eur J Biochem 265, 404–414 10 Kapatral V, Anderson I, Ivanova N, Reznik G, Los T, Lykidis A, Bhattacharyya A, Bartman A, Gardner W, Grechkin G, Zhu L, Vasieva O, Chu L, Kogan Y, Chaga O, Goltsman E, Bernal A, Larsen N, D’Souza M, Walunas T, Pusch G, Haselkorn R, Fonstein M, Kyrpides N & Overbeek R (2002) Genome sequence and analysis of the . 2-Hydroxyisocaproyl-CoA dehydratase and its activator from Clostridium difficile Jihoe Kim, Daniel Darley and Wolfgang Buckel Laboratorium. Hence, 2-hydroxyisocaproyl-CoA dehydratase and its activator appear as simple iron–sulfur proteins without any J. Kim et al. 2-Hydroxyisocaproyl-CoA dehydratase FEBS