Suppression of NADPH oxidase substantially restores glucose-induced dysfunction of pancreatic NIT-1 cells Huiping Yuan, Yonggang Lu, Xiuqing Huang, Qinghua He, Yong Man, Yingsheng Zhou, Shu Wang and Jian Li Peking University Fifth School of Clinical Medicine (Beijing Hospital), Beijing, China Keywords apoptosis; glucose; NADPH oxidase 2; NIT-1 cells; reactive oxygen species Correspondence J Li, Peking University Fifth School of Clinical Medicine (Beijing Hospital), Beijing 100730, China Fax: +86 10 65237929 Tel: +86 10 58115048 E-mail: lijian@bjhmoh.cn (Received August 2010, revised 28 September 2010, accepted 11 October 2010) doi:10.1111/j.1742-4658.2010.07911.x Defects in insulin secretion by pancreatic cells and ⁄ or decreased sensitivity of target tissues to insulin action are the key features of type diabetes It has been shown that excessive generation of reactive oxygen species (ROS) is linked to glucose-induced b-cell dysfunction However, cellular mechanisms involved in ROS generation in b-cells and the link between ROS and glucose-induced b-cell dysfunction are poorly understood Here, we demonstrate a key role of NADPH oxidase (NOX2)-derived ROS in the deterioration of b-cell function induced by a high concentration of glucose Sprague–Dawley rats were fed a high-fat diet for 24 weeks to induce diabetes Diabetic rats showed increased glucose levels and elevated ROS generation in blood, but decreased insulin content in pancreatic b-cells In vitro, increased ROS levels in pancreatic NIT-1 cells exposed to high concentrations of glucose (33.3 mmolỈL)1) were associated with elevated expression of NOX2 Importantly, decreased glucose-induced insulin expression and secretion in NIT-1 cells could be rescued via siRNA-mediated NOX2 reduction Furthermore, high glucose concentrations led to apoptosis of b-cells by activation of p38MAPK and p53, and dysfunction of b-cells through phosphatase and tensih homolog (PTEN)-dependent Jun N-terminal kinase (JNK) activation and protein kinase B (AKT/PKB) inhibition, which induced the translocation of forkhead box O1 and pancreatic duodenal homeobox-1, followed by reduced insulin expression and secretion In conclusion, NOX2-derived ROS could play a critical role in high glucoseinduced b-cell dysfunction through PTEN-dependent JNK activation and AKT inhibition Introduction Diabetes mellitus comprises a number of diseases characterized by high levels of blood glucose resulting from defects in insulin production and ⁄ or insulin action Type diabetes may account for more than 90% of all diagnosed cases of diabetes Insulin resistance first results in a disorder in which cells cannot utilize insulin properly and ⁄ or gradual loss occurs in the ability of pancreatic b-cells to produce insulin as the need for insulin increases due to elevated circulating glucose levels [1] This leads to a vicious cycle between insulin Abbreviations AKT/PKB, protein kinase B; DPI, diphenyliodinium; FAM, fluorescein amidite; FOXO1, forkhead box O1; ICAM-1, inter-cellular adhesion molecule 1; JNK, Jun N-terminal kinase; L-NAME, N G-nitro-L-arginine methyl ester; NOX, NADPH oxidase; PDX-1, pancreatic duodenal homeobox-1; PIP3, phosphatidylinositol(3,4,5)-triphosphate (PtdIns(3,4,5)P3); PTEN, phosphatase and tensih homolog; ROS, reactive oxygen species; VCAM-1, vascular adhesion molecule FEBS Journal 277 (2010) 5061–5071 ª 2010 The Authors Journal compilation ª 2010 FEBS 5061 Glucose induces dysfunction of pancreatic cells H Yuan et al Glucose level (mmol·L–1) and glucose levels termed ‘glucotoxicity’ [2] Glucotoxicity is a secondary phenomenon that is proposed to play a role in all forms of type diabetes Continuous overstimulation of b-cells by glucose could eventually lead to depletion of insulin stores, worsening of hyperglycemia, and finally deterioration of b-cell function [2] A large body of evidence shows that increased generation of reactive oxygen species (ROS) destroys the function of b-cells and the balance between glucose and insulin, suggesting a link between high glucose levels and b-cell dysfunction [3,4] However, the cellular mechanisms involved in ROS generation in b-cells and the link between ROS and glucose-induced b-cell dysfunction are poorly understood ROS are produced via multiple processes such as the mitochondrial electron transport chain, nitric oxide synthase and xanthine oxidase, as well as a family of NADPH oxidases (NOX) [5] Although the source of ROS generation in insulin-secreting pancreatic b-cells has traditionally been considered to be the mitochondrial electron transport chain, recent attention has focused on NOX enzymes as a potential source of ROS production in pancreatic b-cells, and the various isoforms that contribute to O2Ỉ) and H2O2 production under various conditions [6] It has been reported that activation of NOX plays an important role in ROS production by pancreatic b-cells during glucose-stimulated insulin secretion [7] However, the relationship between NOX and oxidative stress-mediated dysfunction of b-cells is still unclear In the present study, we demonstrate that NOX2derived ROS play a key role in the deterioration of b-cell function induced by high concentrations of A * 20 10 Results Diabetic rats show increased blood glucose levels, elevated ROS production and impaired insulin content in pancreatic cells Pancreatic b-cell functions, such as insulin biosynthesis and secretion, are often impaired under the chronic hyperglycemic conditions found in diabetes To examine the functional effects of glucotoxicity on insulin secretion, insulin gene expression and b-cell death, nine 4-week-old male Sprague–Dawley rats were fed a highfat diet containing 20% fat and 20% sucrose for 24 weeks to induce diabetes Glucose levels in the blood were significantly increased in the diabetic rats (Fig 1A), accompanied by impaired insulin synthesis (Fig 1B), suggesting deterioration of b-cell function Moreover, levels of ROS production in the pancreas of diabetic rats were significantly increased, confirming a state of oxidative stress (Fig 1C) These in vivo observations suggest that oxidative stress could contribute to dysfunction of pancreatic b-cells under diabetic conditions D-glucose leads to enhanced ROS generation, apoptosis and dysfunction of NIT-1 cells Because animal models of diabetes are complex and may be accompanied by alterations such as high levels of triglyceride, it is difficult to determine the contribution of glucose to oxidative stress and dysfunction of B 25 15 glucose Suppression of NOX2 substantially reverses glucose-induced dysfunction of pancreatic NIT-1 cells * Control Control Diabetes Diabetes * * 0 0.5 Time point (h) C Control Diabetes 5062 ROS Insulin Merge Fig Analysis of blood glucose level, insulin content and ROS generation in pancreas of diabetic rats Rats were fed a high-fat diet containing 20% fat and 20% sucrose for 24 weeks Glucose level (A), insulin content (B) and ROS production (C) in the pancreas of rats Data are means ± SEM (n = 9) *P < 0.05 for comparison with control rats by ANOVA test FEBS Journal 277 (2010) 5061–5071 ª 2010 The Authors Journal compilation ª 2010 FEBS Glucose induces dysfunction of pancreatic cells A ROS production (fold of control) 11.1 5.5 22.2 2.5 2.0 1.0 0.5 0.0 33.3 0h 6h 12 h 24 h 48 h –1 D-Glucose (33.3 mmol·L ) D 0.3 * Control Glucose 0.2 0.1 0.0 1.2 Relative quantification (fold of control) C ** * 1.5 –1 D-Glucose (mmol·L ) Insulin secretion (ng·mg–1 of cellular protein) Fig D-glucose-induced ROS generation, apoptosis and dysfunction of NIT-1 cells ROS levels increased dose- and timedependently after exposure of NIT-1 cells to )1 D-glucose (A,B) D-glucose (33.3 mmolỈL , 48 h) increased basal insulin secretion (2.5 mmolỈL)1 D-glucose) and decreased glucose stimulated insulin secretion (20 mmolỈL)1 D-glucose) in NIT-1 cells (C), reduced the insulin mRNA level as shown by real-time PCR (D), and induced apoptosis as assessed by double-staining with Annexin V and PI (E) Data are means ± SEM (n = independent experiments) *P < 0.05 and **P < 0.01 for comparison with control conditions by ANOVA test ** B ROS production (fold of control) H Yuan et al ** 1.0 0.8 0.6 0.4 0.2 0.0 Basal Control Glucose-stimulated Glucose E Neg pancreatic b-cells Therefore, the observations in vivo need to be re-assessed in vitro We investigated the effects of high concentrations of glucose on ROS production, b-cell dysfunction and apoptosis in cultured NIT-1 cells, a mouse pancreatic b-cell line First we examined whether ROS levels were altered by d-glucose treatment As shown in Fig 2A,B, ROS levels were increased in a dose- and time-dependent manner by exposure of NIT-1 cells to d-glucose To further analyze the effect of d- glucose on b-cell dysfunction, we assessed insulin expression and secretion in NIT-1 cells exposed to 33.3 mmolỈL)1 d-glucose for 48 h ELISA showed increased basal insulin secretion (2.5 mmolỈL)1 d-glucose in KRBH buffer) and decreased glucose stimulated insulin secretion (20 mmolỈL)1 d-glucose in KRBH buffer) in NIT-1 cells in response to d-glucose (Fig 2C) Moreover, insulin mRNA levels were significantly reduced in NIT-1 cells treated with d-glucose, as shown by real-time PCR (Fig 2D) These results show that exposure to d-glucose led to dysfunction of NIT-1 cells We next assessed whether d-glucose induces apoptosis of NIT-1 cells NIT-1cells were doubly stained using Annexin V and PI kit Annexin V can combine with the phosphatidylserine on the surface of the cellular membrane that is activated by very early apoptosis signals and translocated to the membrane In addition, PI stains cells that are at a later stage of apoptosis or death Figure 2E shows the apoptosis in NIT-1 cells treated with 33.3 mmolỈL)1 of d-glucose for 24 h CTRL D-Glucose Si + G PTEN-dependent JNK activation and AKT inhibition are involved in D-glucose-induced dysfunction of NIT-1 cells To assess the molecular mechanisms involved in impaired function of b-cells, we investigated several signal transduction pathways such as JNK and ERK1 ⁄ ERK1 ⁄ was not activated in d-glucose-treated NIT-1 cells (data not shown), but phosphorylation of PTEN, JNK and AKT were altered in response to d-glucose It has been reported that, under oxidative stress, PTEN is phosphorylated at 380Ser ⁄ 382 ⁄ 383Thr, leading to activation of JNK by phosphorylation at 183Thr ⁄ 185Tyr As a consequence, AKT phosphorylation is decreased through increased phosphatidylinositol (3,4,5)-triphosphate (PtdIns(3,4,5)P3) (PIP3) production [8] Therefore, we focused on PTEN-dependent JNK activation and AKT inhibition As shown in Fig 3A, phosphorylation of PTEN and JNK was elevated, but phosphorylation of AKT was reduced, in d-glucosetreated NIT-1 cells Importantly, PTEN-dependent JNK activation and AKT inhibition was rescued by transfection of siRNA-PTEN into NIT-1 cells It has been shown that oxidative stress induces the nuclear translocation of forkhead box O1 (FOXO1) through activation of the JNK pathway, leading to nucleocytoplasmic translocation of pancreatic duodenal homeobox-1 (PDX-1) [9] To further analyze the translocation of FOXO1 and PDX-1 in response to d-glucose, we isolated proteins of the nuclei and FEBS Journal 277 (2010) 5061–5071 ª 2010 The Authors Journal compilation ª 2010 FEBS 5063 Glucose induces dysfunction of pancreatic cells A si-PTEN Glucose si-PTEN + G Protein level (fold of control) Control H Yuan et al PTEN p-PTEN p-Akt Akt β-actin 1.50 Control si-PTEN Glucose si-PTEN + Glucose * * 1.25 † † 1.00 * 0.50 0.25 0.00 p-PTEN/β-actin PTEN/β-actin B C Cytoplasm † 0.75 Control PDX-1 si-PTEN Glucose si-PTEN + G Insulin β-actin β-actin Nucleus FOXO1 PDX-1 PCNA Control Glucose Protein level (fold of control) FOXO1 p-Akt/Akt 1.25 1.00 †† 0.75 0.50 ** 0.25 0.00 Control si-PTEN Glucose si-PTEN + Glucose cytoplasmic fractions of NIT-1 cells after exposure to d-glucose for 48 h Western blotting showed that the FOXO1 content decreased in the cytoplasm but increased in the nucleus In contrast, the level of PDX-1 increased in the cytoplasm but decreased in the nucleus (Fig 3B) Moreover, the d-glucose-induced decreased insulin content was reversed by down-regulation of PTEN (Fig 3C) Fig Signal transduction pathways involved in D-glucose-induced dysfunction of NIT-1 cells D-glucose (33.3 mmolỈL)1, 48 h) increased the phosphorylation of PTEN and JNK and decreased the phosphorylation of AKT This effect was reversed by transfection of siRNA-PTEN into NIT-1 cells (A) FOXO1 content was decreased in the cytoplasm but increased in the nucleus; in contrast, the level of PDX-1 was increased in the cytoplasm but decreased in the nucleus (B) siRNA-PTEN reversed D-glucose-induced impaired insulin content (C) *P < 0.05 and **P < 0.01 by ANOVA test (D-glucose versus control)  P < 0.05 and   P < 0.01 by ANOVA test (siRNAPTEN + D-glucose versus D-glucose) NIT-1 cells (Fig 4C) Moreover, d-glucose stimulated elevated expression of cytochrome c and its release from mitochondria to the cytoplasm (Fig 4C), resulting in activation of caspase-3 These observations suggest that p38MAPK and p53 mediate the apoptosis of NIT-1 cells induced by d-glucose Suppression of NOX2 substantially restores dysfunction and apoptosis of NIT-cells D-glucose-induced P38MAPK and p53 mediate the apoptosis of NIT-1 cells induced by D-glucose We next explored the molecular mechanisms involved in apoptosis of b-cells induced by d-glucose It has been reported that p38MAPK is activated by dual phosphorylation of 180Thr and 182Tyr residues, and p53 is activated by phosphorylation of 15Ser residues Phosphorylation of p38MAPK and p53 is widely held to represent its activation in response to oxidative stress In the present study, we found that exposure to d-glucose for 48 h substantially stimulated phosphorylation of p53 and p38MAPK (Fig 4A,D) It bas been suggested that NF-jB is involved in apoptosis mediated by p53 As shown in Fig 4B, d-glucose enhanced phosphorylation of I-jB at 32Ser, followed by degradation of I-jB, confirming NF-jB activation We further assessed the molecules involved in d-glucose-induced apoptosis The levels of Bcl-2 and Bax, key factors in the process of apoptosis, were measured by western blot A decreased Bcl-2 level and an increased Bax content, accompanied by the translocation of Bax into the mitochondria, were found in d-glucose-treated 5064 To investigate the potential role of the NOX family in the glucose-induced elevated ROS generation that leads to dysfunction of b-cells, we first identified the source of ROS generated in response to d-glucose by determination of the effects on d-glucose-induced ROS levels of various inhibitors of ROS-generating systems: 2.5 lmolỈL)1 diphenyliodinium (DPI), which inhibits NOX, 50 lmolỈL)1 NG-nitro-l-arginine methyl ester (l-NAME), which inhibits nitric oxide synthases, lmolỈL)1 Rotenone, which inhibits the mitochondrial respiratory chain, and 50 lmolỈL)1 oxypurinol, which inhibits xanthine oxidase As shown in Fig 5A, DPI and Rotenone, but not l-NAME or oxypurinol, significantly suppressed the generation of ROS induced by d-glucose, suggesting that NOX is a leading candidate for production of ROS in NIT-1 cells We next analyzed the expression profile of the NOX family in NIT-1 cells RT-PCR showed expression of NOX2 and its subunits, such as p22phox, p47phox, p67phox and Rac1, but not of NOX1, NOX3, NOX4 or NOX5 in NIT-1 cells (Fig 5B) Importantly, d-glucose significantly increased the expression of NOX2, FEBS Journal 277 (2010) 5061–5071 ª 2010 The Authors Journal compilation ª 2010 FEBS H Yuan et al Glucose induces dysfunction of pancreatic cells Control Glucose Protein level (fold of control) A P38 p-P38 P53 p-P53 β-actin Control Glucose ** * * p-P38/P38 B Control Glucose C p-P53/β-actin P53/β-actin Control Glucose I-κB Mito-bax p-I-κB Mito-HSP70 ICAM-1 Cyt c VCAM-1 β-actin β-actin Fig Molecular mechanisms involved in apoptosis of b-cells induced by D-glucose )1 D-glucose (33.3 mmolỈL , 48 h) stimulated the phosphorylation of p53 and p38MAPK (A) D-glucose stimulated degradation of I-jB, phosphorylation of I-jB at 32Ser, expression of ICAM-1 and VCAM-1 (B), expression and translocation of Bax (C), and release and translocation of cytochrome c (C,D) *P < 0.05 and **P < 0.01 for comparison with control conditions by ANOVA test D Negative Control Glucose Cyt c DAPI Merge but not that of p22phox, p47phox, p67phox and Rac1 (Fig 5C) NOX1, NOX3, NOX4 and NOX5 were also not expressed in d-glucose-treated NIT-1 cells (data not shown) Moreover, reduction of NOX2 by transfection of siRNA-NOX2 into NIT-1 cells significantly suppressed d-glucose-induced elevated ROS levels (Fig 5D) and apoptosis (Fig 2E), and reversed d-glucose-induced impaired synthesis and secretion of insulin (Fig 5E,F) Finally, the effects of d-glucose on activation of JNK, p38MAPK and p53 pathways were reversed by NOX2 down-regulation in NIT-1 cells (Fig 5G) Taken together, these results demonstrate that suppression of NOX2 substantially restores d-glucoseinduced dysfunction and apoptosis of NIT-1 cells Discussion Type diabetes is normally described as a multifactor-induced disease Increased glucose levels and dysfunction of pancreatic cells have been shown to be key features of type diabetes Glucotoxicity is proposed to play an important role in the pathogenesis of type diabetes In particular, pancreatic b-cell function, such as insulin biosynthesis and secretion, is often impaired under the chronic hyperglycemic conditions found in diabetes Given the weight of experimental evidence, it is now widely accepted that ROS contribute to the cell and tissue dysfunction and damage caused by ‘glucotoxicity’ in diabetes Under diabetic conditions, ROS levels are increased in many tissues and organs, leading to the progression of b-cell dysfunction in type diabetes [10] In addition, because pancreatic islet cells express a relatively low amount of anti-oxidative enzymes such as glutathione peroxidase and catalase [11], b-cells are sensitive to oxidative stress Thus, research has focused on the critical role of oxidative stress in the deterioration of b-cell function The aims of this study were to: confirm whether NOX2 is the source of ROS generated in response to FEBS Journal 277 (2010) 5061–5071 ª 2010 The Authors Journal compilation ª 2010 FEBS 5065 Glucose induces dysfunction of pancreatic cells A ROS production (fold of control) ** 2.0 ** ** ** p47phox p67phox C NOX2 1.5 p22phox 1.0 †† p47phox †† 0.5 p67phox Rac-1 0.0 l e ro nt Co ROS production (fold of control) phox NS ** D Marker NOX1 NOX2 NOX3 NOX4 Rac1 p22 B NS 2.5 H Yuan et al lu G G H SO s co + DM G aO + N G + G I DP + 1.8 1.6 1.4 1.2 0.8 0.6 0.4 0.2 n te Re G ol e on pu xy + LA rin + G O β-actin NM Control E Control Glucose si-NOX2 Glucose si-NOX2+G NOX2 * PTEN p-PTEN † Akt p-Akt Glucose – – – – + + + si-NOX2 FAM Transfection reagent – – – – – + + – – – + – – – – + – – – + – JNK p-JNK Insulin β-actin Control * si-NOX2 Protein level (fold of control) † si-NOX2 + Glucose † 1.00 15.0 Glucose * 1.25 †† †† 0.75 0.50 0.00 p-PTEN/β-actin PTEN/β-actin F * 0.3 Insulin secretion (ng·mg–1 of cellular protein) ** ** 0.25 p-Akt/Akt p-JNK/JNK protein level (fold of control) 1.50 12.5 10.0 † 7.5 5.0 2.5 0.0 Insulin/β-actin ** Control si-NOX2 Glucose si-NOX2 + Glucose Control si-NOX2 Glucose si-NOX2 + Glucose ** NS * Control Glucose si-NOX2 si-NOX2 + Glucose † 0.2 * 0.1 0.0 G Basal Control Glucose-stimulated - si-NOX2 Glucose si-NOX2 + G P38 2.5 p-P53 bcl-2 Protein level (fold of control) 2.0 P53 Control si-NOX2 Glucose si-NOX2 + Glucose ** p-P38 ** * 1.5 †† †† † p-P53/β-actin P53/β-actin 1.0 0.5 Caspase-3 0.0 β-actin p-P38/P38 high concentrations of glucose, explore the molecular mechanisms of glucotoxicity in diabetes, and define the critical role of NOX2-derived ROS in the dysfunction and apoptosis of b-cells induced by d-glucose 5066 Fig Effects of siRNA-NOX2 on D-glucose-induced production of ROS and dysfunction and apoptosis of NIT-1 cells (A) Effects on D-glucose-induced ROS generation of various inhibitors of ROS-generating systems: 2.5 lmolỈL)1 diphenyliodinium (DPI), which inhibits NOX, 50 lmolỈL)1 NG nitro-L arginine methyl ester (L NAME), which inhibits nitric oxide synthases, lmolỈL)1 Rotenone, which inhibits the mitochondrial respiratory chain, and 50 lmolỈL)1 oxypurinol, which inhibits xanthine oxidase Dimethyl sulfoxide and NaOH were used as solvent controls (B,C) Expression profile of NOX family members in NIT-1 cells without or with D-glucose treatment NIT-1 cells were transiently transfected with siRNA-NOX2 for 48 h followed by treatment with D-glucose (33.3 mmolỈL)1) for 48 h ROS production (D), insulin expression and activation of the JNK pathway (E), release of insulin (F) and activation of the p38MAPK and p53 pathways (G) were assessed Data are means ± SEM (n = independent experiments) *P < 0.05 and **P < 0.01 by ANOVA test (D-glucose versus control)   P < 0.05 and   P < 0.01 by ANOVA test (siNOX2 + D-glucose versus D-glucose) There is growing evidence suggesting that ROS are produced via multiple processes such as via NOX, the mitochondrial electron transport chain, nitric oxide synthase and xanthine oxidase The source of ROS FEBS Journal 277 (2010) 5061–5071 ª 2010 The Authors Journal compilation ª 2010 FEBS H Yuan et al generation in insulin-secreting pancreatic b-cells has traditionally been considered to be the mitochondrial electron transport chain, but recent attention has focused on NOX enzymes as a potential source of ROS production in pancreatic b-cells [6] Those authors found suppression of high glucose-induced ROS production and decreased glucose-stimulated insulin secretion by DPI in cells of the insulin-producing cell line MIN We obtained a similar result in NIT-1 cells In the present study, we found that DPI and Rotenone, but not l-NAME or oxypurinol, significantly suppressed the generation of ROS induced by d-glucose However, the possibility that ROS are also derived from the mitochondrial electron transport chain is not ruled out by our results NOX is a multicomponent enzyme comprising two membrane-associated proteins and cytosolic subunits Gp91phox was first identified in phagocytes and also termed NOX2 In connection with similar membrane-associated proteins p22phox, NOX form the catalytic core of the enzyme family by incorporating the flavocytochrome b558 complex p47phox, p67phox and the small G-protein Rac located in the cytoplasm play as regulatory role by interacting with the cytochrome The NOX family has seven known isoforms (NOX1, NOX2, NOX3, NOX4, NOX5, Duox1 and Duox2), which are localized in specific tissues and perform diverse functions [5] In the present study, RT-PCR indicated expression of NOX2 and subunits such as p22phox, p47phox, p67phox and Rac1, but not of NOX1, NOX2, NOX4 and NOX5 in NIT-1 cells Moreover, NOX2 downregulation by transfection of siRNA-NOX2 led to reduced ROS generation, reversing d-glucose-induced impaired synthesis and secretion of insulin in NIT-1 cells These observations suggest that NOX2 could be a leading candidate for production of ROS in NIT-1 cells However, whether NOX2 acts as source of ROS production in vivo, and how glucose up-regulates the expression of NOX2 requires further investigation It has been reported that NF-jB, p38MAPK and p53 are the key points relating to apoptosis [12] An inhibitor of p38MAPK was used to confirm its role in apoptosis The increased level of phosphorylation indicates that activation of p38MAPK and p53 are involved in the pathways of cell apoptosis It has been suggested that NF-jB is involved in the process of apoptosis mediated by p53 In addition, it is considered that apoptosis induced by d-glucose is mitochondriadependent A high level of glucose serves as a stimulus to release cytochrome c to the cytoplasm from mitochondrial cristae, leading to cleavage of caspase-3 [13] Our results suggest that p38MAPK and p53 mediate the apoptosis of NIT-1 cells induced by d-glucose Glucose induces dysfunction of pancreatic cells Exposure to d-glucose for 48 h substantially stimulated phosphorylation of p38MAPK and p53, accompanied by activation of NF-jB and increased expression of inter-cellular adhesion molecule (ICAM-1) and vascular adhesion molecule (VCAM-1) Moreover, a decreased Bcl-2 level and an increased Bax content, followed by release of cytochrome c and activation of caspase-3, were also found in d-glucose-treated NIT-1 cells With regard to the molecular mechanism of b-cell deterioration, it has been reported that activity of JNK pathway is abnormally elevated in various tissues under diabetic conditions [14] JNK activation is involved in the reduction of insulin gene expression in response to oxidative stress, and suppression of the JNK pathway can protect b-cells from glucose toxicity [15] In addition, the PTEN-mediated JNKdependent pathway is thought to be the main pathway with respect to dysfunction of b-cells [8] We found that phosphorylation of PTEN and JNK was elevated, but phosphorylation of AKT was reduced, in d-glucose-treated NIT-1 cells Importantly, PTENdependent JNK activation and AKT inhibition were reversed by transfection of siRNA-PTEN into NIT-1 cells It is noteworthy that d-glucose-induced JNK activation and AKT inhibition resulted in decreased phosphorylation of FOXO1 following nuclear localization and nucleocytoplasmic translocation of PDX-1, leading to reduction of insulin levels and ultimately dysfunction of b-cells It is proposed that transcription factor FOXO1 functions as a bridge between AKT and PDX-1 [16] FOXO1 was recently reported to inhibit PDX-1 gene transcription in pancreatic b-cells [17], suggesting that it is involved in the deterioration of b-cell function Moreover, FOXO1 translocation may modulate the nucleocytoplasmic translocation of PDX-1 Importantly, oxidative stress induces nuclear translocation of FOXO1 through activation of the JNK pathway, leading to nucleocytoplasmic translocation of PDX-1 It has been shown that PDX-1 functions as an accelerator of b-cell functions, such as insulin transcription, growth and proliferation The reduction of insulin gene expression in NIT-1 cells exposed to high glucose levels is accompanied by a decrease in PDX-1 expression in nuclei, implicating PDX-1 in b-cell dysfunction More interestingly, d-glucose-induced activation of JNK, inhibition of AKT and decreased phosphorylation of FOXO1, followed by nucleocytoplasmic translocation of PDX-1, was reversed by NOX2 down-regulation in NIT-1 cells, demonstrating a critical role for NOX2-derived ROS in the deterioration of b-cell function FEBS Journal 277 (2010) 5061–5071 ª 2010 The Authors Journal compilation ª 2010 FEBS 5067 Glucose induces dysfunction of pancreatic cells H Yuan et al with fluorescein isothiocyanate/horseradish peroxidaseconjugated anti-rabbit IgG at 37 °C for 60 Finally, the cover slips were mounted using 1,4-diazabicyclo[2.2.2]octane (Sigma, The Woodlands, TX, USA) Experimental procedures Animals Nine 4-week-old male Sprague–Dawley rats were fed a high-fat diet containing 20% fat and 20% sucrose for 24 weeks to induce diabetes Nine control rats were fed standard laboratory food for 24 weeks All animal procedures were performed in accordance with the National Institutes of Health Animal Care and Use Guidelines All animal protocols were approved by the Animal Ethics Committee at the Beijing Institute of Geriatrics Determination of apoptosis occurrence To assess the occurrence of apoptosis in NIT-1 cells, cells were double-stained with Annexin V and a PI kit (Baosai, Beijing, China) according to the manufacturer’s protocol Stained nuclei were immediately visualized by fluorescence microscopy Cell culture RNA isolation, RT-PCR and real-time PCR NIT-1 cells derived from mouse pancreatic b-cells (American Type Culture Collection) were cultured in low-glucose Dulbecco’s modified Eagle’s medium (5 mmolỈL)1 glucose, Gibco, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (Hyclone, Logan City, UT, USA), 100 U mL)1 penicillin (Gibco) and 0.1 mgỈmL)1 streptomycin (Gibco) at 37 °C in a humidified atmosphere of 95% O2, 5% CO2 Total RNA was isolated from NIT-1 cells using Trizol reagent (Invitrogen, Carlsbad, CA, USA) Reverse transcription was performed using lg RNA at 60 °C for 35 using a reverse transcription kit (A3500, Promega, Fitchburgm, WI, USA) containing 0.5 lg random primers, 15 units of avian myeloblastosis virus and 0.5 units of RNasin RNase inhibitor After reverse transcription, the cDNAs were used for semi-quantitative PCR using sets of specific primers as shown in Table An initial denaturation at 94 °C for was followed by 30 cycles of 94 °C for min, 60 °C for and 72 °C for RT-PCR was completed by incubation at 72 °C for Aliquots (15 lL) of the reaction mixture were run on a 1.5% agarose gel, and photographed on a UV transilluminator using a digital camera Real-time PCR was performed using an A7500 real-time thermal cycler (ABI, Foster City, CA, USA) The specific Determination of ROS Cells (3 · 105 cells per mL) were incubated with lmolặL)1 of 2Â7Â-dichlorouorescein diacetate (Sigma, The Woodlands, TX, USA) for 40 at 37 °C The 2¢7¢-dichlorofluorescein fluorescence was measured by fluorescence-activated cell sorting with excitation ⁄ emission wavelengths of 488 ⁄ 525 nm Sections of optimum cutting temperature-embedded pancreas were incubated with 10 lm dihydroethidium (Sigma) for 15 at room temperature The sections were analyzed by fluorescence microscopy Immunofluorescence and immunohistochemistry Cover slips of NIT-1 cells or sections of optimum cutting temperature-embedded pancreas of rats were incubated with polyclonal antibodies at 37 °C for 60 min, and then labeled Table Nucleotide sequences of primers used for real-time PCR Forward primer (5¢ fi 3¢) Insulin GAPDH AGGCTTTTGTCA AACAGCACCTT CGTCCCGTAGAC AAAATGGT Reverse primer (5¢ fi 3¢) ATCCACAATGCCACGCTTCTG TTGATGGCAACAATCTCCAC Table Nucleotide sequences of primers used for PCR Forward primer (5¢ fi 3¢) NOX1 NOX2 NOX3 NOX4 p22phox p47phox p67phox Rac1 b-actin 5068 Reverse primer (5¢ fi 3¢) GAAATTCTTGGGACTGCCTTGG TGGGGAAAAATAAAGGAGTGCC AGCTGCCTTATGCCCTGTACCTC GGACGTCCTGGTGGAAACTT GGAGCGATGTGGACAGAAGTA CTATCTGGAGCCCCTTGACA CCAGAAGACCTGGAATTTGTG AGACAATTTGGGCACACCTC GTGGGGCGCCCCAGGCACCA GCTGGAGAGAACAGAAGCGAGA CTCCCACTAACATCACCACCTCATA AGGCCTTCAATAACGCGCCTCTGTC GCAAACCCTTGGGTATTCTTTGG GCACCGACAACAGGAAGTG ACAGGGACATCTCGTCCTCTT AAATGCCAACTTTCCCTTTACA GCTTCGTCAAACACTGTCTTG CTCCTTAATGTCACGCACGATTTC FEBS Journal 277 (2010) 5061–5071 ª 2010 The Authors Journal compilation ª 2010 FEBS H Yuan et al Glucose induces dysfunction of pancreatic cells Table Nucleotide sequences used for RNA interference (RNAi) Negative control (FAM-siRNA) siRNA-NOX2 siRNA-PTEN Sense Antisense Sense Antisense Sense Antisense 5¢-UUCUCCGAACGUGUCACGUTT -3¢ 5¢-ACGUGACACGUUCGGAGAATT-3¢ 5¢-UGCCAGAGUCGGGAUUUCUTT-3¢ 5¢-AGAAAUCCCGACUCUGGCATT-3¢ 5¢-GTATAGAGCGTGCAGATAATT-3¢ 5¢-UUAUCUGCACGCUCUAUACTT-3¢ primers are shown in Table Amplification was performed as recommended by the manufacturer with a 25 lL reaction mixture containing 12.5 lL of SYBR Green PCR master mix (Applied Biosystems, Foster City, CA, USA), the appropriate primer concentration, and lL of cDNA Relative cDNA concentrations were established from a standard curve prepared using sequential dilutions of corresponding PCR fragments The data were normalized to results obtained for glyceraldehyde-3-phosphate dehydrogenase The amplification program included an initial denaturation step at 95 °C for 10 min, then 40 cycles of denaturation at 95 °C for 10 s and annealing and extension at 60 °C for Fluorescence was measured at the end of each extension step After amplification, melting curves were produced and used to determine the specificity of PCR products siRNA transfection siRNAs targeting mouse NOX2 or PTEN mRNA were transfected into NIT-1 cells using Tran MessengerÔ transfection reagent (Qiagen, Hilden, Germany) according to the manufacturer’s instructions A luciferase siRNA (fluorescein amidite FAM) was used as a negative control RNAi oligonucleotides for transfection are shown in Table Protein preparation of whole-cell, nuclei, cytoplasmic and mitochondrial fractions NIT-1 cells were lysed in lysis buffer containing 50 mmolỈL)1 Tris ⁄ HCl pH 8.0, 150 molỈL)1 NaCl, 0.02% NaN3, 0.1% SDS, 1% NP-40 (Fluka, Sigma-Aldrich Inc., The Woodlands, TX, USA), 100 lgỈmL)1 phenylmethanesulfonyl fluoride, lgỈmL)1 aprotinin and 0.5% sodium deoxycholate supplemented with phosphatase inhibitor cocktails and (Sigma), and sonicated for s to shear DNA Cell lysates were centrifuged at 12 000 g for 10 Supernatant was used for western blot analysis Proteins of the nucleic and cytoplasmic fractions of NIT-1 cells were prepared as described previously [9] Briefly, the cells were collected and centrifuged for 20 s in a microcentrifuge, followed by resuspension in buffer containing 10.0 mmolỈL)1 Hepes pH 7.9, 10.0 mmolỈL)1 KCl, 1.5 mmolỈL)1 MgCl2 and 0.5 mmolỈL)1 dithiothreitol After incubation at °C for 15 min, the cells were lysed using a Dounce homogenizer The suspension was centrifuged for 20 s in a microcentrifuge, and the supernatant (cytoplasmic fraction) was collected and frozen The pellet, which contained the nuclei, was resuspended in 150 lL buffer containing 20 mmolỈL)1 Hepes pH 7.9, 20% v ⁄ v glycerol, 0.1 molỈL)1 KCl, 0.2 mmolỈL)1 EDTA pH 8.0, 0.5 mmolỈL)1 dithiothreitol and 0.5 mmolỈL)1 phenylmethanesulfonyl fluoride After stirring at °C for 30 min, the nuclear extracts were centrifuged for 20 at °C in a microcentrifuge The supernatant was collected and stored at )80 °C Proteins of mitochondria from NIT-1 cells were prepared as described previously [18] Briefly, the cells were collected and lysed on ice for 30 in buffer A containing 20 mmolỈL)1 Hepes ⁄ KOH pH 7.5, 10 mmolỈL)1 KCl, 1.5 mmolỈL)1 MgCl2, mmolỈL)1 EGTA, mmolỈL)1 EDTA pH 8.0, mmolỈL)1 dithiothreitol, 0.1 mmolỈL)1 phenylmethanesulfonyl fluoride, lgỈmL)1 aprotinin and 250 mmolỈL)1 sucrose After consecutive centrifugations at 1000 g for and 10 000 g for 15 min, the pellet, which contained the mitochondrial fraction, was resuspended in buffer A and centrifuged at 100 000 g for h The supernatant was collected and stored at )80 °C Western blot analysis Cell lysates (10–30 lg protein) were separated by 10% SDS ⁄ PAGE, transferred to poly(vinylidene difluoride) membrane (Millipore, Billerica, MA, USA), blocked using 5% non-fat dry milk for 60 min, and probed with antibodies at °C overnight The blots were incubated with horseradish peroxidase-conjugated anti-IgG, followed by detection using enhanced chemiluminescence (Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA) Antibodies against p38, phosphorylated p38, JNK, phosphorylated JNK, AKT, phosphorylated AKT, phosphorylated p53, PTEN and phosphorylated PTEN were purchased from Cell Signaling (CST, 3Track Lake Danvers, MA, USA) Antibodies against NOX2, p67phox, p47phox, p22phox, Rac1, I-jB, phosphorylated I-jB, ICAM-1, VCAM-1, bcl-2, bax, cytochrome c, HSP70, p53, FOXO1, PDX-1, insulin and b-actin were obtained from Santa Cruz Measurement of insulin secretion and cellular insulin content NIT-1 cells were washed using a modified Krebs ⁄ Ringer ⁄ bicarbonate ⁄ Hepes buffer (KRBH buffer: 140 mmolỈL)1 NaCl, 3.6 mmolỈL)1 KCl, 0.5 mmolỈL)1 NaH2PO4, 0.5 mmolỈL)1 MgSO4, 1.5 mmolỈL)1 CaCl2, mmolỈL)1 NaHCO3, 10 mmolỈL)1 Hepes, 0.1% BSA, pH 7.4), and pre-equilibrated using Dulbecco’s modified Eagle’s medium containing 2.5 mmolỈL)1 glucose for h at 37 °C Cells were then incubated for 35 in KRBH buffer containing 2.5 mmolỈL)1 glucose (basal secretion) or KRBH buffer containing 20 mmolặL)1 glucose (glucose-stimulated insulin FEBS Journal 277 (2010) 50615071 ê 2010 The Authors Journal compilation ª 2010 FEBS 5069 Glucose induces dysfunction of pancreatic cells H Yuan et al secretion) Supernatants were collected and frozen for insulin assays [19,20] The content of insulin was assessed using an ELISA kit (Linco, St Charles, MO, USA) according to the manufacturer’s protocol Statistical analysis All values are represented as means ± SEM of the indicated number of measurements A one-way ANOVA test was used to determine significance, with values of P < 0.05 indicating statistical significance Acknowledgements We would like to thank Professor Yi Zhu (Peking University Health Science Center, China) for providing NIT-1 cells This work was supported by grants from the National Basic Research Program of China (2006CB 503910), the National Natural Science Foundation of China (30572082) and the Natural Science Foundation of Beijing (7052059) References Chen J, Saxena G, Mungrue IN, Lusis AJ & Shalev A (2008) Thioredoxin-interacting protein: a critical link between glucose toxicity and b-cell apoptosis Diabetes 57, 938–944 Poitout V & Robertson RP (2008) Glucolipotoxicity: fuel excess and b-cell dysfunction Endocr Rev 29, 351–366 Newsholme P, Haber EP, Hirabara SM, Rebelato EL, Procopio J, Morgan D, Oliveira-Emilio HC, Carpinelli AR & Curi R (2007) Diabetes associated cell stress and dysfunction: role of mitochondrial and non-mitochondrial ROS production and activity J Physiol 583, 9–24 Tang C, Han P, Oprescu AI, Lee SC, Gyulkhandanyan AV, Chan GN, Wheeler MB & Giacca A (2007) Evidence for a role of superoxide generation in glucoseinduced b-cell dysfunction in vivo Diabetes 56, 2722–2731 Bedard K & Krause KH (2007) The NOX family of ROS-generating NADPH oxidases: physiology and pathophysiology Physiol Rev 87, 245–313 Newsholme P, Morgan D, Rebelato E, Oliveira-Emilio HC, Procopio J, Curi R & Carpinelli A (2009) Insights into the critical role of NADPH oxidase(s) in the normal and dysregulated pancreatic beta cell Diabetologia 52, 2489–2498 Morgan D, Rebelato E, Abdulkader F, Graciano MFR, Oliveira-Emilio HR, Hirata AE, Rocha MS, Bordin S, Curi R & Carpinelli AR (2009) Association of NAD(P)H oxidase with glucose-induced insulin secretion by pancreatic b-cells Endocrinology 150, 2197–2201 5070 Song P, Wu Y, Xu J, Xie Z, Dong Y, Zhang M & Zou MH (2007) Reactive nitrogen species induced by hyperglycemia suppresses Akt signaling and triggers apoptosis by upregulating phosphatase PTEN (phosphatase and tensin homologue deleted on chromosome 10) in an LKB1-dependent manner Circulation 116, 1585–1595 Kawamori D, Kaneto H, Nakatani Y, Matsuoka TA, Matsuhisa M, Hori M & Yamasaki Y (2006) The forkhead transcription factor Foxo1 bridges the JNK pathway and the transcription factor PDX-1 through its intracellular translocation J Biol Chem 281, 1091–1098 10 Nishikawa T, Edelstein D, Du XL, Yamagishi S, Matsumura T, Kaneda Y, Yorek MA, Beebe D, Oates PJ, Hammes HP et al (2000) Normalizing mitochondrial superoxide production blocks three pathways of hyperglycaemic damage Nature 404, 787–790 11 Tiedge M, Lortz S, Drinkgern J & Lenzen S (1997) Relation between antioxidant enzyme gene expression and antioxidative defense status of insulin-producing cells Diabetes 46, 1733–1742 12 Maedler K, Schulthess FT, Bielman C, Berney T, Bonny C, Prentki M, Donath MY & Roduit R (2008) Glucose and leptin induce apoptosis in human b-cells and impair glucose-stimulated insulin secretion through activation of c-Jun N-terminal kinases FASEB J 22, 1905–1913 13 Martinez SC, Tanabe K, Cras-Meneur C, Abumrad NA, Bernal-Mizrachi E & Permutt MA (2008) Inhibition of Foxo1 protects pancreatic islet b-cells against fatty acid and endoplasmic reticulum stress-induced apoptosis Diabetes 57, 846–859 14 Hirosumi J, Tuncman G, Chang L, Gorgun CZ, Uysal KT, Maeda K, Karin M & Hotamisligil GS (2002) A central role for JNK in obesity and insulin resistance Nature 420, 333–336 15 Kawamori D, Kajimoto Y, Kaneto H, Umayahara Y, Fujitani Y, Miyatsuka T, Watada H, Leibiger IB, Yamasaki Y & Hori M (2003) Oxidative stress induces nucleo-cytoplasmic translocation of pancreatic transcription factor PDX-1 through activation of c-Jun NH2-terminal kinase Diabetes 52, 2896–2904 16 Glauser DA & Schlegel W (2007) The emerging role of FOXO transcription factors in pancreatic b cells J Endocrinol 193, 195–207 17 Nakae J, Biggs WH III, Kitamura T, Cavenee WK, Wright CV, Arden KC & Accili D (2002) Regulation of insulin action and pancreatic b-cell function by mutated alleles of the gene encoding forkhead transcription factor Foxo1 Nat Genet 32, 245–253 18 Nijhawan D, Fang M, Traer E, Zhong Q, Gao W, Du F & Wang X (2003) Elimination of Mcl-1 is required for the initiation of apoptosis following ultraviolet irradiation Genes Dev 17, 1475–1486 FEBS Journal 277 (2010) 5061–5071 ª 2010 The Authors Journal compilation ª 2010 FEBS H Yuan et al 19 Wang H, Kouri G & Wollheim CB (2005) ER stress and SREBP-1 activation are implicated in b-cell glucolipotoxicity J Cell Sci 118, 3905–3915 20 Yang JY, Walicki J, Abderrahmani A, Cornu M, Waeber G, Thorens B & Widmann C (2005) Expres- Glucose induces dysfunction of pancreatic cells sion of an uncleavable N-terminal RasGAP fragment in insulin-secreting cells increases their resistance toward apoptotic stimuli without affecting their glucose-induced insulin secretion J Biol Chem 280, 32835–32842 FEBS Journal 277 (2010) 5061–5071 ª 2010 The Authors Journal compilation ª 2010 FEBS 5071 ... apoptosis of NIT-1 cells induced by d-glucose Suppression of NOX2 substantially restores dysfunction and apoptosis of NIT -cells D -glucose-induced P38MAPK and p53 mediate the apoptosis of NIT-1 cells. .. FEBS Journal 27 7 (20 10) 5061–5071 ª 20 10 The Authors Journal compilation ª 20 10 FEBS Glucose induces dysfunction of pancreatic cells A ROS production (fold of control) 11.1 5.5 22 .2 2.5 2. 0 1.0 0.5... levels of triglyceride, it is difficult to determine the contribution of glucose to oxidative stress and dysfunction of B 25 15 glucose Suppression of NOX2 substantially reverses glucose-induced dysfunction