Characterization of heme-binding properties of Paracoccus denitrificans Surf1 proteins Achim Hannappel 1 , Freya A. Bundschuh 1 and Bernd Ludwig 1,2 1 Molecular Genetics Group, Institute of Biochemistry, Goethe University Frankfurt, Frankfurt am Main, Germany 2 Cluster of Excellence Macromolecular Complexes, Frankfurt am Main, Germany Introduction Cytochrome c oxidase (COX; also kown as cyto- chrome aa 3 or complex IV) is a key player in cellular respiration: as the terminal redox complex of the elec- tron transport chain, it reduces molecular oxygen to water and couples the free energy of this reaction to the generation of a transmembrane proton gradient. The mitochondrial enzyme consists of up to 13 subun- its, of which only the key subunits I–III are encoded in the organelle genome. These very subunits are also found in the corresponding bacterial oxidases and share both structural and functional homologies. Sub- unit I, as the core of the enzyme, houses two heme a moieties (heme a and a 3 ) and a copper ion [1,2]. The biosynthetic pathway of heme a cofactor syn- thesis starts with the conversion of heme b to heme o by the addition of a farnesyl side chain. This reaction is catalysed by the enzyme heme o synthase, named Cox10 in eukaryotes and CtaB in bacteria [3]. In a subsequent step, the C-8 methyl group of heme o is oxidized to a formyl group catalysed by heme a synthase, termed Cox15 in eukaryotes and CtaA in bacteria [3]. The Bacillus subtilis CtaA homolog is the best-studied variant to date, but its exact cofactor- binding stoichiometries and enzymatic mechanism is still unresolved [4–6]. With its eight transmembrane helices, heme a synthase is supposed to provide two different heme-binding sites, one for the heme b redox cofactor and one where the substrate heme o may bind and be oxidized to heme a [6]. The assembly factor Surf1 has long been known for its involvement in oxidase biogenesis. Its functional loss leads to Leigh syndrome in humans, a severe Keywords CtaA; cytochrome c oxidase; heme a synthase; Leigh syndrome; oxidase assembly Correspondence B. Ludwig, Institute of Biochemistry, Goethe University Frankfurt, Max-von-Laue- Strasse 9, D-60438 Frankfurt am Main, Germany Fax: +49 69 798 29244 Tel: +49 69 798 29237 E-mail: ludwig@em.uni-frankfurt.de Website: http://www.biochem. uni-frankfurt.de/ (Received 8 February 2011, revised 4 March 2011, accepted 14 March 2011) doi:10.1111/j.1742-4658.2011.08101.x Biogenesis of cytochrome c oxidase (COX) is a highly complex process involving >30 chaperones in eukaryotes; those required for the incorpora- tion of the copper and heme cofactors are also conserved in bacteria. Surf1, associated with heme a insertion and with Leigh syndrome if defec- tive in humans, is present as two homologs in the soil bacterium Paracoc- cus denitrificans, Surf1c and Surf1q. In an in vitro interaction assay, the heme a transfer from purified heme a synthase, CtaA, to Surf1c was followed, and both Surf proteins were tested for their heme a binding pro- perties. Mutation of four strictly conserved amino acid residues within the transmembrane part of each Surf1 protein confirmed their requirement for heme binding. Interestingly the mutation of a tryptophan residue in trans- membrane helix II (W200 in Surf1c and W209 in Surf1q) led to a drastic switch in the heme composition, with Surf1 now being populated mostly by heme o, the intermediate in the heme a biosynthetic pathway. This tryp- tophan residue discriminates between the two heme moieties, apparently coordinates the formyl group of heme a, and most likely presents the cofactor in a spatial orientation suitable for optimal transfer to its target site within subunit I of cytochrome c oxidase. Abbreviation COX, cytochrome c oxidase. FEBS Journal 278 (2011) 1769–1778 ª 2011 The Authors Journal compilation ª 2011 FEBS 1769 neurodegenerative disorder characterized by lesions in the central nervous system [7–9]. Patients suffer a 80– 90% loss of COX activity in all tissues and the assem- bly process is stalled at intermediate levels [10]. The yeast homolog Shy1p is one of the best-characterized Surf1 homologs and studies point at a stabilizing role in early assembly intermediates containing both the core subunits I and II [11–13]. Analysis of purified COX from surf1 deletion mutants in a bacterial background showed that the loss of oxidase activity is attributed to a disturbed heme a incorporation into COX subunit I, particularly affecting the level of heme a 3 [14,15]. The soil bacte- rium Paracoccus denitrificans encodes two different Surf1 homologs, with Surf1c specifically acting on the aa 3 -type cytochrome c oxidase, and Surf1q exclusively serving the ba 3 -type quinol oxidase [15]. In addition, we showed that both Paracoccus Surf proteins indeed bind heme a, both in vivo and in vitro, with a 1 : 1 stoichiometry and affinities in the submicromolar range. A conserved periplasmically located histidine residue near the second transmembrane helix is the presumed ligand for the central iron atom, because a histidine-to-alanine mutant showed strongly diminished heme a affinities [16]. A corresponding mutation in the yeast homolog Shy1p resulted only in modest growth impairment on nonfermentable carbon sources, in line with diminished levels, but no complete loss of heme affinities [17]. In early oxidase assembly events, a triple contribu- tion of Surf1 may be imagined: (a) modulation of heme a synthase activity by abstracting the enzymatic end product, (b) supply of an readily available protein- bound heme a pool, and (c) incorporation of heme a into oxidase subunit I. In this study, we show that Surf1 specifically receives heme a from heme a synthase under in vitro condi- tions. We further investigated highly conserved resi- dues within the transmembrane part of the Surf1 protein and show that they all contribute to heme binding in either bacterial version of the Surf1 protein, with a strategic tryptophan residue possibly interacting with the formyl group of heme a. Results Lacking the machinery for the final step in heme a bio- synthesis, Escherichia coli is well suited for heterologous expression experiments of biogenesis factors involved in heme a delivery to COX: E. coli cells neither encode a Surf1 homolog nor provide the heme a-synthesizing machinery and therefore offer a genetic background that allows well-defined analysis of interactions between these components. In an earlier study, we showed that the Surf1 proteins from Paracoccus denitrificans can bind heme a under in vivo conditions when coexpressed in E. coli together with the heme a-biosynthesizing enzymes CtaB and CtaA [16]. To further investigate whether CtaA is the interaction partner for Surf1 and thereby directly supplies the cofactor, we characterized the CtaA protein on a purified level. The P. denitrificans CtaA protein was heterologously expressed in E. coli to low levels under the control of the constitutive tet promoter. As judged by SDS ⁄ PAGE analysis, the protein is isolated to > 95% pur- ity via a TEV-cleavable C-terminal hexahistidine tag (Fig. S1). Depending on the presence or absence of CtaB, as well as on the growth conditions (high aera- tion in baffled flasks vs. limiting aeration in standard flasks), the protein is obtained in one of three spec- trally distinct forms: b-form, bo-form and ba-form (Figs S2 and S3). The b-form is acquired when the protein is expressed in the absence of CtaB; the bo-form in the presence of CtaB under limiting oxygen conditions; the ba-form in the presence of CtaB and high aeration (Table S1). Heme a is specifically transferred from CtaA to Surf1 in vitro The ba-form of CtaA, carrying predominatly hemes b and a, but also traces of heme o, was further used in an in vitro heme transfer assay. For this, purified CtaA and apo-Surf1c were mixed in a 1 : 2 molar ratio and after 1 h of incubation at room temperature reseparat- ed via immobilized metal-affinity chromatography. Both proteins are recovered efficiently with only minor cross-contaminations of CtaA in the Surf1c fraction (Fig. 1A). Redox spectra (dithionite minus ferricya- nide) taken under native conditions clearly show that CtaA specifically loses heme a during incubation with apo-Surf1c (Fig. 1B). The heme a peak maximum at 592.5 nm is decreased by  66%, whereas the heme b peak at 560 nm remains unchanged. However, Surf1c specifically takes up heme a exhibiting an absorption maximum at 595 nm not present in its apo-form before incubation with CtaA (Fig. 1C). The small shoulder at 560 nm in the Surf1c fraction after incuba- tion is caused by the minor cross-contamination with CtaA visible in the polyacrylamide gel. This transfer assay clearly shows that both proteins transiently interact in vitro and that during this interac- tion heme a is specifically transferred from its site of synthesis in CtaA to Surf1c. A conserved Trp specifies heme a binding in Surf1 A. Hannappel et al. 1770 FEBS Journal 278 (2011) 1769–1778 ª 2011 The Authors Journal compilation ª 2011 FEBS Heme binding of Surf1 mutants Earlier expression studies of wild-type Surf1 proteins in E. coli, in the presence of CtaB and CtaA, con- tained next to heme a also small amounts of heme o in Surf1, a fact interpreted as unspecific binding under the expression conditions chosen [16]. Indeed the for- mation of heme a in the recombinant E. coli cells is highly sensitive to aeration levels as CtaA can be purified with different heme compositions (Figs S2 and S3). In order to circumvent spectral impurities caused by nonoptimal expression conditions in E. coli, we chan- ged to an autoinductive medium [18]. Expression in autoinductive medium offers some advantages favour- ing heme a biosynthesis in the heterologous E. coli sys- tem: expression of Surf1 is induced at higher cell densities and expression times are prolonged, allowing the heme a biosynthesis enzymes CtaB and CtaA to match the higher expression levels observed for Surf1. Indeed, the change to autoinductive medium avoids such spectral impurities for the Surf1 wild-type pro- teins and yields homogenous preparations containing heme a as sole heme species (see below). In native redox spectra, absorption maxima of 595 nm for wild- type Surf1c and 600 nm for wild-type Surf1q are obtained, as described previously [16]. To determine the heme-binding properties of the Surf1 proteins, several conserved amino acid residues were mutated that locate within the transmembrane helices near the periplasmic side of the membrane. The chosen residues (Table 1) are the only ones fully con- served in a comparison of 61 different Surf1 sequences found in the KEGG database (http://www.genome.jp/ kegg/). Their side chains may serve as ligands for func- tional groups such as propionates or the formyl side chain of heme a. In the design of the mutations, care Fig. 1. In vitro heme a transfer from CtaA to Surf1c. Purfied CtaA and apo-Surf1c were mixed in a 1 : 2 molar ratio and separated after 1 h of incubation at room temperature via immobilized metal- affinity chromatography. A Coomassie Brilliant Blue stained SDS ⁄ polyacrylamide gel of 1 lg protein per lane (A) shows the pro- teins before (b.t.) and after (a.t.) the transfer. Native redox differ- ence spectra of 20 l M CtaA (B) and Surf1c (C) are shown. A comparison of the spectra taken before (b.t., dotted line) and after (a.t., solid line) the transfer shows a diminished heme a con- tent for CtaA, whereas heme b remains unaffected. The transferred heme a is found in the Surf1c fraction (a.t., solid line) that did not contain any heme before transfer (b.t., dotted line). Fig. 2. Gel electrophoresis of purified Paracoccus denitrificans Surf1 mutant proteins. Coomassie Brilliant Blue-stained 12% SDS ⁄ polyacrylamide gel of Surf1 mutant proteins after purification via immobilized metal affinity chromatography. Approximately 2.5 lg of protein was loaded per lane. A. Hannappel et al. A conserved Trp specifies heme a binding in Surf1 FEBS Journal 278 (2011) 1769–1778 ª 2011 The Authors Journal compilation ª 2011 FEBS 1771 was taken to introduce conservative mutations to avoid disturbing the overall structural determinants and to merely tackle their potential electron-donor functions involved in hydrogen bonding. The mutated proteins were heterologously expressed in autoinductive medium in the presence of CtaA and CtaB and purified via their N-terminal decahistidine tag, as described previously [16]. All proteins were obtained without major impurities (Fig. 2). In the sam- ples of Surf1c Q25A and Surf1q Q26A, a potential degradation product can be seen at low molecular mass that does not stain in a Western blot against the decahistidine tag (not shown). Native redox spectra reveal that all mutants are impaired in their heme a content compared to wild- type. The mutants W24F, Q25A, H193A and Y196F (Surf1c nomenclature) completely lack any heme a, the same being observed for the corresponding Surf1q mutants. By contrast, mutation of a tryptophan in the second transmembrane helix (W200F for Surf1c, W209F for Surf1q) resulted in a peak maximum differ- ing from the wild-type proteins (558 nm for Surf1c W200F with a small shoulder at 595 nm; 565 nm for Surf1q with a shoulder at 600 nm). A conserved tryptophan in the second transmembrane helix of Surf1 may be responsible for heme a formyl group coordination In order to clarify the nature of the heme species in Surf1c W200F and Surf1q W209F, pyridine hemo- chrome spectra were taken under denaturing condi- tions (Fig. 4). Both mutant proteins show a peak at 552 nm and a small shoulder at 587 nm, pointing to heme types o and a. To unequivocally establish the nature of the heme species, HPLC analysis was performed. For this, puri- fied Surf1c W200F and Surf1q W209F protein was extracted with acidified acetone and hemes were analy- sed on a reversed-phase column using an acetonitrile gradient. A comparison with samples of known heme content clearly shows that both mutant proteins con- tain heme o and heme a. Assuming similar extinction coefficients in acetonitrile for the Soret for both heme o and heme a, we estimate  25% heme a and 75% heme o for Surf1c W200F, and  40% heme a and 60% heme o for Surf1q respectively. The cytochrome c oxidase defect in a D surf strain can not be rescued by Surf1c W200F Upon deletion of the surf1c gene in P. denitrificans the resulting COX is compromised in its heme content to  50% compared with wild-type levels, and COX activity is reduced to 28%. This phenotype can be res- cued by the expression of wild-type Surf1c in trans [15]. In order to assess the effect of the Surf1c W200F mutant on oxidase, COX was purified from a P. deni- trificans Dsurf1c strain expressing Surf1c W200F (con- firmed by immunescreen; not shown), and analysed enzymatically as well as spectroscopically. Surf1c W200F cannot recover oxidase activity, and the Table 1. Mutations introduced in Surf1c and Surf1q and their resulting heme composition after heterologous expression in Escherichia coli in the presence of Paracoccus denitrificans CtaB and CtaA. Heme type Surf1c Wild-type a W24F – Q25A – H193A a – Y196F – W200F o ⁄ a Surf1q Wild-type a W25F – Q26A – H202A a – Y205F – W209F o ⁄ a a Mutant first described in Bundschuh et al. [16]. Fig. 3. Native redox difference spectra of purified Surf1 mutant proteins. Native redox spectra of 50 l M purified Surf1 mutant pro- teins in the a-region for the Surf1c mutants (A) and the corresponding Surf1q mutants (B). A conserved Trp specifies heme a binding in Surf1 A. Hannappel et al. 1772 FEBS Journal 278 (2011) 1769–1778 ª 2011 The Authors Journal compilation ª 2011 FEBS enzyme is still impared in its heme content as is the deletion strain FA3 (Table 2), clearly confirming that this Surf1 mutant version is nonfunctional during oxidase assembly under in vivo conditions. Discussion Failures in cytochrome c oxidase biogenesis are a com- mon cause of respiratory deficiencies that may lead to severe diseases such as Leigh syndrome. In eukaryotic systems, an increasing number of protein factors has been associated with COX biogenesis, because power- ful genetic screening systems available for the yeast model. In bacteria, known biogenesis factors appear to be limited to those possibly involved in metal cofactor delivery to oxidase subunits [19]. Recently we estab- lished that the P. denitrificans Surf1 proteins stoichio- metrically bind heme a with submicromolar affinities [16]. In this study, we further analyse their heme- binding properties using site-directed mutagenesis and provide clear evidence for a specific interaction with heme a synthase. To establish heme a biosynthesis in E. coli, endoge- nously modifying heme b only to the level of heme o, two additional genes (ctaB and ctaA) were introduced and expressed under high aeration, as shown previously [20,21]. Here, we demonstrate that this observation is also true for the Paracoccus heme a-syn- thesizing machinery. The Paracoccus heme a synthase, CtaA, can be purified after heterologous expression in E. coli with three distinct heme cofactor compositions: b-form, bo-form and ba-form (Figs S1–S3). Only with CtaB present and under high aeration levels can CtaA be enzymatically fully active when expressed in E. coli. To our knowledge, this is the first study working with purified Paracoccus CtaA enzyme, confirmimg results obtained for the corresponding Bacillus subtilis and Rhodobacter sphaeroides enzymes [6,20]. Because Surf1 binds heme a when coexpressed in E. coli together with the heme a-synthesizing enzymes, we postulated an in vivo interaction between CtaA and Surf1 [16]. To check whether CtaA is the actual heme a source for Surf1, we followed the heme trans- fer in vitro by mixing purified CtaA and apo-Surf1c. Indeed, heme a is being taken up by Surf1 from its site of synthesis, CtaA, requiring a specific interaction between both proteins to mediate heme transfer. Stud- ies in yeast demonstrated that heme a synthase expres- sion and activity is strictly regulated [22]. In this context, Surf1 is an attractive candidate for a regula- tion of CtaA activity because it abstracts the enzymatic end product, thereby initiating a new round of heme a synthesis. In this function, Surf1 would prevent any undesirable release of heme a from CtaA, thus avoid- ing the accumulation of free heme a that would be det- rimental to the cell. As we show experimentally here, both proteins transiently interact and readily separate once the transfer process is completed (Fig. 1). Because our experimental approach does not offer any kinetic resolution we can only speculate on the nature of the transfer process. It may be that the transfer process, as such, leads to structural rearrangements that cause a decrease in the reciprocal affinity, either triggered by Fig. 4. Heme analysis of Surf1c W200F and Surf1q W209F. Pyridine hemochromogen redox spectra of 20 l M Surf1 mutant pro- teins (A) and HPLC analysis of heme extracts derived from Surf1c W200F and Surf1q W209F in an 50–100% acetonitrile gradient shown as dotted line in (B). Both mutant proteins show an increased ratio of heme o over heme a. Table 2. Activity and heme a content of COX samples purified from a Paracoccus surf1c deletion strain (FA3), Surf1c complemen- tation (FA3.61) and a complementation with Surf1c W200F (FA3.61-W200F). Turnover [s )1 ] %wt activity % Heme a content a Wild-type 344 100 100 FA3 b 95 28 41 FA3.61 b 292 85 96 FA3.61–W200F 123 36 43 a As determined by pyridine hemochromogen redox spectra using an extinction coefficient of De 587–620 = 21.7 mM )1 Æcm )1 ; heme a content relative to wild-type oxidase (16.1 nmolÆ mg )1 ). b first described in Bundschuh et al. [15]. A. Hannappel et al. A conserved Trp specifies heme a binding in Surf1 FEBS Journal 278 (2011) 1769–1778 ª 2011 The Authors Journal compilation ª 2011 FEBS 1773 the loss of heme a in CtaA or the gain of the cofactor by Surf1. After separation from CtaA, Surf1 might instantly donate the heme moiety to COX subunit I, potentially in a cotranslational fashion. An interaction of heme a synthase and Surf1 was also detected in yeast, where heme a synthase, Cox15, copurifes with the yeast Surf1 homolog Shy1p, but the authors of the study did not discuss this observation in any further detail [23]. Additional biochemical and biophysical studies are needed to investigate the inter- action between both proteins and clarify the nature of the heme transfer process. Because the formation of heme a in E. coli cells is highly dependent on growth parameters, as discussed above, reproducible expression conditions for Surf1 are needed, avoiding variations from one preparation to another. The switch to an autoinductive medium fulfils these requirements and compensates the rather slow production of heme a in the heterologous host system by induction of Surf1 expression at high cell densities and extended induction times. Such experi- mental conditions allow the access to spectroscopically pure Surf1 samples containing heme a as the sole heme species, enabling us to test the heme-binding properties of the two Paracoccus homologs using site-directed mutagenesis. All mutations introduced into conserved residues within the transmembrane part of the proteins led to impaired heme a binding compared with wild- type, further emphasizing that heme binding must be an important physiological role of the protein, at least in the bacterial system (Fig. 3). Missense mutations of human Surf1 tend to be responsible for mild clinical phenotypes of Leigh syn- drome, allowing prolonged survival of affected patients [24]. Recently, a mutagenesis study on Shy1p tried to mimic clinically relevant missense mutations in yeast, also investigating the role of the conserved tyrosine resi- due in transmembrane helix II (Fig. 5). The mutation to aspartate did not have major effects in the yeast back- ground [17]. Here we show that both bacterial versions lose their heme-binding properties once the tyrosine is mutated. The same is true also for W24F and Q25A (Surf1c nomenclature), as well as the corresponding Surf1q mutations. All mutations tested here compro- mise any hydrogen-bonding properties of the side chains, presumably without affecting the overall struc- ture. Those residues might, therefore, be involved in binding the propionate side chains of the heme moiety. Interestingly, in the tryptophan to phenyalanine mutant in transmembrane helix II (W200F in Surf1c, W2009F in Surf1q), heme o is the predominant heme cofactor, indicating that this residue is the criti- cal determinant to bind the formyl group of heme a, thus discriminating against the heme o moiety (Fig. 5). This tryptophan residue would orient the cofactor in a way that facilitates subsequent correct incorporation of both hemes into COX subunit I. Because the trypto- phan to phenylalanine mutant binds an unphysiologi- cal heme type we expected a negative effect on COX biogenesis in vivo. Indeed, the Surf1c W200F mutant is not able to compensate the surf1 deletion phenotype in P. denitrificans (Table 2). Nevertheless, an alternative heme incorporation pathway into COX subunit I must be operative inde- pendent of Surf1, because residual COX activity is reported for surf1 deletions in any organism studied so far. A direct interaction between heme a synthase and subunit I could be envisaged. As we now show a direct transfer of heme from heme a synthase to Surf1, it is tempting to speculate whether a ternary complex exists, comprised of heme a synthase, Surf1 and sub- unit I. Surf1 could at least stabilize such a complex and facilitate the flow of heme a from its site of syn- thesis to its target site(s) within subunit I. But as the Surf protein itself stably binds heme a, the mechanism Fig. 5. Schematic model of heme a binding to Surf1. Based on sequence alignments highly conserved amino acid residues can be identified that all locate in the predicted transmembrane helices near the periplasmic side of the membrane. The histidine residue is most likely involved in iron (blue sphere) coordination [16], whereas the tryptophan in the second helix may specify the binding of the formyl group of heme a (red sphere) thus correctly orienting the co- factor for later integration into COX subunit I. Secondary structure elements are based on predictions by the program Sable [31]. A conserved Trp specifies heme a binding in Surf1 A. Hannappel et al. 1774 FEBS Journal 278 (2011) 1769–1778 ª 2011 The Authors Journal compilation ª 2011 FEBS of incorporation into subunit I may proceed in a sequential mode as well. Although it is still not clear what exact physiological function Surf1 exhibits in mitochondrial oxidase bio- genesis and whether eukaryotic Surf1 proteins also bind heme a, it becomes obvious from studying the bacterial homologs that Surf1 is directly involved in binding and incorporation of heme a into oxidase. In future, bacterial model systems may be particularly helpful because they easily offer access to sufficient amounts of protein needed for protein biochemical and biophysical studies. Materials and methods Cloning of CtaA The ctaA gene was amplified via PCR using P. denitrificans genomic DNA (strain Pd1222) as template with the forward primer (5¢-ATATACATATGGCTAGCATGACTGGTGG ACAGCAAATGGGTCGCGGATCCATGTCGCGCCCG ATCGAGAA-3¢) introducing an N-terminal t7 tag and a NdeI site, and a reverse primer (5¢ -TATATCTCGAGT CA(ATGGTG) 3 GCCCTGAAAATAAA GATTC TCA CCC GGACCGGGACCTCGGACAGTTCCCCGGAC-3¢) add- ing a TEV site, a C-terminal hexahistidine tag and an XhoI site. The product was digested with NdeI ⁄ XhoI and cloned into the plasmid pET24a, generating pHA01. For constitu- tive expression under control of the tet-promoter, ctaA– His 6 was subcloned into the plasmid pGR52. This plasmid encodes the P. denitrificans heme a synthesizing genes ctaB and ctaA in their wild-type versions [16]. To this end, ctaA–His 6 was excised from pHA01 using an endogenous AatII site and an XhoI site and subcloned into AatII ⁄ XhoI- digested pGR52, resulting in plasmid pHA02. For constitu- tive expression of CtaA–His 6 without CtaB, the ctaA gene was amplified via PCR using pHA02 as template with the forward primer (5¢-TCAAGGTGTACAAAGGAGATACT CATGTCGCGCCCGATCGAGAAG-3¢) introducing a Acc65I site, a ribosomal-binding site and the reverse primer mentioned above. The PCR product was digested with Acc65I ⁄ XhoI and cloned into the vector pGR50 [16] restricted by BsrGI ⁄ XhoI, resulting in pHA23. The gener- ated plasmids were verified by sequencing and can be used for constitutive expression of CtaA with a TEV-cleavable C-terminal hexahistidine tag in the presence (pHA02) or the absence (pHA23) of CtaB. Mutagenesis of Surf1 Templates for site-directed mutagenesis of His 10 –surf1 genes were pET22b derivative plasmids housing surf1c (pFA48) or surf1q (pFA49) as described previously [16]. Mutagenesis reactions were either performed using a QuikChange muta- genesis protocol (Stratagene, La Jolla, CA, USA) or via inverse PCR. Mutants derived from a QuikChange protocol (Surf1c: Q25A, Y196F, W200F; Surf1q: Q26A) were obtained using a single primer harbouring the desired muta- tion and introducing a restriction site for screening pur- poses. Mutants derived from inverse PCR reactions (Surf1c: W24F; Surf1q: W25F, Y205F, W209F) were obtained using a mutagenic forward primer also introduc- ing a restriction site for screening purposes and a reverse primer allowing the amplification of the expression plasmid by PCR. All introduced mutations were confirmed by sequencing and mutant plasmids were subsequently trans- formed into the E. coli expression strain C41(DE3) that already contained the plasmid pGR52. For cloning of a P. denitrificans complementation plas- mid, the gene encoding Surf1c W200F was subcloned from pFA48–W200F into the broad host range vector pFA61 that expresses wild-type Surf1c under the control of the cta- promoter [15]. For this, both plasmids were digested with NdeI ⁄ SacI and the resulting fragments were ligated, result- ing in plasmid pFA61–W200F. After sequence confirmation the plasmid was finally conjugated via triparental mating into the Paracoccus surf1c-deletion strain FA3 [15], resulting in FA3.61–W200F. Expression and purification of CtaA E. coli DH5-a strains constitutively expressing CtaA were grown in 15–30 L of Luria–Bertani medium supplemented with 10 lm iron (III) chloride. For high aeration, baffled flasks were used, whereas oxygen-limited growth was per- formed in normal flasks. The main culture was inoculated to 1% with an overnight culture and grown for 18 h at 32 °C. Cells were harvested at 5000 g for 15 min, resus- pended in 20 mm sodium phosphate, pH 8.0, 10 mm sodium chloride, 1 mm EDTA and membranes were prepared by established methods. Membranes were solubilized in the presence of 5% (w ⁄ v) Triton X-100 in buffer A (50 mm sodium phosphate, pH 8.0, 300 mm sodium chloride, 10 mm imidazole) at a final protein concentration of 10 mgÆmL )1 . The solubilized material was diluted with buffer A to reduce the Triton con- centration to 2.5% prior to loading on a nickel–nitriloacetic acid column (column volume CV = 20 mL; Qiagen, Hilden, Germany). Bound material was washed with 7.5 CV of buffer B (50 mm sodium phosphate, pH 8.0, 300 mm sodium chloride, 0.02% n-dodecyl-b -d-maltoside) contain- ing 20 mm imidazole. After washing with 40 mm imidazole in buffer B (7.5 CV), His-tagged CtaA was eluted from the column by 100 mm imidazole (7.5 CV). This fraction was concentrated to 1 mL and imidazole was removed by a 30-mL Sephadex G-25 desalting column (Pharmacia, Frei- burg, Germany). The His-tag was cleaved off by TEV prote- ase (Tobacco Etch Virus protease, final concentration of 0.02 mgÆmL )1 ) under gentle shaking for 18 h at 4 °C. A. Hannappel et al. A conserved Trp specifies heme a binding in Surf1 FEBS Journal 278 (2011) 1769–1778 ª 2011 The Authors Journal compilation ª 2011 FEBS 1775 The TEV-digested material was again loaded on a nickel– nitriloacetic acid column (CV = 5 mL) and washed with buffer B. CtaA is found in the flow-through, whereas con- taminating proteins, TEV protease and uncleaved CtaA bind to the column material. The flow-through is concen- trated and the protein concentration is determined by a modified Lowry protocol [25,26]. Expression and purification of Surf1 Heterologous expression of apo-Surf1 in E. coli was per- formed in the absence of the Paracoccus heme a-synthesiz- ing machinery as described previously [16]. Expression of Surf1 proteins in the presence of CtaB and CtaA (encoded on pGR52) was performed in autoinductive ZYM-5052 medium supplemented with 10 lm iron (III) chloride, according to Studier [18]. Nine litres of culture were inocu- lated to 1% in baffled flasks and grown for 24 h at 32 °C. Cells were harvested at 5000 g for 15 min and resuspended in 20 mm sodium phosphate, pH 8.0, 10 mm sodium chloride, 1mm EDTA. Membranes were prepared using established methods and the protein concentration was determined using the Lowry assay. The Surf1 proteins (apo-form, heme a containing and site-directed mutants) were solubilized from membranes and purified by a nickel–nitriloacetic acid column as described previously [16]. Heme a transfer from CtaA to Surf1 CtaA (ba-form) and apo-Surf1c were mixed in buffer 1 (20 mm sodium phosphate, pH 8.0, 150 mm sodium chloride, 0.02% n-dodecyl-b-d-maltoside) to a final concentration of 0.75 mgÆmL )1 CtaA and 0.895 mgÆmL )1 apo-Surf1c, corre- sponding to a molar ratio of CtaA ⁄ apo-Surf1c of 1 : 2. The mixture was incubated for 1 h at 25 °C and the two proteins were separated again on a nickel–nitriloacetic acid column (CV = 5 mL; Qiagen). After loading the sample, the column was washed with 5 CV of buffer 2 (50 mm sodium phos- phate, pH 8.0, 300 mm sodium chloride, 0.02% n-dodecyl-b- d-maltoside) and the CtaA containing flow through was col- lected. A washing step with 5 CV of buffer 2 containing 50 mm imidazole followed, before Surf1c was eluted from the column with 5 CV of buffer 2 containing 250 mm imidazole. All fractions were collected, concentrated and washed with buffer 1 to remove imidazole. After final concentration of the samples, the protein concentration was determined by the Lowry assay and samples were further analysed by SDS ⁄ PAGE and UV ⁄ Vis spectroscopy. Purification of cytochrome c oxidase and COX activity measurement COX purification from Paracoccus membranes was carried out as described previously [27]. COX activity measurements were performed at room temperature in buffer (20 mm potassium phosphate, pH 8, 20 mm potassium chloride, 0.05% n-dodecyl-b-d-maltoside) with 20 lm reduced horse heart cytochrome c as substrate on a Hitachi U-3000 spec- trophotometer (De 550 (cyt c) = 19.4 mm )1 Æcm )1 ). PAGE For SDS ⁄ PAGE, samples were denatured in SDS-containing buffer for 20 min at 37 °C. Electrophoresis was performed on 12% polyacrylamide gels according to Laemmli [28]. Spectral analysis Redox difference spectra were recorded in the visible range using potassium ferricyanide for oxidation and sodium dithionite for reduction. For denaturing redox difference spectra samples were taken up in 20% (v ⁄ v) pyridine, 0.1 m NaOH, and heme a concentration was determined using the extinction coefficient De 587–620 = 21.7 mm )1 Æcm )1 [29]. Heme extraction and HPLC analysis For analysis of the Surf1c W200F and Surf1q W209F mutant proteins, 10 mg were subjected to acidic acetone ⁄ ether extraction [30]. After evaporation of the ether, the precipitate was resolved in 50 lL dimethylsulfoxide. The resulting heme extract was diluted to 50% acetonitrile ⁄ TFA and filtered through a 0.2 lm nanosep MF filter (Pall, Dreieich, Germany). The hemes were separated on a lRPC- C2 ⁄ C18 column (GE Healthcare, Mu ¨ nchen, Germany) using a linear 50–100% acetonitrile gradient over 5 CV at 4 °C. Reference samples of different heme types were prepared from E. coli (hemes b and o) and from purified P. denitrif- icans COX (heme a). Acknowledgements We thank Andrea Herrmann for excellent technical assistance and Thuy Van-Tran and Sina Weidenweber for performing initial experiments in the mutagenesis project. We acknowledge financial support from DFG (SFB 472 ‘Molecular Bioenergetics’, and Cluster of Excellence ‘Macromolecular Complexes’ EXC 115). References 1 Hosler JP, Ferguson-Miller S & Mills DA (2006) Energy transduction: proton transfer through the respi- ratory complexes. Annu Rev Biochem 75, 165–187. 2 Kaila VR, Verkhovsky MI & Wikstrom M (2010) Pro- ton-coupled electron transfer in cytochrome oxidase. Chem Rev 110, 7062–7081. A conserved Trp specifies heme a binding in Surf1 A. Hannappel et al. 1776 FEBS Journal 278 (2011) 1769–1778 ª 2011 The Authors Journal compilation ª 2011 FEBS 3 Mogi T, Saiki K & Anraku Y (1994) Biosynthesis and functional role of haem O and haem A. Mol Microbiol 14, 391–398. 4 Hederstedt L, Lewin A & Throne-Holst M (2005) Heme A synthase enzyme functions dissected by muta- genesis of Bacillus subtilis CtaA. J Bacteriol 187, 8361– 8369. 5 Mogi T (2009) Probing structure of heme A synthase from Bacillus subtilis by site-directed mutagenesis. J Biochem 145, 625–633. 6 Svensson B, Andersson KK & Hederstedt L (1996) Low-spin heme A in the heme A biosynthetic protein CtaA from Bacillus subtilis. Eur J Biochem 238, 287–295. 7 Leigh D (1951) Subacute necrotizing encephalomyelopa- thy in an infant. J Neurol Neurosurg Psychiatry 14, 216–221. 8 Zhu Z, Yao J, Johns T, Fu K, De Bie I, Macmillan C, Cuthbert AP, Newbold RF, Wang J, Chevrette M et al. (1998) SURF1, encoding a factor involved in the bio- genesis of cytochrome c oxidase, is mutated in Leigh syndrome. Nat Genet 20, 337–343. 9 Tiranti V, Hoertnagel K, Carrozzo R, Galimberti C, Munaro M, Granatiero M, Zelante L, Gasparini P, Marzella R, Rocchi M et al. (1998) Mutations of SURF-1 in Leigh disease associated with cytochrome c oxidase deficiency. Am J Hum Genet 63, 1609–1621. 10 Van Coster R, Lombres A, De Vivo DC, Chi TL, Dodson WE, Rothman S, Orrechio EJ, Grover W, Berry GT, Schwartz JF et al. (1991) Cytochrome c oxidase-associated Leigh syndrome: phenotypic features and pathogenetic speculations. J Neurol Sci 104, 97– 111. 11 Nijtmans LG, Taanman JW, Muijsers AO, Speijer D & Van den Bogert C (1998) Assembly of cytochrome-c oxidase in cultured human cells. Eur J Biochem 254, 389–394. 12 Nijtmans LG, Artal Sanz M, Bucko M, Farhoud MH, Feenstra M, Hakkaart GA, Zeviani M & Grivell LA (2001) Shy1p occurs in a high molecular weight com- plex and is required for efficient assembly of cyto- chrome c oxidase in yeast. FEBS Lett 498, 46–51. 13 Barrientos A, Korr D & Tzagoloff A (2002) Shy1p is necessary for full expression of mitochondrial COX1 in the yeast model of Leigh’s syndrome. EMBO J 21, 43– 52. 14 Smith D, Gray J, Mitchell L, Antholine WE & Hosler JP (2005) Assembly of cytochrome-c oxidase in the absence of assembly protein Surf1p leads to loss of the active site heme. J Biol Chem 280, 17652– 17656. 15 Bundschuh FA, Hoffmeier K & Ludwig B (2008) Two variants of the assembly factor Surf1 target specific ter- minal oxidases in Paracoccus denitrificans . Biochim Bio- phys Acta 1777, 1336–1343. 16 Bundschuh FA, Hannappel A, Anderka O & Ludwig B (2009) Surf1, associated with Leigh syndrome in humans, is a heme-binding protein in bacterial oxidase biogenesis. J Biol Chem 284, 25735–25741. 17 Bestwick M, Jeong MY, Khalimonchuk O, Kim H & Winge DR (2010) Analysis of Leigh syndrome muta- tions in the yeast SURF1 homolog reveals a new mem- ber of the cytochrome oxidase assembly factor family. Mol Cell Biol 30, 4480–4491. 18 Studier FW (2005) Protein production by auto-induc- tion in high density shaking cultures. Protein Expr Purif 41, 207–234. 19 Greiner P, Hannappel A, Werner C & Ludwig B (2008) Biogenesis of cytochrome c oxidase – in vitro approaches to study cofactor insertion into a bacterial subunit I. Biochim Biophys Acta 1777, 904–911. 20 Brown BM, Wang Z, Brown KR, Cricco JA & Hegg EL (2004) Heme O synthase and heme A synthase from Bacillus subtilis and Rhodobacter sphaeroides interact in Escherichia coli. Biochemistry 43, 13541– 13548. 21 Brown KR, Brown BM, Hoagland E, Mayne CL & Hegg EL (2004) Heme A synthase does not incorporate molecular oxygen into the formyl group of heme A. Biochemistry 43, 8616–8624. 22 Wang Z, Wang Y & Hegg EL (2009) Regulation of the heme A biosynthetic pathway: differential regulation of heme A synthase and heme O synthase in Saccharomy- ces cerevisiae. J Biol Chem 284, 839–847. 23 Mick DU, Wagner K, van der Laan M, Frazier AE, Perschil I, Pawlas M, Meyer HE, Warscheid B & Reh- ling P (2007) Shy1 couples Cox1 translational regulation to cytochrome c oxidase assembly. EMBO J 26, 4347– 4358. 24 Piekutowska-Abramczuk D, Magner M, Popowska E, Pronicki M, Karczmarewicz E, Sykut-Cegielska J, Kmiec T, Jurkiewicz E, Szymanska-Debinska T, Bielecka L et al. (2009) SURF1 missense mutations promote a mild Leigh phenotype. Clin Genet 76, 195– 204. 25 Lowry OH, Rosebrough NJ, Farr AL & Randall RJ (1951) Protein measurement with the Folin phenol reagent. J Biol Chem 193, 265–275. 26 Markwell MA, Haas SM, Bieber LL & Tolbert NE (1978) A modification of the Lowry procedure to sim- plify protein determination in membrane and lipopro- tein samples. Anal Biochem 87, 206–210. 27 Hendler RW, Pardhasaradhi K, Reynafarje B & Lud- wig B (1991) Comparison of energy-transducing capa- bilities of the two- and three-subunit cytochromes aa3 from Paracoccus denitrificans and the 13-subunit beef heart enzyme. Biophys J 60, 415–423. 28 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685. A. Hannappel et al. A conserved Trp specifies heme a binding in Surf1 FEBS Journal 278 (2011) 1769–1778 ª 2011 The Authors Journal compilation ª 2011 FEBS 1777 29 Williams JN Jr (1964) A Method for the simultaneous quantitative estimation of cytochromes a, b, c 1 , and c in mitochondria. Arch Biochem Biophys 107, 537–543. 30 Weinstein JD & Beale SI (1983) Separate physiological roles and subcellular compartments for two tetrapyrrole biosynthetic pathways in Euglena gracilis. J Biol Chem 258, 6799–6807. 31 Adamczak R, Porollo A & Meller J (2005) Combining prediction of secondary structure and solvent accessibil- ity in proteins. Proteins 59, 467–475. Supporting information The following supplementary material is available: Fig. S1. Gel electrophoresis of purified Paracoccus den- itrificans CtaA proteins. Fig. S2. Native redox difference spectra of purified CtaA proteins. Fig. S3. Pyridine hemochromogen redox spectra of purified CtaA proteins. Table S1. Strains used for the heterologous expression of CtaA from Escherichia coli. This supplementary material can be found in the online version of this article. Please note: As a service to our authors and readers, this journal provides supporting information supplied by the authors. Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset. Technical support issues arising from supporting information (other than missing files) should be addressed to the authors. A conserved Trp specifies heme a binding in Surf1 A. Hannappel et al. 1778 FEBS Journal 278 (2011) 1769–1778 ª 2011 The Authors Journal compilation ª 2011 FEBS . Characterization of heme-binding properties of Paracoccus denitrificans Surf1 proteins Achim Hannappel 1 , Freya A expression studies of wild-type Surf1 proteins in E. coli, in the presence of CtaB and CtaA, con- tained next to heme a also small amounts of heme o in Surf1, a