Symmetric fluoro-substituted diol-based HIV protease inhibitors Ortho-fluorinated and meta-fluorinated P1/P1¢-benzyloxy side groups significantly improve the antiviral activity and preserve binding efficacy Jimmy Lindberg 1 , David Pyring 2 , Seved Lo¨ wgren 1 ,A ˚ sa Rosenquist 2 , Guido Zuccarello 2 , Ingemar Kvarnstro¨m 2 , Hong Zhang 3 , Lotta Vrang 3 , Bjo¨ rn Classon 3,4 , Anders Hallberg 5 , Bertil Samuelsson 3,4 and Torsten Unge 1 1 Department of Cell and Molecular Biology, BMC, Uppsala University, Sweden; 2 Department of Chemistry, Linko ¨ ping University, Sweden; 3 Medivir AB, Huddinge, Sweden; 4 Department of Organic Chemistry, Arrhenius Laboratory, Stockholm University, Sweden; 5 Department of Organic Pharmaceutical Chemistry, Uppsala University, BMC, Sweden HIV-1 protease is a pivotal enzyme in the later stages o f the viral life cycle which is r esponsible for the processing and maturation of the virus particle into an infectious virion. As such, HIV-1 pro tease has become an important target for the treatment of AIDS, and e fficient drugs have been developed. However, negative side effects and fast emerging resistance to the current drugs have necessitated t he development of novel chemical entities in ord er to exploit different phar- macokinetic properties as well as new interaction patte rns. We have used X-ray crystallography to decipher the s truc- ture–activity relationship of fluoro-substitution as a strategy to improve the antiviral activity and the protease inhibition of C2-symmetric diol-based inhibitors. In total we present six protease–inhibitor complexes a t 1.8–2.3 A ˚ resolution, which have been structurally characterized with r espect to their antiviral a nd inhibitory activities, in order to evaluate t he effects of different fluoro-substitutions. These C 2-symmetric inhibitors comprise mono- and difluoro-substituted benzyl- oxy side groups in P 1/P1¢ and indanoleamine side groups in P2/P2¢. The ortho- an d meta-fluorinated P1/P1¢-benzyloxy side groups proved to have the most cytopathogenic effects compared with the nonsubstituted analog and related C2-symmetric diol-based inhibitors. The different fluoro- substitutions are well accommodated in the protease S1/S1¢ subsites, a s observed by an increase in favorable Van der Waals c ontacts and surface area buried by the inhibitors. These data will be used in the development of potent inhibitors with different pharmacokinetic profiles towards resistant protease mutants. Keywords: AIDS; aspartic protease; crystal structure; fluor- ine; HIV. Human immunodeficiency virus 1 ( HIV) is the causative agent of AIDS [1–3]. The single-stranded RNA genome of HIV encodes a dimeric aspartyl protease (protease) which processes the viral gag and gag-pol precursor polyproteins into structural and f unctional proteins. The HIV protease has been shown to be essential in the production of mature and infectious virions [4,5], hence inhibition of this enzyme has b ecome an attractive ta rget for effective a ntiviral agent s; several protease inhibitors are currently in clinical trials. Despite t he initial success o f the FDA approved protease inhibitors (saquinavir [6], ritonavir [7], indinavir [8], nelfin- avir [9], amprenavir [10], lopinavir [11] and atazanavir [12]), there is an urgent need for improved drugs against HIV protease because of increasing viral resistance and unfavor- able pharmacokinetic profiles [13–16]. Our research group has utilized carbohydrates as building blocks in the design an d synthesis of C2-symmetric protease inhibitors. T he applied method of syn thesis p roduces a symmetry core unit w ith the C2-symmetry axis in the center of an asymmetric inhibitor using L -mannaric a cid as the building block [17–20]. Subsequent benzylation and coup- ling w ith amino acid or amines gave a series of symmetric or asymmetric diol-based inhibitors which were f urther opti- mized on the P1/P1¢ and P2/P2¢ side groups, providing a variety of inhibitors with efficient antiviral profiles [21–26]. This class of protease inhibitors has p reviously been associated with poor absorption profiles in cell assays and unsatisfactory pharmacokinetics in rats, which led us to investigate the effect of fluoro-substituted inhibitors on cell absorption. The substitution of fluorine for hydrogen introduces a minor increase in molecu lar mass and minimal steric changes accompanied by increased lipophilicity (Table 1) [27–29]. Previously, these properties of fluorine have been utilized successfully in the development of receptor-subtype-selective cholinergic and adrenergic drugs [30–32]. To study these e ffects of fluorine on s ymmetric diol- based protease inhibitors, we synthesized a series of fluoro inhibitors, w ith e ither m ono- or di-substituted P1/P1¢- benzyloxy side groups [33]. Correspondence to T. Unge, Department of Cell and Molecular Biology, BMC, Box 596, Uppsala University, SE- 751 24, Uppsala, Sweden. Fax: +46 18 530396, Tel.: +46 18 4714985, E-mail: Torsten.Unge@icm.uu.se Enzyme: HIV-1 protease, POL_HV1B1 (P03366) (EC 3.4.23.16). Note: The refined coo rdinates and assoc iated struc ture factors of HIV-1 protease in complex with inhibitors 1–6 have been deposited in the RCSB Protein Data Bank wi th accession codes: 1EBY, 1EC0, 1W5V, 1W5W, 1W5X, and 1W5Y. (Received 20 August 2004, revised 28 September 2004, accepted 12 October 2004) Eur. J. Biochem. 271, 4594–4602 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04431.x Herein we have used X-ray crystallography to decipher the structure–activity relationship for this series of fluoro inhibitors. In general, fluoro-substitution results in efficient utilization of a ccessible v olume in the subsites, associated with increased number of Van der Waals contacts and surface area buried by the inhibitors. This is reflected in moderate to good protease inhibition (K i values), albeit poorer than the nonsubstituted analog. The general reduc- tion in binding efficacy associated with fluoro-substitution is contradictory with respect to the increase in number of Van der Waals contacts and favorable electrostatic contacts. It is possible that the presence of two binding configurations of the fluoro-substituted benzyloxy side groups in the S1/S1¢ subsites may account for the general reduction in bind ing efficacy t hat w e obser ved for the fluoro inhibitors compared with the nonsubstituted analog. Structural and biochemical data suggest that difluoro-substitutions at the ortho and meta positions on P1/P1¢-benzyloxy side groups of sym- metric diol-based protease inhibitors preserve the b inding efficacy and significantly improve the antiviral potency. Materials and methods Expression of HIV-1 protease The expression and purification of HIV-1 protease w as adapted from Andersson et al. [21]. The protease gene was isolated by PCR with the upstream primer GAACA TATGGCCGATAGACAAGGAACTGTATCC and the downstream primer AGGGGATCCCTAAAAATTTAA AGTGCAACCAATCTG. The annealing s ite f or the upstream primer corresponds to 12 amino acids before the protease sequence. These extra amino a cids were added to facilitate the autocatalytic processing of the precursor protein and thereby ensure a correct N-terminus. Through the PCR step, the protease DNA fragment was provided with an NdeI restriction site at the 5¢ end and a BamHI site at the 3¢ end. These sites were used for ligation to the pET11a expression vector. Escherichia coli st ra ins XL-1 and HB101 were used as hosts for cloning. Protein e xpression was performed in E. coli strain BL21(DE3). Bacteria were grown in Luria–Bertani medium to an A 550 of 1.0 before induction by the addition of 0.5 m M isopropyl b- D -thiogalactoside. Cells were harvested after 3 h of induction. Purification of HIV-1 protease Cells were suspended in lysis buffer (20 m M Tris/HCl, pH 7.5, 10 m M dithiothreitol, 1 m M phenylmethanesulfonyl fluoride) and lysed in a French press. The lysate was centrifuged for 30 min at 12 100 g. The insoluble inclusion body fraction, which contained more than 90% of the expressed material, was dissolved in buffer (8 M urea, 20 m M Tris/HCl, pH 8.5, 10 m M NaCl, 10 m M dithiothreitol, 1m M EDTA) and incubated for 1 h at room temperature followed by centrifugation for 20 min at 48 200 g. The chromatographic steps were performed at 5 °C. ThesupernatantwasappliedtoaPOROSQ TM column (Perspective Biosystems, Cambridge, CA, USA). The flow- through fraction was collected and diluted to a final protein c oncentration of 0.3 mgÆmL )1 . R efolding was performed by dialysis against 20 m M sodium phosphate buffer, pH 6.5, containing 10 m M dithiothreitol and 1 m M EDTA, at room temperature for 60 min. The r efolded protein was diluted with an equal volume of buffer (50 m M MES, pH 6.5, 1 m M dithiothreitol, 1 m M EDTA), applied to a POROS HS column (Centricon, Billeric a, CA, USA), and eluted with a linear gradient of 0–0.6 M NaCl in MES buffer. The pooled fractions were precipitated with (NH 4 ) 2 SO 4 . The precipitate was collected by low-speed centrifugation and dissolved in 50 m M MES, pH 6.5, containing 10 m M dithiothreitol, 100 m M 2-mercaptoetha- nol, and 1 m M EDTA. The solution was desalted on a PD-10 column (AP Biotech AB, Uppsala, Sweden) and concentrated by ultrafiltration with CentriconÒ Centrifugal Filter Units to 2 mgÆmL )1 . Enzyme activity/inhibition studies Enzyme activity/inhib ition studies were performed as des- cribed by Nillroth et al. [34]. Briefly, a fluorimetric assay was used t o d etermine the effects of the inhibitors on HIV-1 protease. This assay used an internally quen ched fluorescent peptide substrate, DABSYL- c-Abu-Ser-Gln-Asn-Tyr-Pro- Ile-Val-Gln-EDANS (Bachem, B ubendorf, Switzerland). The measurements were performed in 96-well plates with a Fluoroscan plate reader (Labsystems, Helsinki, Finland). Excitation and emission wavelengths were 355 nm and 500 nm, respectively. Anti-HIV activity was assayed in vitro in MT4 cells with the vital dye XTT (Sigma-Aldrich, Steinheim, Germany) to monitor the cytopathogenic effects [35]. Crystallization Crystallization was pe rformed at 4 °C with the hanging- drop vapour-diffusion method. Drops were prepared by mixing 5 lL protein inhibitor s olution with an equal v olume of reservoir solution. The protein inhibitor solution con- tained 2 mgÆmL )1 protein in 50 m M MES, pH 6.5, con- taining 10 m M dithiothreitol and 1 m M EDTA, and 7 m M inhibitor in 10% (v/v) dimethyl sulfoxide. The reservoir solution contained 50 m M MES, pH 5.5, and 0.5 M NaCl. The drops were microseeded a fter 2 days. Crystals appeared after 1 week, and grew to the final size of 0 .3 · 0.3 · 0.05 mm in 3–4 weeks. Data collection and processing X-ray data were r ecorded on MAR-imaging plates on the synchrotron beam lines 9.5 DRAL at the Daresbury Table 1. Physicochemical properties of the carbon–fluorine bond. Values used in the evaluation of intermolecular c ontacts among the protease–inhibit or com plexes. Element Electro- negativity Bond length (CH 2 X, A ˚ ) Van der Waals radius (A ˚ ) H 2.1 1.09 1.2 F 4.0 1.39 1.4 C 2.5 1.42 1.7 O (OH) 3.5 1.43 1.6 Ó FEBS 2004 Fluorine substitution of HIV-1 protease inhibitors (Eur. J. Biochem. 271) 4595 Laboratory, D aresbury, Cheshire, UK, DL41 and DW32 at Lure, France, and I711 at MAX-lab, Lund, Sweden. The programs DENZO and SCALEPACK were used for processing and scaling [36,37]. A summary of data collection s tatistics is giveninTable2. Structure refinement Refinement was performed using the program package CNS [38]. The protease model coordinates from 1EBW were used for molecular replacemen t calculations. The starting model was refined with r igid-body r efinement and simulated annealing. The difference Fourier map (F o –F c ) clearly showed the position and orientation of inhibitor together with many water molecules. The inhibitor was b uilt into the electron density with the molecular visu alization program O [39]. Water molecules were added to the structures determined from the difference Fourier maps a t chemically acceptable sites. Only solvent molecules with B values less than 50 A ˚ 2 were accepted. Several cycles of minimization, simulated annealing, and B factor refinement were performed for each complex, accompan ied with manual rebuilding. The R cryst and R free factors were used to monitor the refinement [40]. The refinement statistics are shown in Table 2. Results Inhibitor properties The linear C2-symmetric inhibitors in this study encompass a six-carbon chiral center derived from L -mannaric acid. The five P1/P1¢ fluoro-substituted C2-symmetric inhibitors 2–6 were synthesized based on the nonsubstituted analog; 1 with benzyloxy side groups in P1/P1¢ and i ndanolamine side groups in P2/P2¢ [33]. All inhibitors have K i values within the nanomolar to picomolar range, and antiviral activity expressed as E D 50 values varying from 100 to 20 n M (Table 3) . Table 2. Crystallographic s tructure determination statistics for protease–inhibitor complexes 1–6. Statistics for reflections in h ighest resolution shells are indicated in parentheses. 123456 PDB accession number 1EBY 1EC0 1W5V 1W5W 1W5X 1W5Y Data collection details Space group P2 1 2 1 2P2 1 2 1 2P2 1 2 1 2P2 1 2 1 2P2 1 2 1 2P2 1 2 1 2 Wavelength (A ˚ ) 1.386 1.386 0.976 0.976 0.976 0.976 No of crystals 156444 Cell dimensions (A ˚ ) a ¼ 59.2 58.4 58.5 58.3 58.5 59.2 b ¼ 86.9 86.3 86.1 85.9 86.3 87.0 c ¼ 47.2 46.8 46.6 46.8 46.6 47.2 d min (A ˚ ) 2.3 1.8 1.8 1.8 1.8 1.9 No. of observations 28849 52852 97169 102338 86063 49671 No. of unique reflections 10685 21005 21224 21819 21258 16080 Completeness (%) 93.8 (93.0) 88.2 (84.1) 94.1 (90.8) 97.7 (89.3) 95.3 (95.0) 82.9 (83.0) R merge a (%) 4.6 (22.2) 12.6 (31.2) 3.4 (16.0) 7.0 (25.2) 4.8 (23.0) 11.4 (31.9) Reflections I > 2 r (%)847686889090 Reflections I > 2 r in highest resolution shell (%) 74 50 66 64 61 78 Bin resolution (A ˚ ) 2.40–2.30 2.00–1.80 1.90–1.80 1.83–1.80 1.83–1.80 2.02–1.90 Refinement statistics Resolution range (A ˚ ) 24.0–2.3 25.0–1.8 25.0–1.8 28–1.8 25.0–1.8 30.0–1.9 R cryst b (%) 18.1 19.0 19.9 19.9 18.8 18.8 R free c (%) 20.0 22.0 21.8 21.8 20.7 21.8 No. of atoms 1662 1668 1684 1691 1690 1669 Mean B factor (A ˚ 2 ) All 20.2 19.1 21.9 21.3 20.1 22.3 Solvent 34.5 42.0 33.4 34.9 35.4 46.0 Deviation from ideality d Bond lengths (A ˚ ) 0.008 0.007 0.005 0.005 0.006 0.006 Angles (°) 1.2 1.3 1.2 1.2 1.2 1.2 Dihedrals (°) 25.4 25.3 25.2 25.1 25.1 25.2 Impropers (°) 0.77 0.69 0.70 0.69 0.70 0.90 a R merge ¼ S |I i ) <I>|/SI i , where I i is an observation of the intensity of an individual reflection and <I> is the average intensity over symmetry equivalents. b R cryst ¼ S||F o |)|F c ||/S|F o |, where F o and F c are the observed and calculated structure factor amplitudes, respect- ively. c R free is equivalent to R cryst but calculated for a randomly chosen set of reflections that were omitted from the refinement process. d Ideal parameters are those defined by Engh & Huber [47]. 4596 J. Lindberg et al.(Eur. J. Biochem. 271) Ó FEBS 2004 Structure of the complexes The crystal structures of the six protease–inhibitor com- plexes have been solved and refined down to 1.8–2.3 A ˚ resolution with R cryst and R free of 18.1–19.9% and 20.0– 22.5%, respectively (Table 2). All complexes were crystal- lized in the orthorhombic space group P2 1 2 1 2withthe complete protease molecule in the asymmetric unit. This twofold symmetry arrangement of the crystal packing does not impose symmetry restraints on the protease dimer– inhibitor complex. All six inhibitors bind in an asymmetric manner to t he protease, with t he hydroxyls of the chiral center in staggered and gauche positions with respect to the catalytic aspartates and the strong interaction with one of the hydroxyls, which i nvolves short distance h ydrogen bonds with strong polar components. The geometric restraints of the hydroxyls cause the asymmetric bin ding. The asymmetry of the central h ydroxyls is present in all inhibitor s tructures, propagating significant differences in the d istances between the inhibitor side g roups and respective s ubsites. T he characteristic structural water molecule is bridging the m ain-chain a mino groups of Ile50/Ile50¢ to the carbonyls of the i nhibitor and is observed in all complexes. The difference Fourier m aps, 2F o –F c and F o –F c , unambiguously indicate the conformation of the inhibitors and t he position of the fluorine s ubstitutions in P1/P1¢ (Fig. 1). Structural accommodations in response to ortho-, meta- and para-fluoro-substituted P1/P1¢-benzyloxy side groups Overall. The mono- and di-substituted inhibitors 2–6 bind to the active site of the protease w ith specific accommoda- tions of the residues lining the S1/S1¢ subsites, as compared with the nonsubstituted analog 1. The rmsd of Ca atoms of S1/S1¢-lining r esidues range from 0.12 to 0.33 A ˚ for the different protease–inhibitor complexes. I n Fig. 2 an over- view of the accommodation of S1 subsite lining residues is presented with r espect to mono- and difluoro-substituted benzyloxy side groups. The rmsd of all atoms from residue side chains that are within 3.9 A ˚ of the P1-benzyloxy side groups (Arg8, Leu23, Gly48, Gly49, Ile50, Val32, Pro81 and Ile84) are plotted pairwise for the protease–inhibitors complexes 1–6. Generally, the most pronounced side-chain accommodations in re sponse to the fluoro-substitution in ortho, meta and p ara positions on the P1-benzyloxy side groups are in the range of 0.3–0.4 A ˚ , and are mainly observed for residues Arg8, Leu23, Gly48, V al32 and P ro81. The conformation of the remaining S1-lining residues remains u naffected by the panel of fluoro-substitutions. The protease inhibitor complex with inhibitor 6 exhibited the most pronounced shifts in side-chain position, partic- ularly for residues Arg8 and Leu23, which are displaced  0.5 A ˚ with respect to inhibitors 1–5. 2- and 3-Fluorobenzyloxy side groups. The mono-substi- tuted inhibitors 2 and 3 are fluoro-substituted in the ortho (2-fluoro) and meta ( 3-fluoro) positions of the benzyloxy side groups, respectively. Table 4 summarizes the binding characteristics of the fluoro inhibitors. For the P1/P1 ¢ mono-substituted inhibitors, 2 and 3, the accessible volume of the s ubsites is utilized more efficiently in relation to the surface area buried by the inhibitors compared with the nonsubstituted a nalog, as evid enced by an increase in the number of favorable Van der Waals contacts. Superimpo- Table 3. Binding characteristics of the fluoro inhibitors to the protease active site. Inhibitor Molecular mass (Da) Buried surface area (A ˚ 2 ) a No. of inhibitor– protease contacts b No. of hydrogen bonds c No. of repelling contacts d K i (n M ) ED 50 e (l M ) 1 652.7 1394.6 57 10 – 1.2 0.10 2 671.7 1440.1 71 10 – 3.2 0.05 3 671.7 1398.3 78 10 2 7.1 0.06 4 690.7 1435.8 70 11 – 1.6 0.11 5 690.7 1433.5 84 10 2 4.0 0.03 6 690.7 1456.3 69 10 – 3.3 0.02 a Buried surface area was calculated with programs in the CNS package [38]. b An atom-pair distance of less than 3.9 A ˚ was used as criterion for a close contact. c Hydrogen bonds were calculated with a maximum distance of 3.2 A ˚ between acceptors and donors. d An atom-pair distance of less then 3.5 A ˚ between atom with same polarity was used as a criterion for a repelling contact. e ED 50 for reference substances tested in the same assay: ritonavir (ED 50 0.06 l M ), indinavir (ED 50 0.06 l M ), saqinavir (ED 50 0.01 l M ), nelfinavir (ED 50 0.04 l M ). Fig. 1. Conformation of the C2-symmetr ic inhibitor 4 in the protease active site. The 2F o –F c difference electron-density m ap unambiguously shows a unique orientation of the inhibitor and the fluorine substitu- ents on the P1/P1¢ side groups. The electron density maps were ca l- culated at 1.8 A ˚ resolution with the inhibitor omitted, employing the omit option in CNS [38]. Map contouring is at 0.4 eÆA ˚ 3)1 (1 r). The figure was drawn with the program SWISS - PDBVIEWER [45] (http://www.expasy.ch/spdbv/) and 3D-rendered with POV - RAY (http://www.povray.org/). Ó FEBS 2004 Fluorine substitution of HIV-1 protease inhibitors (Eur. J. Biochem. 271) 4597 sition of the two inhibitors on the nonsubstituted a nalog revealed that the position of 2-fluoro; 2 and 3-fluoro; 3 benzyloxy side g roups in the S1/S1¢ subsites are similar, and slightly closer to Arg8/Arg8¢ than in the non-substituted analog. For inhibitor 2, this position prevents steric clashes between the 2 -fluoro substituents and Ile50/Ile50¢ side chains and puts the 2-fluoro in range of Van der Waals contacts to the Cc1 c arbons. In contrast, the 3-fluoro- benzyloxy side groups of inhibitor 3 have no contacts with the i soleucines. I nstead, there are V an der Waals contacts to Gly48/Gly48¢ and Pro81/Pro81¢ where the former contacts display unfavorable electrostatic interactions between the 3- fluoro atoms and the glycine backbone carbonyls (Table 4). 2,3-, 2,4- and 2,5-Difluorobenzyloxy side groups. The changed size and chemical character of the difluoro- substituted benzyloxy side groups is accommodated for by the S1/S1¢ subsites. I t is e vident by sligh t changes i n position of the P1/P1¢ side groups and residue side-chain adaptations. In Fig. 3 inhibito rs 2 and 6 are superimposed on to the nonsubstituted analog to show the difference in position of the benzyloxy side groups associated with 2-fluoro and 2,5-difluoro-substitutions compared with the nonsubstituted analog. The 2,5-difluoro-substitution in inhibitor 6 changes the position of the benzyloxy side groups 0.8 A ˚ towards t he C f-carbon of Arg8/Ar g8¢, accompanied by 0.3/0.4 A ˚ shifts in side-chain positions compared with inhibitors 1–5. The conformations of the arginine side chains are stabilized by hydrogen bonds from Asp29/Asp29¢ resulting in a restrained repositioning of the 2,5-difluorobenzyloxy side groups in proximity of the Cf carbon. Notably, the 5-fluoro s ubstituents are observed within dipole–dipole interaction range of the partially charged C f carbon of the arginines. The presence of an electrostatic interaction is supported by quantum mechan- ical calculat ions of the partial charges for Cf carbon (+ 0.3 4) a nd the 5-fluoro substituents ()0.11) in vacuu m (unpublished observations). In addition, the repositioning of the benzyloxy side groups results in lost Van der Waals contacts between the 2-fluoro substituents and Ile50/Ile50¢ side chains. Fu rthermore, the crystal structure of inhibitor 6 reveals increased flexibility (higher B values) and reduced quality of the electron density for the isoleucine side chains compared with the i nhibitor 2 complex. In Fig. 4, inhibitors 4 (2,4-difluoro) and 2 (2-fluoro) are superim- posed on the nonsubstituted analog 1. In contrast with the structural adaptation required for the 2,5-difluoro-substi- tutions, the 2,4-difluoro-substituted benzyloxy side groups (4) accommodate well in the S1/S1¢ subsites. Thus, the 4-fluoro substituents act a s proton acceptors in two hydrogen bonds to the nitrogen atoms of Arg8/Arg8¢ side chains, and the 2-fluoro substituen ts are within Van der Waals distance of Ile50/Ile50¢. Enzyme activity/inhibition studies The present series of fluoro-substituted inhibitors shows satisfactory protease inhibition with K i values in the picomolar to nanomolar range, albeit poorer than the nonsubstituted analog 1. Notably, for P1/P1¢ fluoro-substi- tutions, the antiviral activity (as measured by ED 50 values) were m arkedly improved compared with the nonsubstituted analog and other related C2-symmetric diol-based protease inhibitors [23,26], and comparable to the reference com- pounds indinavir, ritonavir, nelfinavir, and saquinavir. The inhibitory efficacy ( as measured by K i values) on enzyme activity of the P1/P1¢-fluorinated analogs differs depending on the position of fluoro-substitution on the benzyloxy side group, par a being greater than ortho and ortho greater than meta. Among the fluoro-substituted inhibitors, the most potent was the disubstituted inhibitor 4 (2,4-difluoro). However, the effect on the antiviral activity is more c omplex (Table 3) . Benzyloxy side groups disubstituted in the ortho and meta position exhibit the highest antiviral potency (Table 3). Among the d isubstituted analogs, the most potent was inhibitor 6 (2,5-difluoro), but the difference in antiviral activity a mong the mono- and d i-substituted fluoro inhibitors was minor. H owever, not surprisingly, t he significant increase in volume of the P1/P1¢ side group affects the inhibitory efficacy. Fo r example, inhibitor 6 (2,5- difluoro) has an ED 50 of 0.02 l M , albeit it has a moderate K i of 3.3 n M compared with the reference compound 1 with an ED 50 of 0.1 l M and a K i of 1.2 n M . However, the most convincing e vidence on the ability of fluorine substitution to enhance antiviral activity in cell assay was observed for inhibitor 3 which has an ED 50 of 0.06 l M and a K i of 7.1 n M . Fig. 2. Accommodation of S1-lining residues as a result of P1-benzyloxy fluorination. The root-mean-square deviation (RMSD ) of all side chain atoms within 3.9 A ˚ of the P1 benzyloxy side groups of inhibitors 1–6 are p lotted pairwise. The expansion of the S 1 subsite is most apparent for residues L eu23, Gly48 Val32 and Pro81, which show the most significant accommodations on P1-benzyloxy fluorination compared with the nonsubstituted analog 1. Inhibitor-specific side-chain accommodations are most pro nounced for inhibito r 6 where Arg8 and Leu23 are displaced  0.5 A ˚ with respect to inhibitors 2–5.The S1-subsite residues Ile50 a nd Ile84 display high flexibility with large atomic displacements, which correlates with B values above average. The RMSD values were calculated using LSQMAN [46]. 4598 J. Lindberg et al.(Eur. J. Biochem. 271) Ó FEBS 2004 Discussion Symmetric HIV-1 protease inhibitors comprising the C2-symmetric diol-based scaffold with v arious P1/P1¢ and P2/P2¢ side groups were previously found by us to exhibit poor antiviral activity despite moderate-to-good protease inhibition [23–26]. As fluoro-substitution is known to modulate pharmaco- kinetic properties of various compounds, we decided to fluorinate the benzyloxy side groups as a strategy for improving their ce ll absorption by the cell. The series of fluoro inhibitors based on inhibitor 1 were tested on MT4 cells and showed improved antiviral activity, whereas fluorinations of P2/P2¢-indanolamine side groups did not (unpublished observations). It is also remarkable that all fluoro analogs except inhibitor 4 displayed reduced binding efficacy with respect to the nonsubstituted analog. The apparently moderate K i values indicate inefficient accom- modation of fluoro-substituted P1/P1¢ benzyloxy side groups in the respective subsites. However, the orientation of the fluoro inhibitors in the active site showed an increased number of Van der Waals contacts and favorable electro- static contacts to the p rotease s ubsites, which is evidence for an improvement i n protease i nhibition. These contradictory results may mean that the asymmetrically fluoro-substituted benzyloxy side groups have two binding configurations, differing by a 180° rotation, with two distinct affinities for the S1/S1¢ subsites. However, i n the structures of the complexed forms of the protease, only one configuration is trapped in the crystal lattices and observed at full occu- pancy. Computer modeling of the 2- and 3-fluorobenzyloxy side groups showed that the 180°-rotated configurations were equally possible; the fluoro substituents filled t he space in the vicinity of Gly27/Gly27¢ and Leu23/Leu23¢ without need for s ide-chain adaptation. However, the modeling also revealed repelling contacts between the fluoro substituents and the back bone carbonyl o xygen of G ly27/Gly27¢ and Leu23/Leu23¢, making that confi guration highly unfavora- ble. Extending the modeling to the disubstituted inhibitors 4–6 showed similar unfavorable binding properties of the 180°-shifted configurations. This is also reflected in a reduction in binding efficacy (increased K i values) for Table 4. Effect of P1/P1¢ fluoro-substitution on interatomic d istances between inhibitor side groups and subsite-lining residues. Dista nces presented in bold represent f avorable Van de r Waals and electrostatic contacts, whereas dista nces in italics represent unfavorable charge r epulsions. Hydrogen bonds were calculated with a m aximum distance of 3.2 A ˚ between acceptors an d donors and are i ndicated by an asterisk. The inh ibitor–residue distances were measured between the c losest atom pairs with t he macromolecular visualization p rogram O [39]. The diol-based scaffold, substituted with indanolamine in P2/P2¢ positions, is included for clarity. Inhibitor P1/P1¢- side group Inhibitor–residue distance (A ˚ ) Arg8/Arg8¢ Ile50/Ile50¢ Leu23/Leu23¢ Gly48/Gly48¢ Cf Ne NH 2 Cc1Cd2O 1 3.6/4.0 4.5/4.8 3.5/3.7 4.8/4.7 3.8/3.8 3.9/3.7 2 3.5/3.7 4.3/4.4 3.5/3.4 3.8/3.7 3.6/3.5 3.9/3.9 3 3.5/3.7 4.3/4.5 3.5/3.5 5.0/4.7 3.5/3.6 3.4/3.3 4 3.5/3.8 4.3/4.4 3.5/3.0* 3.9/3.7 3.7/3.4 3.7/3.9 5 3.4/3.6 4.1/4.2 3.4/3.6 3.7/3.5 3.5/3.4 3.3/3.3 6 2.7/2.8 2.9/3.1 3.0/3.0 3.9/3.9 3.4/3.5 4.0/4.1 Ó FEBS 2004 Fluorine substitution of HIV-1 protease inhibitors (Eur. J. Biochem. 271) 4599 inhibitors fluoro-su bstituted a symmetrically on the benzyl- oxy side groups compared with symmetric analogs, such as the nonsubstituted inhibitor (1), 2,6- and 3,5-difluoro- substituted analogs [33]. However, it cannot be excluded that other factors are involved in the reduced binding efficacy f o r the fluoro inhibitors, including decreased entropy and increased solvation energies. Modeling of the two possible orientations of the side groups indicates that the trapped configurations observed in the X-ray structures should have the highest binding efficacy compared with the 180°-rotated configurations. Thus, o n the basis of the physicochemical properties of the fluorine– carbon bonds (Table 1), the effect from individual fluori- nations on binding efficacy c ould be discerned by e valuating the intermolecular contacts among the protease–inhibitor complexes. The m onosubstituted 2-fluoro s ide groups are accommodated differently in the S1/S1¢ subsites compared with the 3-fluoro and nonsubstituted side groups. The 2-fluoro inhibitor utilize s the accessible volume in the subsites more efficiently, which is reflected as a gain of two Van der Waals contacts to Ile50/Ile50¢ side chains, contacts that are not present in the case of the 3 -fluoro inhibitor. Interestingly, the 1 80°-rotated configuration i s not ob served in the X-ray structure, but modeling reveals that the benzyloxy side groups need to adapt their configuration to prevent steric clashes with Arg8/Arg8¢, which results in lost contacts to the Ile50/Ile50¢ side chains. This underlines the importance of p reserved Van der Waals contacts between the 2-fluoro substituents and the isoleucine side chains. The lower B values and improved electron-density map quality for the isoleucines in c omplex with inhibitor 2 in contrast with inhibitor 3 also reflects this. In addition to the difference in Van der Waals contacts to the S1/S1¢ subsites of the two inhibitors, the twofold reduction in protease inhibition for inhibitor 3 is due to charge repulsion between the 3-fluoro substituents an d the backbone carbonyls of Gly48/Gly48¢. The differences in proteas e inhibition for t he 2,3-, 2,4- and 2,5-difluoro-substitutions outlined in Table 3 can be attrib- uted to a gain or loss of intermolecular contacts to the S1/S1¢ subsites. Similar to 3-fluoro (3), the 2,3-difluoro side groups in inhibitor 5 are inefficiently accommodated in the S1/S1¢ subsites, mainly because of the charge repulsion to Gly48/Gly48¢. However, the contribution from the 2-fluoro substituents results in a significant improvement in pro- tease inhibition (K i 4.0 n M ) compared with inhibitor 3 (K i 7.1 n M ). The 2 ,4-difluoro-substitutions in inhibitor 4 are well accommodated by t he S1/S1¢ subsites: the 4-fluoro substituents acting as proton acceptors in two hydrogen bonds to Arg8/Arg8¢ and the 2-fluoro substituents are within Van der Waals distance of Ile50/Ile50¢. The gain in Gibbs free energy from saturation of two proton acceptors accounts for the t wofold improvement in protease inhibition (K i 1.6 n M ) compared with the 2-fluoro-substituted analog (K i 3.2 n M ). The 2-fluoro inhibitor 2 and 2 ,5-difluoro inhibitor 6 were equipotent in terms of protease inhibition despite the 2,5-difluorobenzyloxy side group repositioning. This is at tributed to the contacts g ained to Arg8/Arg8¢ by the 5-fluoro substituents and to contacts lost to Ile50/Ile50¢ by the 2-fluoro substituents. Hence, t he K i values are influenced not only by the number of fluorine substituents but also by the position of the fluorine on t he benzyloxy s ide groups. Antiviral activity, ED 50 Our monofluoro- and difluoro-substituted inhibitors exhibit significant improvements in antiviral activities in MT4 cell culture assay co mpared with the nonsubstituted analog 1. Fig. 4. Superimposition o f the 2,4-difluoro-substituted inhibitor on the nonsubstituted analog in the S1¢ subsite. Th e 2,4-difluoro-substitution o f inhibitor 4 fills the accessible volume o f the S1 ¢ subsite more efficiently than the nonsubstituted a nalog. The 2 -fluoro substituent is in Van der Waals contact with residue I50 and the 4-fluoro substituent acts as a proton acceptor in a hydrogen bond to R8¢. The 2,4-difluoro-substi- tuted i nhibitor 4 is shown in ligh t blue, and the n onsubstitute d analog in brown. The figure was drawn with the program SWISS - PDBVIEWER [45] (http://www.expasy.ch/spdbv/) and 3D-rendered with POV - RAY (http://www.povray.org/). Fig. 3. Superimposition of the 2-fluoro- and 2,5-difluoro-substituted inhibitors on to the nonsubstituted analog in the S1¢ subsite. The 2,5- difluoro-substitution of in hibitor 6 results in a slightly different adap- tation of the benzyloxy side groups to the S1/S1¢ subsites compared with the 2-fluoro (2) and nonsubstituted analogs (1). The 2-fluoro- substituted inhibitor is shown in light green, the 2,5-difluoro-substi- tuted i nhibitor in dark gray, and the nonsubstituted analog in brown. The figure was drawn with the program SWISS - PDBVIEWER [45] (http://www.expasy.ch/spdbv/) and 3D-rendered with POV - RAY (http://www.povray.org/). 4600 J. Lindberg et al.(Eur. J. Biochem. 271) Ó FEBS 2004 Previously, these symmetric diol-based protease inhibitors have been associated with a variety of pharmacological and metabolic distinctions that negatively affect their adminis- tration, distribution, and toxicity, properties that have been discussed in a number of different reviews [13,16,41]. It is noteworthy, however, that ortho-, meta- and fluoro-substi- tuted benzyloxy side group s had markedly improved ED 50 values than the nonsubstituted analog and related C2-symmetric diol-based protease inhibitors [23,26]. These values were comparable to those for the reference drugs ritonavir, indinavir, saquinavir, and nelfinavir. This ten- dency can be attributed in part to the higher lipophilicity of the fluoro-substituted i nhibitors [42]. Fluorine contributes to overall pharmacological activity by enh ancing bioavail- ability and retarding metabolic degradation. It thereby extends the c linical applications for several different drug candidates [43,44]. In our series of fluoro inhibitors, the fluorine substitution with most enhanced antiviral activity i n a cell assay w as observed for inhibitor 3 which had an ED 50 of 0.06 l M and a K i as high as 7.1 n M . In addition to the improved antiviral effect, fluorination offers pharmacologi- cal alternatives to co mbat resistance mutations of HIV-1 protease, because it extends th e cont act surf ace and has polarity d ifferences. This is documented by the threefold improvement in activity of inhibitors 2 and 6 against the triple mutant M46I, I82V and V84A compared with the nonsubstituted analog 1 [33]. Conclusion We have used X-ray c rystallography to s tudy the s tructure– activity relationship of a series of fluoro inhibitors com- plexed to HIV p roteas e. Compared w ith th e nonsubstitut ed analog, the fluoro inhibitors have improved the antiviral activity and retained the binding efficacy. The flexibility of the target molecule complicates the prediction of an effect caused by a modification on the inhibitor and necessitates structural analysis of each complex. The P1/P1 ¢ fluoro- substitutions are a ssociated with efficient u tilization of accessible volume in the subsites and increased number of Van der Waals contacts. The general reduction in bind ing efficacy associated with fluoro-substitution is contradictory with respect to the efficient binding to the subsites. We propose that the presence of two binding configurations to the S1/S1¢ subsites of the fluoro-substituted benzyloxy side groups accounts for the general reduction in protease inhibition. Notwithstanding the moderate binding efficacy, the most active fluoro inhibitor in terms of cytopathogenic effects in cell-based experiments is ortho- and meta-difluor- inated on the P1/P1¢ benzyloxy side groups. These data will be used in th e d evelopment of new inhibitors with i mproved pharmacokinetic p rofiles directed towards r esistant mu tants of HIV-1 protease. Acknowledgements We than k Terese Bergfors for reading the manuscript and Professor Alwyn Jones for fruitful discussions. This work was supported by the Swedish Medical Research Consuil (MFR, K79-16X-09505-07A), the Swedish N ational Board for Industrial and Technical Development (NUTEK), the Swedish Research Council for Engineering Sciences (TFR), and Medivir AB, Huddinge, Sweden. References 1. Gallo, R .C., Salahuddin, S.Z., Popovic, M., Shearer, G.M., Kaplan, M., Haynes, B.F., Palker, T.J., Redfield, R., Oleske, J., Safai, B. et al. (1984) Frequent detection and isolation of cyto- pathic retroviruses (HTLV-III) from patients with AIDS and at risk for AIDS. Science 224, 500–503. 2. Gallo, R.C., Sarin, P.S., Gelmann, E.P., Robert-Guroff, M., Richardson, E., Kalyanaraman, V.S., Mann, D., Sidhu, G.D., Stahl, R.E., Zolla-Pazner, S., Leibowitch, J. & Popovic, M. (1983) Isolation of human T-cell leukemiavirusinacquiredimmune deficiency synd rome ( AIDS). Science 220, 865–867. 3.Barre-Sinoussi,F.,Chermann,J.C.,Rey,F.,Nugeyre,M.T., Chamaret, S., Gruest, J., Dauguet, C., Axler-Blin, C., Vezinet- Brun, F., Rouzioux, C., Rozenbaum, W. & Montagnier, L. (1983) Isolation of a T-lymphotropic retrovirus from a p atient at risk f or acquired immune deficiency syndrome (AIDS). Science 220,868– 871. 4. Peng, C ., Ho, B.K., Chang, T.W. & Chang, N .T. (1989) Role of human immunodeficiency virus type 1-specific protease in core protein maturation and viral infectivity. J. Virol. 63, 2550– 2556. 5. Kohl, N.E., Emini, E.A., Schleif, W.A., Davis, L.J., Heimbach, J.C., Dixon, R.A., Scolnick, E.M. & Sigal, I.S. (1988) Active human immunodeficiency virus protease is required for viral infectivity. Proc. Natl Acad. Sci. USA 85, 4686–4690. 6. Roberts, N.A., Martin, J.A., K inchington, D ., Broadh urst, A.V., Craig, J.C., Duncan, I.B., G alpin, S.A., Handa, B.K., Kay, J., Krohn, A. et al. (1990) Rational design of peptide-based HIV proteinase inhibitors. Science 248, 358–361. 7. Kempf, D.J., Marsh, K.C., Denissen, J.F., McDonald, E., Vasa- vanonda, S., Flentge, C.A., Green, B.E., Fino, L., Park, C.H., Kong, X.P. et al. (1995) ABT-538 is a potent inhibitor of human immunodeficiency virus protease an d has h igh oral bioavailability in humans. Proc.NatlAcad.Sci.USA92, 2484–2488. 8. Vacca, J.P., Dorsey , B.D., S chleif, W .A., Levin, R.B., M cDaniel, S.L.,Darke,P.L.,Zugay,J.,Quintero,J.C.,Blahy,O.M.,Roth,E. et al. (1994) L-735,524: an orally bioavailable human immuno- deficiency virus type 1 protease inhibito r. Proc. Natl Acad. Sci. USA 91, 4096–4100. 9. Kalish, V., Kaldor, S., Shetty, B., Tatlock, B., Davies, J., Ham- mond,M.,Dressman,B.,Fritz,J.,Appelt,K.,Reich,S.&Su,K. (1995) Eur. J. Med. Chem. 30, 201s–214s. 10. Reddy, P. & Ross, J. (1999) Formulary, 567–577. 11. Sham, H.L., Kempf, D.J., Molla, A., Marsh, K.C., Kumar, G.N., Chen,C.M.,Kati,W.,Stewart,K.,Lal,R.,Hsu,A.,et al. (1998) ABT-378, a highly potent inhibitor of the human immunodefi- ciency virus prote ase. Antim icrob. A gents Chemother. 42, 3218– 3224. 12. Bold, G., Fassler, A., Capraro, H.G., Cozens, R., Klimkait, T., Lazdins, J., Mestan, J., Poncioni, B., Rosel, J., Stover, D., Tin- telnot-Blomley, M., Acemoglu, F., Beck, W., Boss, E., Eschbach, M., Hurlimann, T., Masso, E., Roussel, S., Ucci-Stoll, K., Wyss, D. & Lang, M. (1998) New aza-dipeptide analogues as potent and orally absorbed HIV-1 protease inhibitors: candidates f or clinical development. J. M e d. Chem . 41 , 3387–3401. 13. Sommadossi, J.P. (1998) Pharmacological considerations in anti- retroviral therapy. Antivir. Ther. 3, 9–12. 14. Flexner, C. (1998) HIV-protease inhibito rs. N.Engl.J.Med.338, 1281–1292. 15. Molla, A., Granneman, G.R., Sun, E. & Kempf, D.J. (1998) Recent developments in HIV protease inhibitor therapy. Anti-viral Res. 39, 1–23. 16. Moyle, G. (2002) Overcoming obsta cles to t he success o f protease inhibitors in highly active antiretroviral therapy regimens. AIDS Patient Care STDS 16, 585–597. Ó FEBS 2004 Fluorine substitution of HIV-1 protease inhibitors (Eur. J. Biochem. 271) 4601 17. Erickson, J. & Ke mpf, D. (1994) Structure-based design of symmetric inhibitors of HIV-1 protease. Arch. Virol. Suppl. 9, 19–29. 18. Kempf, D.J. (1994) Design of symmetry-based, peptidomimetic inhibitors of human immunodeficien cy virus protease. Methods Enzymol. 241, 334–354. 19. Kempf, D.J., Norbeck, D.W., Codacovi, L., Wang, X.C., Kohl- brenner, W.E., Wideburg, N.E., Paul, D.A., Knigge, M.F., Vasavanonda, S., Craig-Kennard, A. et al. (1990) Structure- based, C2 symmetric inhibitors of HIV protease. J. Med. Chem. 33, 2687–2689. 20. Erickson, J., Neidhart, D.J., VanDrie, J., Kempf, D .J., Wang, X.C., Norbeck, D.W., Plattner, J.J., Rittenhouse, J.W., Turon, M., Wideburg, N. et al. (1990) De sign, activity, and 2 .8 A crystal structure of a C2 symmetric inhibitor complexed to HIV-1 pro- tease. Science 249, 527–533. 21. Andersson, H.O., Fridborg, K., Lo ¨ wgren, S., Alterman, M., Muhlman, A., Bjo ¨ rsne, M., Garg, N., Kvarnstro ¨ m,I.,Schaal,W., Classon, B., Karlen, A., Danielsson, U.H., Ahlsen, G., Nillroth, U., Vrang, L., O ¨ berg, B., Samuelsson, B., Hallberg, A. & Unge, T. (2003) Optimization of P1–P3 g roups in symmetric an d asym- metric HIV-1 protease i nhibitors. Eur. J. Bioc hem. 27 0, 1746– 1758. 22. Alterman, M., Bjo ¨ rsne, M., Muhlman, A., Classon, B., Kvarn- stro ¨ m, I., Danielson, H., Mark gren, P.O., Nillroth, U., Unge, T ., Hallberg, A. & Samuelsson, B. (1998) Design and synthesis of new potent C2-symmetric H IV-1 p rotease inh ibitors. Use of 1-man- naric acid as a peptidomimetic scaffold. J. Med. Ch em. 41 , 3782– 3792. 23. Alterman,M.,Andersson,H.O.,Garg,N.,Ahlsen,G.,Lo ¨ wgren, S., Classon, B., Danielson, U.H., Kvarnstro ¨ m,I.,Vrang,L., Unge, T., Samuelsson, B. & Hallberg, A. (1999) Design and fast synthesis of C-terminal d uplicated potent C (2)-symmetric P1/P1 ¢- modified HIV-1 protease inhibitors. J. Med. Chem. 42, 3835–3844. 24. Muhlman, A., Lindberg, J ., Classon, B., Unge, T., Hallberg, A. & Samuelsson, B. (2001) Synt hesis of novel, potent, diol-based HIV- 1 protease inhibitors via intermolecular pinacol homocoupling of (2S)-2-benzyloxymethyl-4-phenylbutanal. J. Med. Chem. 44, 3407–3416. 25. Muhlman, A., Classon, B., Hallberg, A. & S amuelsson, B. (2001) Synthesis of p otent C(2)-sym metric, d iol-based h iv-1 protease inhibitors. Investigation of thioalkyl and thioaryl P1/P1¢ substit- uents. J. Med. Ch em. 44 , 3402–3406. 26. Oscarsson, K., Lahmann, M., Lindberg, J., Kangasmetsa, J., Unge, T ., Oscarson, S., Hallberg, A. & Samuelsson, B. (2003) Design and synthesis of HIV-1 protease inhibitors. Novel tetra- hydrofuran P2/P2¢-group s interacting with Asp29/30 of the HIV-1 protease. Determination of binding from X-ray crystal structure of inhibitor protease complex. Bioorg. Med. Chem. 11, 1107–1115. 27. Lee, K., Jung, W.H., H wang, S.Y. & Lee, S.H. (1999) Fluor- obenzamidrazone thrombin inhibitors: influ ence o f fluorine on enhancing oral absorption. Bioorg. Med. Chem. Lett. 9, 2483– 2486. 28. Park, B.K. & Kitteringham, N.R. (1994) Effects of fluorine sub- stitution on drug metabolism: pharmacological and toxicological implications. Drug Metab. Rev. 26, 605–643. 29. Park, B.K., Kitteringham, N.R. & O’Neill, P.M. (2001) Metabo- lism of fluorine-containing drugs. An nu. Rev. Pharmacol. Toxicol. 41, 443–470. 30. Lu, S.F., H erbert, B., Haufe, G., Laue, K.W., Padgett, W.L., Oshunleti, O., Daly, J.W. & Kirk, K.L. (2000) Syntheses of (R)- and (S)-2- and 6 -fluoronore pinephrine and ( R)- and (S)-2- and 6-fluoroepinephrine: effect of stereochemistry on fl uorine-indu ced adrenergic selectivities. J. Med. Chem. 43, 1611–1619. 31. Bravo,P.,Resnati,G.,Angeli,P., Frigerio, M., Viani, F., Arnone, A., Marucci, G. & Cantalamessa, F. (1992) Synthesis and phar- macological evaluation of enantiomerically pure 4-deoxy-4-fluor- omuscarines. J. Med. Chem. 35, 3102–3110. 32. Tewson,T.J.,Stekhova,S.,Kinsey,B.,Chen,L.,Wiens,L.& Barber, R. (1999) Synthesis and biodistribution of R-andS-iso- mers of [ 18 F]-fluoropropranolol, a lipophilic ligand for the b eta- adrenergic receptor. Nucl Med. Biol. 26, 891–896. 33. Pyring, D., Lindberg, J., Rosenquist, A., Zuccarello, G., Kvarn- strom,I.,Zhang,H.,Vrang,L.,Unge,T.,Classon,B.,Hallberg, A. & Samuelsson, B. (2001) Design and synthesis of potent C(2)-symmetric diol-based HIV-1 protease inhibitors: effects of fluoro-substitution. J. M ed. Ch em. 44 , 3083–3091. 34. Nillroth, U., Vrang, L., Markgren, P.O., Hulten, J., Hallberg, A. & D anielson, U.H. (1997) Human i mmunode ficiency virus type 1 proteinase resistance to symmetric cyclic urea inhibitor analogs. Antimicrob. Agents Chemother. 41, 2383–2388. 35. Weislow,O.S.,Kiser,R.,Fine,D.L.,Bader,J.,Shoemaker,R.H. & Boyd, M.R. (1989) New soluble-formazan assay for HIV-1 cytopathic effects: application to high-flux screening of synthetic and n atural pr oducts for AIDS- anti-viral activity. J. Natl Cancer Inst. 81, 577–586. 36. Otwinowski, Z. & Minor, W. (1997) X-ray diffraction data c ol- lected in oscillation mode. Methods Enzymol. 276, 307–326. 37. Gewirth, D. & Otwinowski, Z. (1995) The SCALEPACK Manual. Yale University,NewHaven,CT. 38. Brunger, A.T., Adams, P.D., Clore, G.M., DeLano, W.L., Gros, P., Grosse-Kunstleve, R.W., Jiang, J.S., Kuszewski, J., Nilges, M., Pannu, N.S., Read, R.J., Rice, L.M., Simonson, T. & Warren, G.L. (1998) Crystallography & NMR system: a new software suite for macromolecular structure determination. Acta Crystallogr. D Biol. Crystallogr. 54, 905–921. 39. Jones, T.A., Zou, J Y., Cowan, S.W. & Kjeldgaard, M. (1991) Improved methods for b uilding protein models in electron d ensity maps and the location of errors in th ese models. Acta Crystallogr. A 47 , 110–119. 40. Kleywegt, G.J. & Brunger, A.T. (1996) Checking your imagina- tion: applications of the free R value . Structure 4, 897–904. 45. Guex, N. & Peitsch, M .C. (1997) SWISS-MODEL and the Swiss- PdbViewer: an environment for comparative p rotein modeling. Electrophoresis 18, 2714–2723. 41. Moyle, G.J. & Back, D. (2001) Principles and practice of HIV-protease inhibitor pharmacoenhancement. HIV Med. 2, 105–113. 42. Welch, J. (1987) Advances in the preparation of biologically active fluorinated compoun ds. Tetrahedron 43, 3123–3197. 43. Resnati, G. (1990) Aspects of the medicinal chemistry of fluoro- organic compounds. Part I. Farmaco. 45, 1043–1066. 44. Bryskier, A. & Chantot, J.F. (1995) Classification and structure- activity relationships of fluoroquinolon es. Drugs 49, 16–28. 46. Kleywegt, G.J. & Jones, T.A. (1997) Detecting folding m otifs and similarities in protein structures. Methods Enzymol. 525–545. 47. Engh, R.A. & Huber, R. (1991) Accurate bond and angle para- meters for X-ray p rotein structure refinement. Acta Crystallogr. A47, 392–400. 4602 J. Lindberg et al.(Eur. J. Biochem. 271) Ó FEBS 2004 . fluoro-substituted diol-based HIV protease inhibitors Ortho-fluorinated and meta-fluorinated P1/P1¢-benzyloxy side groups significantly improve the antiviral activity and preserve. positions on P1/P1¢-benzyloxy side groups of sym- metric diol-based protease inhibitors preserve the b inding efficacy and significantly improve the antiviral