Agrobacterium tumefaciens type II NADH dehydrogenase Characterization and interactions with bacterial and thylakoid membranes ´ ´ Laetitia Bernard*,‡, Carine Desplats‡, Florence Mus†, Stephan Cuine, Laurent Cournac and Gilles Peltier ´ ´ ´ ´ CEA Cadarache, Direction des Sciences du Vivant, Departement d’Ecophysiologie Vegetale et Microbiologie des Bacteries et Microalgues, UMR 6191 CNRS-CEA, Aix-Marseille II, Saint-Paul-lez-Durance, France Keywords flavoenzyme; type II NADH dehydrogenase; plastoquinone reduction; quinone reduction; respiration Correspondence G Peltier, CEA Cadarache, Direction des ´ Sciences du Vivant, Departement d’Ecophysiologie Vegetale et Microalgues, UMR 6191 CNRS-CEA, Aix-Marseille II, F-13108 Saint-Paul-lez-Durance, France Fax: +33 442 25 62 65 Tel: +33 442 25 76 51 E-mail: gilles.peltier@cea.fr Present address ´ *UMR Microbiologie et Geochimie des sols, ´ INRA ⁄ Universite de Bourgogne, Dijon, France †Department of Plant Biology, The Carnegie Institution of Washington, Stanford, CA, USA Type II NADH dehydrogenases (NDH-2) are monomeric enzymes that catalyse quinone reduction and allow electrons to enter the respiratory chain in different organisms including higher plant mitochondria, bacteria and yeasts In this study, an Agrobacterium tumefaciens gene encoding a putative alternative NADH dehydrogenase (AtuNDH-2) was isolated and expressed in Escherichia coli as a (His)6-tagged protein The purified 46 kDa protein contains FAD as a prosthetic group and oxidizes both NADH and NADPH with similar Vmax values, but with a much higher affinity for NADH than for NADPH AtuNDH-2 complements the growth (on a minimal medium) of an E coli mutant strain deficient in both NDH-1 and NDH-2, and is shown to supply electrons to the respiratory chain when incubated with bacterial membranes prepared from this mutant By measuring photosystem II chlorophyll fluorescence on thylakoid membranes prepared from the green alga Chlamydomonas reinhardtii, we show that AtuNDH-2 is able to stimulate NADH-dependent reduction of the plastoquinone pool We discuss the possibility of using heterologous expression of NDH-2 enzymes to improve nonphotochemical reduction of plastoquinones and H2 production in C reinhardtii Note ‡These authors contributed equally to this study (Received April 2006, revised 16 May 2006, accepted June 2006) doi:10.1111/j.1742-4658.2006.05370.x Electrons that enter the respiratory chain can originate from three different types of NADH dehydrogenase Complex I (NDH-1), a multisubunit transmembrane enzyme coupling quinone reduction to proton translocation, is present in bacteria, as well as in plant, fungal and mammal mitochondria [1] Multisubunit sodiumpumping NADH : quinone oxidoreductases are found in some bacterial respiratory chains [2,3] Monomeric type II NADH dehydrogenases (NDH-2), which contain a flavinic cofactor and are incapable of H+ Abbreviations DPI, diphenyleneiodonium; IPTG, isopropyl thio-b-D-galactoside; NDH-1, NADH dehydrogenase or Complex I; NDH-2, type II NADH dehydrogenases; PQ, plastoquinone; PS I, photosystem I; PS II, photosystem II; ROS, reactive oxygen species; SOD, superoxide dismutase; UQ, ubiquinone FEBS Journal 273 (2006) 3625–3637 ª 2006 The Authors Journal compilation ª 2006 FEBS 3625 Agrobacterium tumefaciens NDH-2 L Bernard et al pumping activity, have been evidenced in plant mitochondria [4–6], some bacteria [7–9], yeasts [10–12] and more recently in archae [13] and protozoans [14] Progress in systematic genome sequencing over the last decade has revealed numerous putative NDH-2 sequences in various types of organisms [15] Prokaryotic NDH-2s appear to play an important role in both aerobic and anaerobic metabolism, and fulfil a high diversity of functions, depending on the organism and the environmental conditions For example, in the aerobic nitrogen-fixing bacteria Azotobacter vinelandii, a NDH-2 protects nitrogenase from O2 inhibition, by drastically increasing the respiration rate [16] In the facultative aerobe Bacillus subtilis [17] or in the obligatory fermentative aerotolerant Zymomonas mobilis [18], NDH-2 has been reported to replace NDH-1 in a simplified respiratory chain A NDH-2 has been shown to mediate electron transfer to the membranebound methane monooxygenase of the methanotroph Methylococcus capsulatus [19] In cyanobacteria, the existence of several NDH-2s has been reported Although one of these was able to complement an Escherichia coli-mutant deficient in NDH-1 and NDH-2, they were proposed, because of their low activity, to have a sensor rather than a bioenergetic function [20] In other bacteria, although the physiological role of NDH-2 is still unclear, the NDH-1 ⁄ NDH-2 ratio seems to be regulated as a function of variations in the growth conditions [21] In chloroplasts of higher plants and algae, in addition to the photosynthetic electron transfer chain oxidizing water at photosystem II (PS II) and reducing NADP+ at photosystem I (PS I), the existence of a respiratory chain including both nonphotochemical reduction and oxidation of the plastoquinone (PQ) pool has been shown [22] In higher plant chloroplasts, dark PQ reduction is mediated by a multisubunit complex homologous to bacterial complex I [23,24] In the green unicellular alga Chlamydomonas reinhardtii such a complex is absent from chloroplasts [22] Based on pharmacological studies, the involvement of a plastidial NDH-2 enzyme has been proposed [25,26] Whether bacterial or mitochondrial NDH-2s, which normally reduce ubiquinones (UQs), are able to reduce PQs and interact with the photosynthetic electron transport chain is not established In this study, we report on the isolation of an Agrobacterium tumefaciens gene coding for a putative NDH-2 (AtuNDH-2) Following expression in E coli, a His-tagged protein was purified by nickel-affinity chromatography The purified AtuNDH-2 recombinant protein is shown to complement growth on a minimal medium of an E coli mutant strain deficient in 3626 both NDH-1 and NDH-2, and to supply electrons to the respiratory chain when incubated with bacterial membranes prepared from this mutant AtuNDH-2 is also shown to reduce PQs of the photosynthetic electron transport chain when incubated with C reinhardtii thylakoids Results Sequence analysis of AtuNDH-2 The A tumefaciens genome, which is 60% GC rich, contains a unique protein sequence sharing common features with already described NDH-2 genes (NCBI accession number AI2824) The putative A tumefaciens NDH-2 protein sequence (AtuNDH-2) showed relatively poor identity with E coli (NDH), Saccharomyces cerevisiae (NDE1) and Solanum tuberosum (StNDB1) protein sequences, respectively, 28, 26 and 25% The AtuNDH-2 sequence was compared with 49 NDH-2 or putative NDH-2 sequences from prokaryotes, fungi and plants using phylogenetic analysis (Fig 1) NDH-2 can be classified in four different groups, three of which contain prokaryotic NDH-2s The ‘prokaryote A’ subgroup includes most of the known eubacterial NDH-2s, including the E coli [27], B subtilis [17] and A vinelandii [16] enzymes The ‘prokaryote C’ subgroup contains cyanobacterial NDH-2 as well as plant NDC [6] AtuNDH-2 belongs to the poorly described ‘prokaryote B’ group containing eubacterial and cyanobacterial sequences The last subgroup contains plant NDA, NDB as well as yeast and C reinhardtii sequences AtuNDH-2 shares from 24 to 28% identity and 40 to 48% similarity with rotenone-insensitive NAD(P)H dehydrogenases of plant mitochondria Alignment of representative NDH-2 protein sequences from the four different families (Fig 2) revealed high conservation in two domains showing most of the criteria for dinucleotide binding, including a bab fold and a GxGxxG motif [28] Based on a comparison with the lipoamide dehydrogenase sequence (an enzyme which shares significant similarity with NDH-2s and the structure of which has been resolved), the first binding site can be attributed to FAD and the second to NAD(P)H [27] The C-terminal domain of the protein, which contains  20 hydrophobic residues (Fig 2), has been suggested to anchor the enzyme to the membrane [29] Expression, purification and biochemical characterization of AtuNDH-2 In order to express a His-tagged AtuNDH-2 protein in E coli, the AtuNDH-2 gene sequence was amplified FEBS Journal 273 (2006) 3625–3637 ª 2006 The Authors Journal compilation ª 2006 FEBS L Bernard et al Agrobacterium tumefaciens NDH-2 Fig Phylogenetic analysis of bacterial, plant, fungal and protist NDH-2-like protein sequences Because lipoamide dehydrogenase shares a probable common ancestry with NDH-2 (30), the E coli sequence (LpdA) was chosen as a common root Corresponding GenBank (GenPept) accession numbers, NCBI RefSeq numbers or references of the protein sequences used are: E coli-LpdA, NP_308147; Acidianus ambivalens, CAD33806; C reinhardtii (N2Cr347); Arabidopsis thaliana (AtNDC), NP_568205; Synechocystis (slr1743), NP_441103; Nostoc-5, BAB75793; Synechocystis (sll1484), NP_442910; Nostoc-6, BAB76910; Leptospira interrogans, NP_714580; Chlorobium tepidum, NP_661273; Xanthomonas axonopodis, AAM38664.1; Brucella melitensis, AAL54028; A tumefaciens (AtuNDH-2), AI2824; Sinorhizobium meliloti, NP_386185; Mesorhizobium loti, NP_102176; Bradyrhizobium japonicum-1, NP_767691.1; Synechocystis (slr0851), NP_441107; Nostoc-1, BAB73083; Corynebacterium glutamicum, CAB41413; Mycobacterium smegmatis, AAC46302.1; Nostoc-4, BAB74663; Desulfovibrio desulfuricans, ZP_00130145; Cytophaga hutchinsonii, ZP_00309856; Bacteroides thetiaotaomicron, NP_810450; Neurospora crassa (NcNDI1), EAA27430; Trypanosoma brucei, AAM95239; S tuberosum (StNDA1), CAB52796; A thaliana (AtNDA1), NP_563783; N crassa (NcNDE1), CAB41986; S tuberosum (StNDB1), CAB52797; A thaliana (AtNDB1), NP_567801; C reinhardtii (N2Cr147), C reinhardtii (N2Cr247), S cerevisiae (NDI1), NP_013586; S cerevisiae (NDE1), NP_013865; S cerevisiae (NDE2), NP_010198; Yarrowia lipolytica (YlNDH-2), XP_505856; N crassa3, EAA29772; Burkholderia cepacia-2, ZP_00224966; Z mobilis, AAD56918; E coli, NP_415627; Haemophilus influenzae, NP_438906; B cepacia-1, ZP_00223855; A vinelandi, AAK19737; Pseudomonas fluorescens, AAF97237; B japonicum-2, NP_770367.1; Rhodopseudomonas palustris, ZP00010689; Halobacterium, NP_279851; B subtilis, NP_389111; Deinococcus radiodurans, NP_294674 When homologue sequences originating from the same organism were closely related, a single representative has been selected (e.g A thaliana NDAs or NDBs) from genomic DNA, cloned into pSD80 with a C-terminus (His)6-tag sequence The resulting plasmid was used to transform E coli strain DH10b The recombinant protein, mainly present in membrane fractions (Fig 3A), was purified by nickel-affinity chromatography from membrane protein extracts Following elution with an imidazole gradient, collected fractions were loaded on a SDS ⁄ PAGE gel (Fig 3A) A single FEBS Journal 273 (2006) 3625–3637 ª 2006 The Authors Journal compilation ª 2006 FEBS 3627 Agrobacterium tumefaciens NDH-2 L Bernard et al Fig Conserved sequence motifs in NDH-2s from various organisms GenBank accession numbers: C glutamicum, CAB41413; S tuberosum (StNDB1), CAB52797; S cerevisiae (NDE1), NP_013865; Synechocystis (slr1743), NP_441103 In the consensus sequence, conserved residues in at least five of seven or six sequences are indicated in one letter code: upper case when conserved in every sequence, lower case in other cases Functionally similar residues are marked with the following symbols: D, hydrophobic; fi , aromatic; #, acidic or neutral counterpart Grey shaded regions in C-terminal sequences represent hydrophobic fragments detected using MITOPROT II software (v 1.0) corresponding to the maximal local hydrophobicity indicated protein band was eluted by 200 mm imidazole This band, located below the 50 kDa molecular mass marker (AtuNDH-2 has an expected size of 46 kDa), was recognized by an antibody directed against the poly(His) tag sequence and was recovered mainly in the membrane fraction The purified enzyme was used for further biochemical characterizations Following heat denaturation of the enzyme, the flavine cofactor was analysed by HPLC and identified as FAD (Fig 3B) Figure 3C shows the absorption spectrum of AtuNDH-2 protein Typical peaks of FAD-containing proteins were observed, confirming the nature of the cofactor [19] By using the extinction coefficient at 450 nm we calculated that the stoichiometric ratio of flavinic cofactor per mole of protein reaches 1.02 mol, which is characteristic of NDH-2 proteins [21] The capacity of the purified enzyme to oxidize NADH or NADPH was measured by monitoring absorbance decay at 340 nm in the presence of various electron acceptors (Table 1) In the presence of ferricyanide, the NADH-oxidizing activity saturated around 50 lm NADH and reached 100 nmolỈmin)1Ỉlg)1 3628 protein In the presence of NADPH, a significant activity was measured, but it was not possible to observe saturation within a concentration range suitable for spectrophotometric studies An activity of  50 nmolỈmin)1Ỉlg)1 protein was measured at 200 lm NADPH Various quinone acceptors were tested In the presence of the soluble quinone Q0, a NADH oxidation activity of 140 nmolỈmin)1Ỉlg)1 protein was measured We also tested the ability of the protein to use decyl-ubiquinone (UQ) and decyl-PQ as acceptors Because these quinones are poorly soluble in aqueous solutions, the rates measured in these experiments should be considered as indicative Nevertheless, it clearly appears that AtuNDH-2 is able to catalyse the oxidation of NADH in the presence of both quinone acceptors (Table 1) In the absence of acceptors, the enzyme was found to oxidize NADH and NADPH at limited rates, probably due to the capacity of the enzyme to interact directly with O2 [30] This property was studied by measuring O2 consumption using an O2 electrode (Table 2) In this assay, the affinity of the enzyme for FEBS Journal 273 (2006) 3625–3637 ª 2006 The Authors Journal compilation ª 2006 FEBS L Bernard et al A Agrobacterium tumefaciens NDH-2 Table Kinetic parameters of NADH oxidation determined on purified AtuNDH-2 in the presence of various electron acceptors, using spectrophotometric measurements at 340 nm Km (lM) Ferricyanide (1 mM) Q0 (100 lM) PQ (2 mM) UQ (2 mM) B Vmax (nmolỈmin)1Ỉlg)1 protein) 3.5 – – 100 140 66 26 Table Km and Vmax of O2 reduction by AtuNDH-2 measured using an O2 electrode in the presence of NADH and NADPH as electron donors Km (lM) NADH NADPH Vmax (nmolỈmin)1Ỉlg)1 protein) 52.9 201 2.26 2.70 In vitro interaction of AtuNDH-2 with bacterial and thylakoid membranes C Fig Purification of His-tagged AtuNDH-2 by nickel-affinity chromatography (A) and analysis of the flavinic cofactor (B) (A) Coomassie Brilliant Blue-stained SDS ⁄ PAGE and western blot analysis using an anti-histidine IgG T, total protein extract from bacterial cells expressing AtuNDH-2; S, soluble proteins; M, membrane proteins solubilized by dodecyl maltoside; E1 and E2, eluted fractions from nickel-affinity chromatography using 200 mM imidazole MW, molecular mass markers (B) HPLC separation and fluorometric analysis of the flavinic cofactor Continuous line, cofactor extracted from purified recombinant AtuNDH-2; dashed black line, FAD standard; dashed grey line, FMN standard (C) UV-visible spectrum of 0.3 lM of purified AtuNDH-2 NADPH was about four times lower than for NADH Similar Vmax values were measured for NADPH and NADH, but under these conditions, measured Vmax values were ~ 50 times lower than in the presence of ferricyanide or quinone acceptors The ability of AtuNDH-2 to interact with bacterial membranes was studied using membrane preparations of an E coli mutant lacking both NDH-1 and NDH-2 The functionality of the respiratory chain of these preparations was first checked in the presence of succinate as substrate of complex II (data not shown) As expected, no O2 uptake was detected when mutant membranes were supplemented with NADH (Fig 4A) Preincubation of mutant membranes with AtuNDH-2 resulted in an O2 uptake upon NADH addition, whereas the enzyme alone consumed O2, but at a much lower rate (Fig 4B) At variance with respiratory O2 uptake, which leads to reduction of O2 into H2O, direct NADH oxidation activity of NDH-2 generates reactive oxygen species (ROS) [9] Superoxide dismutase (SOD) and catalase were added to the assay medium to convert back ROS into O2 and therefore minimize the contribution of direct oxidation which is not connected to electron transfer into the respiratory chain to O2 uptake Then, when assays on E coli membranes are performed in the presence of these scavengers, O2 uptake rates essentially reflect the quinone reductase activity of the enzyme (Fig 4A,B) Under these conditions, at pH 7.2, similar Vmax values (~ 3.7 nmol O2Ỉmin)1Ỉlg)1 protein) were obtained for both NADH and NADPH oxidations (data not shown) Diphenyleneiodonium (DPI), an inhibitor of flavin enzymes, inhibited both NADH- and NADPHdependent reactions by ~ 75%, half inhibition being obtained at DPI concentrations of ~ 13 lm (data not shown) FEBS Journal 273 (2006) 3625–3637 ª 2006 The Authors Journal compilation ª 2006 FEBS 3629 Agrobacterium tumefaciens NDH-2 L Bernard et al A C B A B Fig Interaction of AtuNDH-2 with membranes of the E coli mutant ANN0222 and effect of DPI (A) Effect of AtuNDH-2 on NADH-dependent O2 uptake measured in bacterial membranes following addition of 200 lM NADH; (a) control; (b) purified AtuNDH-2 (1.5 lgỈmL)1) was preincubated with bacterial membranes prior to measurements; (c) effect of SOD (500 unitsỈmL)1) and catalase (1000 unitsỈmL)1) addition to (b); (B) NADH-dependent O2 reduction by AtuNDH-2 (a) and effect of SOD and catalase addition (b) The ability of AtuNDH-2 to interact with PQs of the photosynthetic electron transport chain was studied by performing chlorophyll fluorescence measurements on thylakoid membranes of C reinhardtii (Fig 5) When measured under nonactinic light, the chlorophyll fluorescence level is an indicator of the PQ pool redox state in the dark [31] Under anaerobic conditions to prevent dark reoxidation of the PQ pool, addition of NADH (200 lm) to C reinhardtii thylakoid membranes provoked a slow increase in the chlorophyll fluorescence level, indicating a reduction of the PQ pool (Fig 5) This activity was recently suggested to result from the activity of an endogenous NDH-2-type enzyme [26] When AtuNDH-2 was incubated with thylakoid membranes prior to chlorophyll fluorescence measurements, the redox state of PQ increased significantly more rapidly, the effect being dependent on AtuNDH-2 concentrations (Fig 5) AtuNDH-2 was also found to stimulate (two- to threefold) light-dependent O2 uptake measured in C reinhardtii thylakoid membranes in the presence of NADH, 3-(3,4-dichlorophenyl)-1,1-dimethyl urea (DCMU) and methyl viologen (data not shown), this measurement supplying an estimation of the electron flow from NADH to PS I through the PQ pool [26] 3630 Fig Interaction of AtuNDH-2 with C reinhardtii thylakoid membranes The increase in chlorophyll fluorescence was measured under low light in response to NADH addition (final concentration 200 lM) to a suspension of C reinhardtii thylakoids (30 lg chlorophyllỈmL)1) (A) control; (B, C) thylakoid membranes were preincubated with purified AtuNDH-2 at two protein concentrations (2.5 and lgỈmL)1 final protein concentration, respectively) for 30 before measurements We conclude from these experiments that AtuNDH-2 is able to interact with thylakoid membranes and reduce PQs Functional complementation of a E coli mutant strain Finally, we tested the ability of AtuNDH-2 to function as a NADH dehydrogenase in vivo by studying its ability to restore growth of an E coli mutant strain ANN0222 lacking both NDH-1 and NDH-2 Such a deleted strain has been reported to grow normally on a Luria–Bertani medium, but not be able to grow on a minimal medium supplemented with mannitol as the sole source of carbon [20] As shown in Fig 6A, control transformants (corresponding to cells transformed with empty vector) could not grow on the minimal medium, nor could untransformed cells (data not shown) In contrast, the mutant strain expressing AtuNDH-2 after induction with 0.1 mm isopropyl thiob-d-galactoside (IPTG) could grow under these conditions Note that partial complementation of the mutant was observed in the absence of IPTG, likely indicating significant IPTG-independent expression of the protein Using an antibody raised against the recombinant protein, AtuNDH-2 was detected in protein extracts from the complemented ANN0222 strain (Fig 6C) Most of the protein was present in membrane fractions, FEBS Journal 273 (2006) 3625–3637 ª 2006 The Authors Journal compilation ª 2006 FEBS L Bernard et al Agrobacterium tumefaciens NDH-2 A B C Fig Growth complementation by AtuNDH-2 of a E coli mutant lacking both NDH-1 and NDH-2 (A) Colony forming assays on rich medium (Luria–Bertani) and minimal medium (M9) supplemented with mannitol Control, transformation control of the E coli strain ANN0222; AtuNDH-2, ANN0222 transformant strain expressing AtuNDH-2 under the control of an inducible promotor Induction was realized by addition of 0.1 mM IPTG (B) O2 uptake measurements in membranes of the E coli strain ANN0222 (control) and in the transformant strain expressing AtuNDH-2 NADH (200 mM final concentration) was added when indicated (C) Western blot analysis using an antibody raised against AtuNDH-2 S, soluble protein fraction; M, membrane protein fraction AtuNDH-2 accumulation was analysed in response to induction by 0.1 or 0.5 mM IPTG Gel loading was  2.5 and 30 lg proteins in M and S lanes, respectively Right, immunodetection of purified AtuNDH-2, at 0.1, 0.2 and 0.3 lg protein ⁄ lane from left to right only a small portion being found in soluble proteins Significant expression of AtuNDH-2 was detected in the absence of IPTG, consistent with the partial complementation observed under these conditions AtuNDH-2 activity was assessed on membrane fractions prepared from the transformed mutant strain by measuring NADH- and NADPH-dependent O2 consumption rates Whereas only low O2 uptake activity was induced by NADH addition on membranes of the control transformant strain, strong O2 uptake was observed in membranes containing AtuNDH-2 (Fig 6B) Oxygen-uptake activities were measured in membranes of the complemented ANN0222 strain to determine apparent kinetic parameters of AtuNDH-2 Under these conditions, AtuNDH-2 oxidized both NADH and NADPH with similar maximal rates, and with a much higher affinity for NADH (Km ¼ 12.5 lm) than for NADPH (Km ¼ 1129 lm) (data not shown) Discussion We report here the cloning, expression and characterization of AtuNDH-2, the A tumefaciens orthologue to rotenone-insensitive NAD(P)H dehydrogenases The purified enzyme showed a NADH : Q0 oxidoreductase activity in the range of activities measured for other purified enzymes, such as the C glutamicum NDH-2 [9] or the Trypanosoma brucei NDH-2 [14] AtuNDH-2 appears, however, 1000 less active than the purified His-tagged E coli enzyme, the high activity of which has been attributed either to differences in purification protocols or to the preincubation with phospholipids [27] Like several other organisms, including E coli, Synechocystis PCC6803 and plant mitochondria, A tumefaciens appears to contain both a NDH-1 complex and a functional NDH-2 Whether AtuNDH-2 fulfils a bioenergetic function or acts as a sensor, as suggested FEBS Journal 273 (2006) 3625–3637 ª 2006 The Authors Journal compilation ª 2006 FEBS 3631 Agrobacterium tumefaciens NDH-2 L Bernard et al in cyanobacteria [20], will require further study From amperometric and chlorophyll fluorescence measurements performed on E coli membranes and on C reinhardtii thylakoids, AtuNDH-2 is concluded to interact with bacterial membranes and UQs and also with thylakoid membranes and PQs Although NDH-2s are membrane-bound enzymes, the nature of membrane ⁄ protein interactions has not been elucidated Membrane binding seems to rely on different mechanisms depending on the enzyme, some involving transmembrane anchorage, whereas others involve electrostatic interactions A membrane association via amphiphatic helices has been suggested for E coli and Acidianus ambivalens NDH-2s [13,29] 2D structure analysis, performed on the 50 NDH-2 sequences used to build the phylogenetic tree, predict the presence of C-terminal transmembrane helices in the prokaryotic B subgroup (including AtuNDH-2) AtuNDH-2 also contains a hydrophobic domain enriched in aromatic residues located between its two cofactor binding sites This domain has been proposed to be involved in the interaction with hydrophobic quinones of respiratory chains [11,13] Respective contributions of both hydrophobic domains to membrane and quinone interactions require further study In higher plants, addition of NAD(P)H to thylakoid membrane preparations has been shown to stimulate nonphotochemical reduction of the PQ pool [31] Although higher plant chloroplasts contain a functional NDH-1 complex [23,24], pharmacological studies concluded that a NDH-2-like enzyme is also involved in this phenomenon [31] C reinhardtii chloroplasts are recognized to lack NDH-1 complex [22] A recent study conducted in our laboratory concluded that, in C reinhardtii, the enzyme involved in the dark reduction of PQs is a NDH-2-type enzyme [26] Nonphotochemical reduction of PQs is a reaction of special interest because it may lead to the production of hydrogen Indeed, under anaerobic conditions, C reinhardtii is able to efficiently produce hydrogen, using solar energy and water, because of the existence of a reversible hydrogenase connected to its photosynthetic electron transport chain [32] Photobiological hydrogen production is a natural phenomenon of high biotechnological interest [33,34], but is strongly limited by the extreme O2 sensitivity of the hydrogenase, O2 being produced by PS II during photosynthesis To overcome this limitation, the development of a sequential inhibition of PS II based on sulfur deprivation, has been proposed [35] Under conditions of sulfur deficiency, PS II activity is inhibited, allowing the establishment of anaerobic conditions favourable to hydrogen production In the absence of PS II, hydro3632 gen production is possible thanks to the existence of a nonphotochemical PQs reduction pathway using stromal reductants originating from starch catabolism [36,37] This pathway, which allows hydrogen production without simultaneous O2 production and can sustain hydrogen production on a relatively long time scale [37], was recently proposed to involve a plastidial NDH-2 [26] Because nonphotochemical reduction of PQ may constitute a limiting step of hydrogen production under certain experimental conditions, overexpression of a NDH-2 in C reinhardtii plastid should be considered as a valuable optimization strategy towards improving the anaerobic phase of hydrogen production AtuNDH-2 appears as a suitable gene for such a purpose because its high GC content is similar to that of C reinhardtii genomic DNA The obtention of transformants expressing AtuNDH-2 is currently in progress in our laboratory AtuNDH-2 showed a much higher affinity for NADH than for NADPH, although both substrates were oxidized with comparable Vmax values (Table 2) Several NDH-2s are strict NADH- [14,27] or strict NADPH-dehydrogenases [15,38], whereas a few others, mainly from plants, are able to oxidize both substrates indifferently [5] Michalecka et al [38] suggested that the presence of an acidic residue (E or D) at the end of the second b sheet of the dinucleotide-binding site would confer NADH specificity by providing hydrogen bonding to the ribose moiety (Fig 2) In enzymes specifically oxidizing NADPH, this acidic residue is replaced by a neutral counterpart (Q or N) The presence of a glutamic residue in AtuNDH-2 is in agreement with the enzyme preference for NADH However, AtuNDH-2 was able to oxidize NADPH at a similar maximal rate, but with a lower affinity Although molecular basis of the NDH-2s ability to use both substrates are currently unknown, this property will be important for optimizing hydrogen production through chloroplast engineering, NADPH being generally thought to be the major form of reducing power in this compartment Like most reported alternative NADH dehydrogenases [39,40], AtuNDH-2 was shown to contain FAD as a prosthetic group FAD-containing enzymes driving two-electron reduction are believed to be less likely than FMN-containing enzymes to produce superoxides [41] Nevertheless, AtuNDH-2, which contains FAD, has the ability to produce ROS at a significant rate (Table 1) Whereas very few other studies have considered this autoxidation trait [9], Messner & Imlay [30] have shown that E coli NDH-2 is a primary site of superoxide formation in the aerobic respiratory chain, with intensity varying according to its FEBS Journal 273 (2006) 3625–3637 ª 2006 The Authors Journal compilation ª 2006 FEBS L Bernard et al expression level and reduction status Such a property may limit the potential biotechnological use of NDH-2like enzymes Expression of AtuNDH-2 in plastids may therefore lead to the generation of additional ROS which may alter cell viability and in the case chloroplast-detoxifying mechanisms would be limiting This property should be taken into consideration in experiments aiming to overexpress NDH-2-like enzymes in plastids Experimental procedures Strains and media A tumefaciens C58 was grown in Luria–Bertani medium (1% tryptone, 0.5% yeast extract, 0.5% NaCl, pH 7.0) in the presence of rifampicine (100 lgỈmL)1) at 30 °C for 24 h before genomic DNA extraction Cloning and gene expression were performed in E coli dH10b The E coli mutant lacking both NDH-1 and NDH-2 ANN0222 was generously provided by T Friedrich (Freiburg University, Germany) Complementation assays were performed on a minimal medium supplemented with mannitol (1· M9 salts, · 10)3 m MgSO4, 10)4 m CaCl2, 0.4% mannitol) Transformed bacteria were selected on Luria–Bertani medium containing ampicillin (100 lgỈmL)1) C reinhardtii wildtype (137c) was grown in a Tris-acetate phosphate medium as described previously [42] Algal culture was maintained at 25 °C under continuous agitation and under an illumination of 100 lmolỈphotonỈm)2Ỉs)1 Chemicals All chemicals were purchased from Sigma-Aldrich (St Louis, MO, USA) except DNP-INT which was generously provided by A Trebst (Bochum University, Germany) Cloning, expression and purification of His-tagged NDH-2 The AtuNDH-2 gene was amplified from A tumefaciens genomic DNA, using the following couple of primers: (F) CGCCAATTGATGCAAGAACATCATGTT; (R) AAAA CTGCAGTCAATGATGATGATGATGATGGGCCTCG TCCTTCAGCG MfeI and PstI sites were inserted in forward and reverse primers, respectively, upstream and downstream the start and the stop codons, whereas a (His)6coding sequence was inserted in the reverse primer right upstream the stop codon The amplified DNA was digested by MfeI and PstI and ligated into the ampicillin-resistant expression vector pSD80 [43], which was digested by EcoRI and PstI, and introduced by electroporation in E coli dH10b Ampicillin-resistant transformants were screened by PCR for the presence of the AtuNDH-2 gene, using (F) and Agrobacterium tumefaciens NDH-2 (R) primers The construct has been verified by sequencing The plasmid was named pSDN2Ag6H and used to cotransform E coli dH10b with chloramphenicol-resistant pRare plasmid, carrying genes coding for the six rarest tRNA of E coli (Merck Biosciences, Darmstadt, Germany) His-tagged NDH-2 was expressed in Luria–Bertani medium in the presence of 50 lgỈmL)1 ampicillin and 25 lgỈmL)1 chloramphenicol and incubated at 37 °C under vigorous shaking Expression was induced for h by the addition of 0.5 mm IPTG when the culture reached D ¼ 0.5 Cells were then harvested by centrifugation and washed with a solution containing 500 mm KCl, 10 mm Tris ⁄ HCl, pH 7.5, 0.2 mm phenylmethylsulfonyl fluoride and stored at )80 °C Protein purification Membrane isolation and nickel-affinity purification of A tumefaciens His-tagged NDH-2 were performed following the protocol developed by Bjorklof et al [27] for puriă ă cation of an His-tagged E coli NDH-2 Membranes were solubilized using dodecyl maltoside and the enzyme was ˚ ˚ purified by FPLC (Akta FPLC, Amersham Biosciences, Uppsala, Sweden) using a HiTrap chelating nickel column (Amersham Biosciences) The bound NDH-2 was eluted using an imidazole gradient Collected fractions were analysed by SDS ⁄ PAGE Immunological analysis A commercial antibody directed against the His-tag sequence (Sigma ref H-1029) was used to identify the purified protein The purified enzyme was collected in a mL volume and concentrated by ultrafiltration to a 900 lL final volume Glycerol 100% (200 lL) was added before )80 °C storage The enzyme concentration was estimated by SDS ⁄ PAGE comparing to a range of BSA standards A rabbit serum was raised against the purified AtuNDH-2 protein (Agro-Bio, Villeny, France) and further used to probe the presence of the AtuNDH-2 protein in soluble and membrane protein fractions Proteins were separated on a 10% SDS ⁄ PAGE gel and transferred to a nitrocellulose membrane using a semidry transfer technique The appropriate antibody was correctly diluted: : 2000 diluted anti-His IgG (Fig 3); : 10 000 diluted polyclonal anti(AtuNDH-2) serum (Fig 6) For the anti-His IgG, the detection reaction (anti-rabbit alkaline phosphatase conjugated as secondary antibody) was performed according to the protocol recommended by the manufacturer (Sigma) For the anti-(AtuNdh2) IgG, the Alexa 680 goat anti-rabbit (Invitrogen, Molecular Probes, Carlsbad, CA, USA) was used as secondary antibody and the detection was performed by using the LICOR (Lincoln, NE, USA) Odyssey system FEBS Journal 273 (2006) 3625–3637 ª 2006 The Authors Journal compilation ª 2006 FEBS 3633 Agrobacterium tumefaciens NDH-2 L Bernard et al Colony-forming assays ANN0222 competent cells were transformed either with pSDN2ag6 h plasmid or empty vector as a control and transformants were selected on Luria–Bertani agar containing ampicillin Transformants were grown to mid-exponential phase at 37 °C in ampicillin-containing Luria–Bertani medium Cells were washed once with sterile M9 medium supplemented with mannitol as the sole source of carbon Cells were then diluted in M9 ⁄ mannitol medium and spotted on M9 ⁄ mannitol ⁄ agar plates containing ampicillin and different IPTG concentrations Plates were incubated at 37 °C for two days As a control, cells were plated on a Luria–Bertani agar medium containing ampicillin and appropriate IPTG concentrations and incubated at 37 °C overnight Flavin analysis The nature of the flavinic cofactor was determined as described previously [14] The purified enzyme was boiled for 3–4 followed by centrifugation Supernatant was analysed by HPLC using a 150 · 4.6 mm internal diameter Supelcosil LC-DP column (Sigma-Aldrich) The composition of the mobile phase (flow rate of mLỈmin)1) was 80% of 0.1% TFA in water and 20% of 0.1% TFA in 40% acetonitrile Excitation and emission wavelengths of the fluorescence detector were set at 450 and 525 nm, respectively FAD and FMN standards were used to identify the nature of the flavinic cofactor UV-visible spectra of native and boiled proteins were recorded using a Cary50 spectrophotometer (Varian, Palo Alto, CA, USA) Proteins were diluted in 50 mm Tris ⁄ HCl buffer pH 7.5, 10 mm NaCl, mm MgCl2 and the FAD content was determined spectrophotometrically in protein free supernatant from boiled samples (e450 ẳ 11 300 m)1ặcm)1) Preparation of bacterial and thylakoid membranes A 50 mL Luria–Bertani–tetracyclin E coli ANN0222 culture was harvested at the end of exponential growth phase (D ¼ 1) by centrifugation (15 min, 3200 g) Cells were washed twice and resuspended in 10 mL of lysis buffer A (200 mm Tris ⁄ Cl pH 8, 2.5 mm EDTA and 0.2 mm phenylmethylsulfonyl fluoride) according to Bjorklof et al [27] ă ă Cells were disrupted by passing twice through a chilled French pressure cell maintained at 16 000 p.s.i., and membrane fraction was collected by centrifugation (30 min, °C, 48 500 g, Beckman JA-20 rotor; Beckman Coulter, Fullerton, CA, USA) Membranes were resuspended in 200 lL of analysis buffer B (50 mm phosphate buffer, pH 7.5 and 150 mm NaCl) according to Bjorklof et al [27] ă ă The same procedure was followed to prepare membranes 3634 from ANN.0222 transformed cells either with pSD80 or pSDN2Ag6H A 200 mL volume of C reinhardtii culture grown on Trisacetate phosphate medium was harvested in exponential growth phase, centrifuged, washed in 35 mm Hepes-NaOH buffer, pH 7.2 and resuspended in 12 mL of buffer C (50 mm Tricine-NaOH, 10 mm NaCl, mm MgCl2; pH 8) supplemented with 1% BSA w ⁄ v, mm benzamidine, mm phenylmethylsulfonyl fluoride The following operations were carried out in the dark at °C Cells were disrupted by two cycles of a chilled French pressure cell (2000 p.s.i) The homogenate was centrifuged at 500 g for using an Eppendorf 8510R centrifuge (Eppendorf, Hamburg, Germany) The pellet, containing unbroken cells, was discarded The supernatant was centrifuged at 3000 g for 15 using an Eppendorf 8510R centrifuge to collect thylakoid membranes Thylakoid membranes were resuspended in 250–500 lL of buffer C and stored on ice, in the dark Chlorophyll extraction was performed in 80% acetone ⁄ H2O v ⁄ v, and chlorophyll concentration was calculated from absorption measurements at 663 and 646 nm [44] Spectrophotometric measurement of enzymatic activity Assays of NAD(P)H oxidation were performed by monitoring absorbance decrease at 340 nm, concentration variations being deduced from these measurements by applying the extinction coefficient of NAD(P)H at this wavelength (6.22 mm)1Ỉcm)1) NAD(P)H, acceptors and protein extracts (incubated or not with membranes of E coli ANN0222) were added successively Bovine SOD (500 unitsỈmL)1) and catalase (1000 unitsỈmL)1) were added to the assay medium O2 uptake by bacterial and thylakoid membranes O2 uptake was measured using a Clark electrode (DW2 ⁄ 2, Hansatech, King’s Lynn, UK) In some experiments, a reaction mixture containing 10 lL of membranes of E coli ANN0222 and 1.5 lg of purified enzyme was preincubated 10 on ice, then diluted in 990 lL of buffer B and introduced into the electrode chamber O2 consumption was measured at 25 °C in the presence of NADH or NADPH O2 uptake was also followed in absence of bacterial membranes to measure direct oxidation by the enzyme Catalase (1000 unitsỈmL)1) and SOD (500 unitsỈmL)1) were added to the assay medium Inhibitory effects of DPI were quantified after 10 incubation with membrane samples before measurements Chlorophyll fluorescence measurements Measurements were achieved at 25 °C, in anaerobic conditions a pulse modulated amplitude fluorometer (PAM FEBS Journal 273 (2006) 3625–3637 ª 2006 The Authors Journal compilation ª 2006 FEBS L Bernard et al 101-103, Walz, Effeltrich, Germany) The optic fibre of the fluorometer was placed close to the glass tube of the O2 electrode reaction chamber (1 mL reaction volume: 50 lL of thylakoid membrane suspension and 950 lL of buffer C, pH 7.2) Nonactinic modulated light (650 nm, 1.6 kHz) was used to determine the chlorophyll fluorescence level F0 The maximal chlorophyll fluorescence level (Fm) was measured under s saturating light pulse (~ 1000 lmol photonsỈ m)2Ỉs)1) Anaerobiosis was achieved ~ 15 before measurements by addition to the thylakoid membrane suspension of glucose (10 mm) and glucose oxidase (2 mgỈmL)1) in the presence of catalase (8000 unitsỈmL)1) Bioinformatics Database searches of NDH-2 homologues were performed at the National Center of Biotechnology Information web site (http://www.ncbi.nlm.nih.gov) using BLASTp and tBLASTn algorithms [45] Multiple alignments were achieved by using the multalin software located on the Institut National de la Recherche en Agronomie (Toulouse, France) web site (http://prodes.toulouse.inra.fr/multalin/ multalin.html) The phylogenetic tree was obtained by neighbour-joining analysis of 50 whole protein sequences using clustalw algorithm, with default parametrization, and with the treeviewppc software Predictions of transmembrane helices were applied using the tmhmm program, based on a hidden Markov model (http://www.cbs.dtu.dk/ services/TMHMM/) mitoprot ii (v 1.0) was used to determine segments of high local hydrophobicity [46] Agrobacterium tumefaciens NDH-2 10 11 12 Acknowledgements We are grateful to Professor Thorsten Friedrich for providing the E coli double mutant strain ANN0222 13 References Friedrich T (2001) Complex I: a chimaera of redox and conformation-driven proton pump? J Bioenerg Biomembr 33, 169–177 Steuber J (2001) Na+ translocation by bacterial NADH : quinone oxidoreductases: an extension to the complexI family of primary redox pumps Biochim Biophys Acta 1505, 45–56 Bertsova YV & Bogachev AV (2004) The origin of the sodium-dependent NADH oxidation by the respiratory chain of Klebsiella pneumoniae FEBS Lett 563, 207–212 Menz RI & Day DA (1996) Purification and characterization of a 43-kDa rotenone-insensitive NADH dehydrogenase from plant mitochondria J Biol Chem 271, 23117–23120 Rasmusson AG, Svensson AS, Knoop V, Grohmann L & Brennicke A (1999) Homologues of yeast and bacter- 14 15 16 17 ial rotenone-insensitive NADH dehydrogenases in higher eukaryotes: two enzymes are present in potato mitochondria Plant J 20, 79–87 Michalecka AM, Svensson AS, Johansson FI, Agius SC, Johanson U, Brennicke A, Binder S & Rasmusson AG (2003) Arabidopsis genes encoding mitochondrial type II NAD(P)H dehydrogenases have different evolutionary orgin and show distinct responses to light Plant Physiol 133, 642–652 Bragg PD & Hou C (1967) Reduced nicotinamide adenine dinucleotide oxidation in Escherichia coli particles NADH dehydrogenases Arch Biochem Biophys 119, 202–208 Jaworoski A, Campbell HD, Poulis MI & Young IG (1981) Genetic identification and purification of the respiratory dehydrogenase of Escherichia coli Biochemistry 20, 2041–2047 Matsushita K, Otofuji A, Iwahashi M, Toyama H & Adachi O (2001) NADH dehydrogenase of Corynebacterium glutamicum Purification of an NADH dehydrogenase II homolog able to oxidize NADPH FEMS Microbiol Lett 204, 271–276 De Vries S & Grivell LA (1988) Purification and characterization of a rotenone-insensitive NADH : Q6 oxidoreductase from mitochondria of Saccharomyces cerevisiae Eur J Biochem 176, 377–384 Kerscher SJ, Okun JG & Brandt U (1999) A single external enzyme confers alternative NADH : ubiquinone oxidoreductase activity in Yarrowia lipolytica J Cell Sci 112, 2347–2354 Melo AMP, Duarte M & Videira A (1999) Primary structure and characterisation of a 64 kDa NADH dehydrogenase from the inner membrane of Neurospora crassa mitochondria Biochim Biophys Acta 1412, 282– 287 Bandeiras TM, Salgueiro C, Kletzin A, Gomes CM & Teixera M (2002) Acidianus ambivalens type-II NADH dehydrogenase: genetic characterisation and identification of the flavin moiety as FMN FEBS Lett 531, 273– 277 Fang J & Beattie DS (2002) Novel FMN-containing rotenone-insensitive NADH dehydrogenase from Trypanosoma brucei mitochondria: isolation and characterization Biochemistry 41, 3065–3072 Melo AM, Bandeiras TM & Teixeira M (2004) New insights into type II NAD(P)H : quinone oxidoreductases Microbiol Mol Biol Rev 68, 603–616 Bertsova YV, Bogachev AV & Skulachev VP (2001) Noncoupled NADH : ubiquinone oxidoreductase of Azotobacter vinelandii is required for diazotrophic growth at high oxygen concentrations J Bacteriol 183, 6869–6874 Bergsma J, Van Dongen MBM & Konings WN (1982) Purification and characterization of NADH FEBS Journal 273 (2006) 3625–3637 ª 2006 The Authors Journal compilation ª 2006 FEBS 3635 Agrobacterium tumefaciens NDH-2 18 19 20 21 22 23 24 25 26 27 28 29 L Bernard et al dehydrogenase from Bacillus subtilis Eur J Biochem 128, 151–157 Kim JY, Song K & Rhee S (1995) A novel aerobic respiratory chain-linked NADH oxydase system in Zymomonas mobilis J Bacteriol 177, 5176–5178 Cook SA & Shiemke AK (2002) Evidence that a type-2 NADH : quinone oxidoreductase mediates electron transfer to particulate methane monooxygenase in Methylococcus capsulatus Arch Biochem Biophys 398, 32–40 Howitt CA, Udall PK & Vermaas WFJ (1999) Type NADH dehydrogenases in the cyanobacterium Synechocystis sp strain PCC 6803 are involved in regulation rather than respiration J Bacteriol 181, 3994–4003 Yagi T (1991) Bacterial NADH–quinone oxidoreductases J Bioenerg Biomembr 23, 211–225 Peltier G & Cournac L (2002) Chlororespiration Annu Rev Plant Biol 53, 523–550 Burrows PA, Sazanov LA, Svab Z, Maliga P & Nixon PJ (1998) Identification of a functional respiratory complex in chloroplasts through analysis of tobacco mutants containing disrupted plastid ndh genes EMBO J 17, 868–876 Rumeau D, Becuwe-Linka N, Beyly A, Louwagie M, Garin J & Peltier G (2005) New subunits NDH-M-N, and -O, encoded by nuclear genes, are essential for plastid Ndh complex functioning in higher plants Plant Cell 17, 219–232 Cournac L, Guedeney G, Joet T, Rumeau D, Latouche G, Cerovic Z, Redding K, Horvath E, Medgyesy P & Peltier G (1998) Non-photochemical reduction of intersystem electron carriers in chloroplasts or higher plants and algae In Photosynthesis: Mechanisms and Effects (Garab G, ed.), pp 1877–1882 Kluwer Academic, Dordrecht, The Nertherlands Mus F, Cournac L, Cardettini V, Caruana A & Peltier G (2005) Inhibitor studies on non-photochemical plastoquinone reduction and H2 photoproduction in Chlamydomonas reinhardtii Biochim Biophys Acta 1708, 322– 332 Bjorklof K, Zickermann V & Finel M (2000) Puricaă ă tion of the 45 kDa, membrane bound NADH dehydrogenase of Escherichia coli (NDH-2) and analysis of its interaction with ubiquinone analogues FEBS Lett 467, 105–110 Wierenga RK, Terpstra P & Hol WGJ (1986) Prediction of the occurrence of the ADP-binding bab-fold in proteins, using an amino acid sequence fingerprint J Mol Biol 187, 101–107 Rapisarda VA, Chehin RN, De las Rivas J, RodriguezMontelongo L, Farias RN & Massa EM (2002) Evidence for Cu(I)-thiolate ligation and prediction of a putative copper-binding site in the Escherichia coli NADH dehydrogenase-2 Arch Biochem Biophys 405, 87–94 3636 30 Messner KR & Imlay JA (1999) The identificationof primary sites of superoxide and hydrogen peroxide formation in the aerobic respiratory chain and sulfite reductase complex of Escherichia coli J Biol Chem 274, 10119–10128 31 Corneille S, Cournac L, Guedeney G, Havaux M & Peltier G (1998) Reduction of the plastoquinone pool by exogenous NADH and NADPH in higher plant chloroplasts Characterization of a NAD(P)H–plastoquinone oxidoreductase activity Biochim Biophys Acta 1363, 59–69 32 Happe T & Naber JD (1993) Isolation, characterization and N-terminal amino acid sequence of hydrogenase from the green alga Chlamydomonas reinhardtii Eur J Biochem 214, 475–481 33 Melis A & Happe T (2001) Hydrogen production Green algae as a source of energy Plant Physiol 127, 740–748 34 Melis A (2002) Green alga hydrogen production: progress, challenges and prospects Int J Hydrogen Energy 27, 1217–1228 35 Melis A, Zhang LP, Forestier M, Ghirardi ML & Seibert M (2000) Sustained photobiological hydrogen gas production upon reversible inactivation of oxygen evolution in the green alga Chlamydomonas reinhardtii Plant Physiol 122, 127–135 36 Posewitz MC, Smolinski SL, Kanakagiri S, Melis A, Seibert M & Ghirardi ML (2004) Hydrogen photoproduction is attenuated by disruption of an isoamylase gene in Chlamydomonas reinhardtii Plant Cell 16, 2151– 2163 37 Fouchard S, Hemschemeier A, Caruana A, Pruvost J, Legrand J, Happe T, Peltier G & Cournac L (2005) Investigations on autotrophic and mixotrophic hydrogen photoproduction in sulphur-deprived Chlamydomonas cells Appl Environ Microbiol 71, 6199–6205 38 Michalecka AM, Agius SC, Møller IM & Rasmusson AG (2004) Identification of a mitochondrial external NADPH dehydrogenase by overexpression in transgenic Nicotiana sylvestris Plant J 37, 415–425 39 Kerscher SJ (2000) Diversity and origin of alternative NADH : ubiquinone oxidoreductases Biochim Biophys Acta 1459, 274–283 40 Joseph-Horne T, Hollomon DW & Wood PM (2001) Fungal respiration: a fusion of standard and alternative components Biochim Biophys Acta 1504, 179– 195 41 Luttik MAH, Overkamp KM, Kotter P, de Vries S, van Dijken JP & Pronk JT (1998) The Saccharomyces cerevisiae NDE1 and NDE2 genes encode separate mitochondrial NADH dehydrogenases catalyzing the oxidation of cytosolic NADH J Biol Chem 273, 24529–24534 FEBS Journal 273 (2006) 3625–3637 ª 2006 The Authors Journal compilation ª 2006 FEBS L Bernard et al 42 Harris EH (1989) The Chlamydomonas Sourcebook A Comprehensive Guide to Biology and Laboratory Use Academic Press, San Diego, CA 43 Smith SP, Barber KR, Dunn SD & Shaw GS (1996) Structural influence of cation binding to recombinant human brain S100b: Evidence for calcium-induced exposure of a hydrophobic surface Biochemistry 35, 8805– 8814 44 Lichtenthaler HK & Wellburn AR (1983) Determination of total carotenoids and chlorophylls a and b of leaf extracts in different solvents Biochem Soc Trans 11, 591–592 Agrobacterium tumefaciens NDH-2 45 Altschul SF, Madden TL, Schaffer AA, Zhang J, Miller W & Lipman DJ (1997) Gapped BLAST and PSIBLAST: a new generation of protein database search programs Nucleic Acids Res 25, 3389–3402 46 Claros MG (1995) MitoProt, a Macintosh application for studying mitochondrial proteins Comput Appl Biosci 11, 441–447 ´ 47 Mus F (2005) Activite NAD(P)H plastoquinone oxy´ ` doreductase et photo-production d’hydrogene au sein des thylacoă des de lalgue verte Chlamydomonas rein hardtii, PhD Thesis, Universite d’Aix-Marseille II, Aix-Marseille, France FEBS Journal 273 (2006) 3625–3637 ª 2006 The Authors Journal compilation ª 2006 FEBS 3637 ... on E coli membranes and on C reinhardtii thylakoids, AtuNDH-2 is concluded to interact with bacterial membranes and UQs and also with thylakoid membranes and PQs Although NDH-2s are membrane-bound... rotenone-insensitive NADH dehydrogenase from Trypanosoma brucei mitochondria: isolation and characterization Biochemistry 41, 3065–3072 Melo AM, Bandeiras TM & Teixeira M (2004) New insights into type II NAD(P)H... substrate of complex II (data not shown) As expected, no O2 uptake was detected when mutant membranes were supplemented with NADH (Fig 4A) Preincubation of mutant membranes with AtuNDH-2 resulted