Directed evolution of trimethoprim resistance in Escherichia coli Morgan Watson, Jian-Wei Liu and David Ollis Research School of Chemistry, Australian National University, Canberra, Australia Naturally occurring enzyme inhibitors are found in every living organism, serving purposes ranging from the regulation of metabolism to weapons against com- petitors, predators and prey. By contrast, artificial enzyme inhibitors serve two primary purposes; to aid the study of enzymes and biological pathways, and to serve as drugs in medical applications [1]. The synergy between these two approaches is well illustrated when examination of the means by which an enzyme becomes resistant to an antagonist furthers our understanding of the functionality of the enzyme itself. However, the study of the mechanistic relationship between inhibition by antibacterials and enzymatic activity is complicated by the systematic differences between susceptible and resistant forms of an enzyme. Clinical isolates typically have multiple mutations present [2] and in some cases bear little resemblance to the native form [3] so it is dif- ficult to determine the effect of any one mutation. Although we can examine the result of the mutations, we can only postulate about the reasons that gave rise to them. Directed evolution provides a mechanism for simplifying these studies. Controlling selection pres- sures on the enzyme, by controlling the environment of the host organism during the evolution of resistance [4], allows control over the number of mutations intro- duced, and ensures that the resistant forms produced are related to the susceptible native form. This allows us to determine additional information on why the mutations arose and in what order multiple mutations accumulated, information that is not always available for samples isolated from other sources. Screening tech- niques used in directed evolution also enable us to pro- duce multiple mutant forms of the enzyme, all of which have potentially used different methods to overcome the obstacles present in the directed evolution process. This allows for a greater understanding of enzyme mechanisms than studies of clinical isolates. Directed evolution is gaining popularity as a means of studying enzymes and has recently been used to examine other antibacterial resistance systems [5]. Because of its central role in one-carbon metabo- lism, dihydrofolate reductase (DHFR) has long been a Keywords antibiotic resistance; dihydrofolate reductase; directed evolution; trimethoprim Correspondence M. Watson, Research School of Chemistry, Australian National University, Canberra, ACT 0200, Australia Fax: +61 261 250 750 Tel: +61 261 258 017 E-mail: watson@rsc.anu.edu.au (Received 2 January 2007, revised 12 March 2007, accepted 22 March 2007) doi:10.1111/j.1742-4658.2007.05801.x Directed evolution is a useful tool in the study of enzymes. It is used in this study to investigate the means by which resistance to the antibiotic trimeth- oprim develops in dihyrofolate reductase from Escherichia coli. Mutants with clinical levels of resistance were obtained after only three generations. After four generations of directed evolution, several mutants were charac- terized, along with some point mutants made to investigate amino acid changes of interest. Several mutations were found to grant resistance to trimethoprim, both by reducing the binding affinity of the enzyme for the drug, and by increasing the activity of the enzyme. Abbreviations DHF, 5,6-dihydrofolate; DHFR, dihydrofolate reductase; MHA, Mueller Hinton agar; MIC, minimum inhibitory concentration; THF, 5,6,7,8-tetrahydrofolate; TMP, trimethoprim. FEBS Journal 274 (2007) 2661–2671 ª 2007 The Authors Journal compilation ª 2007 FEBS 2661 target for drugs [6,7]. The structure and function of native forms of DHFR from a variety of sources have been studied. DHFR from Escherichia coli is a mono- meric protein of $ 18 kDa. The structure of the native form has been determined, including complexes with both substrates and a number of inhibitors [8]. DHFR catalyses the reduction of NADPH and 5,6-dihydrofo- late (DHF) to NADP + and 5,6,7,8-tetrahydrofolate (THF), via the redox reaction: DHF þ NADPH þ H þ ! THF þ NADP þ Binding of the substrates is ordered, with the reaction proceeding by the binding of first NADPH then DHF, followed by the release of NADP + and binding of another NADPH molecule before the release of THF. THF release is the rate-limiting step in the reaction [9]. DHFR is also capable of reducing folate to DHF, although at a considerably slower rate than the reduc- tion of DHF to THF. This reduction is essential for maintaining the cellular pool of reduced folate required to synthesize thymidylate, purines and methi- onine [10,11]. Compounds used to inhibit DHFR are collectively know as antifolates, and are used to treat a variety of conditions ranging from bacterial infections and malaria to cancer. This study uses the antifolate drug trimethoprim (TMP) (Fig. 1). TMP is used as an antibiotic as it has a high degree of specificity for bac- terial DHFRs over eukaryotic DHFRs. The widespread use of antifolates has lead to the development of resistance to many of the compounds [12,13], and numerous studies of DHFR from many organisms [11]. The breadth of information available on DHFR and the significance of it in the treatment of a range of conditions makes it an ideal subject for examining the ability of directed evolution to aid us in understanding and overcoming the rise of resistance to enzyme inhibitors. In this study, we used directed evolution to generate a library of E. coli DHFR mutants with resistance to TMP. Selected mutants were characterized kinetically using fluorescence techniques. Third- and fourth-gen- eration mutants were found which possessed greatly increased levels of TMP resistance, with only minor deleterious effects on activity, and in many cases improvement of either substrate K m values or k cat . The location and probable effect of repeatedly occurring mutations has been examined. Results and Discussion Library generation Each round of evolution libraries consisted of $ 100 000 cfu. Of these, $ 250–300 colonies were selected for secondary screening, and the best 20–25 colonies selected for sequencing. From those se- quenced, 10–15 mutants were shuffled to produce the next round of mutants. Amino acid changes observed in the sequenced mutants are shown in Table 1. There were a few false positives so the numbering of mutants is not necessarily sequential. No duplicates were seen, presumably because of the large number of potential combinations of generated mutants. Fig. 1. Comparison of the structure of 5,6-dihydrofolate (DHF) and trimethoprim (TMP). Of particular interest is the substitution of an amine group on TMP for the double bonded oxygen in DHF (circled). Directed evolution in E. coli M. Watson et al. 2662 FEBS Journal 274 (2007) 2661–2671 ª 2007 The Authors Journal compilation ª 2007 FEBS Table 1. List of mutants generated. Mutations found in those resistant colonies sequenced. Only mutations that occur more than once are shown, this may result in some mutants appearing identical. The percentage of mutants containing a given mutation in each round is indicated. Residue 10 20 21 26 30 45 94 109 115 153 158 WTVMPAWHIKIFR 1-04 A 1-06 L 1-07 Q 1-10 L 1-13 S 1-16 V R % R1 16.7 16.7 17 ⁄ 17 (L ⁄ Q) 16.7 16.7 0 16.7 0 0 16.7 0 ⁄ 0 (W ⁄ Q) 2-01 V T L 2-05 R L 2-06 A V R L 2-07 A R L 2-08 Q L 2-10 V R L 2-11 L R 2-12 Q T R 2-13 A R L V 2-14 A L L 2-15 Q L 2-16 Q R 2-17 A Q S 2-18 R L 2-19 A Q L 2-20 L L % R2 37.5 18.75 19 ⁄ 38 (L ⁄ Q) 12.5 56.25 0 75 0 6.25 6.25 0 ⁄ 0 (W ⁄ Q) 3-02 V T R L V 3-03 V T V S 3-04 V T L 3-05 V T L V 3-06 T R L R 3-07 A T R R L 3-08 A T R R L 3-09 A V T R L 3-10 A V T R L V 3-13 A V T L 3-14 T R L R 3-15 V T L 3-16 V T L R V 3-17 T R R L 3-18 A T R L R 3-19 T R L R 3-20 R L % R3 35.29 52.94 0 ⁄ 0 (L ⁄ Q) 94.12 47.06 35.29 94.12 29.14 29.14 5.88 0 ⁄ 0 (W ⁄ Q) 4-01 V T R L R W 4-02 V T R R V Q 4-03 A V T L 4-04 V T L 4-06 V T L V 4-07 A V T R L 4-08 V T L R 4-09 A V T R L R Q M. Watson et al. Directed evolution in E. coli FEBS Journal 274 (2007) 2661–2671 ª 2007 The Authors Journal compilation ª 2007 FEBS 2663 The genes sequenced at the end of the first genera- tion contained only one or two mutations each. With the exception of F53S, these mutations recom- bine in subsequent rounds so that at the end of four rounds a number of these mutations (M20V, A26T, I94L) occurs in most of the resistant enzymes. The A26T and H45R mutations only become common in the third and fourth generations. One of these, H45R, originated only in the third round, but quickly became common. The favouring of these mutations at higher levels of TMP provides a good indication that they either confer a high level of resistance, or are necessary to allow other mutations that confer such resistance. There are three mutations that vanish from later rounds after being common in earlier ones; P21L, P21Q, and W30R. It is possible that these are too inef- fective to survive in later rounds, or it may be that although these mutations are capable of protecting the bacteria from TMP, they are incompatible with the M20V mutation (never occurring together in Table 1) and are lost as the M20V mutation (shown to be a considerably more effective mutation on Table 2) becomes more common. Other mutations show neither affinity nor conflict with each other. Not shown in Table 1 are mutations that only occurred in one mutant, demonstrating little selective advantage. Protein expression and purification All mutants were expressed to between 80 and 100% of the level of native DHFR, so we can conclude that the observed resistance during selection was not due to increased overexpression. All enzymes were purified to > 95% pure, as judged by visual inspection of a Coo- massie Brilliant Blue-stained SDS gel. Kinetic assays Kinetic constants determined from the initial rate reactions are shown in Table 2. These were deter- mined using Michaelis–Menten plots of the data collected. K m values obtained for the native form are consistent with those available in the literature (0.7–3.2 lm for DHF and 0.94–6.8 lm for NADPH) as were the k cat values (literature values of 18–29Æs )1 ) [10,14–16]. With two exceptions, the kinetic constants measured for DHF and NADPH binding of the mutants show a remarkable similarity to that of the native form. This suggests that the native activity is the minimum required for viable cells. Two mutants showing an improvement on these constants, 3-20 and 4-4, both had significantly increased K m values for NADPH. Both of these, along with several other mutants, had an increased k cat . This may, to some extent, compen- sate for the increased K m values. The prevalence of increased k cat values in both directed evolution and single-site mutants suggests that it may also play a direct role in TMP resistance. Many of the single-site mutants possess k cat values far higher than those of the directed evolution mutants that contain them. This is especially true for the third generation, whereas mutants in generation four have more comparable k cat values. This leads to the conclusion that the effects of the single-site mutants are not additive, and are cap- able of interfering with each other. Only the fourth- round generation selection conditions were sufficiently Table 1. Continued. Residue 10 20 21 26 30 45 94 109 115 153 158 4-10 V T R L 4-11 T R L 4-12 V T R L V 4-13 V 4-14 V T L 4-15 T R L R 4-16 A 4-17 A V T L W 4-18 V T L 4-20 V T R L % R4 27.8 83.3 0 ⁄ 0 (L ⁄ Q) 88.9 0.0 50.0 83.3 27.8 16.7 0.0 11 ⁄ 11 (W ⁄ Q) % Total 31.6 49.1 7 ⁄ 12 (L ⁄ Q) 59.6 31.6 26.3 77.2 17.5 15.8 5.3 3 ⁄ 3 (W ⁄ Q) Directed evolution in E. coli M. Watson et al. 2664 FEBS Journal 274 (2007) 2661–2671 ª 2007 The Authors Journal compilation ª 2007 FEBS stringent to select combinations of mutations compar- able to the single-site mutants. Binding assays Binding constants are given in Table 2. A significant increase in K d is apparent between generations three and four. However, the K d of 3-20 is only a little higher than that of the native form, begging the ques- tion of why this mutant was selected and how it has achieved a minimum inhibitory concentration (MIC) value comparable with other TMP-resistant mutants. The reason for this would appear to lie in the k cat value for 3-20, the highest for all round three mutants. In this case, it would appear that an increased k cat value is capable of conferring resistance to the effects of TMP, even in the presence of a K d that is not signi- ficantly different from the native DHFR. The TMP binding constants for the single-site mutants reveals some interesting results. The very high K d values for M20V and H45R suggest that a far more stringent set of selection methods could be applied ear- lier, and the comparatively low K d values for the direc- ted mutants is a result of insufficient evolutionary selection. More interesting is that these K d values can be obtained with little loss of substrate binding and k cat . Combination of M20V and H45R with others appears to result in the lowering of K d , compensated for by increases in k cat , allowing the enzyme to exploit both paths to resistance. Stability assays All enzymes tested had a t 50 (defined as the tempera- ture required for irreversible loss of 50% of maximal activity after 30 min incubation) of 56 ± 4 °C. There was no significant difference between the wild-type E. coli DHFR and any of the mutants (Table 2). Sta- bility was monitored for its potential to explain anti- biotic resistance in terms of protein stability rather than enhanced kinetics. However, it appears that native E. coli DHFR is already a relatively stable enzyme and the mutations examined in this study had little effect on this stability. The temperatures required to cause an irreversible loss of activity in the enzyme are clearly higher than those experienced by the enzyme at any point in this study or in the cell. Main- taining this level of stability may be a requirement to produce viable cells. MIC tests Susceptibility tests revealed an increased resistance to TMP for all mutants, and although the degree of over- expression resulting from our choice of vector makes direct comparisons with the MIC values for TMP Table 2. Kinetic constants of analysed mutants. Mutations present in the directed evolution mutants are listed. Errors indicated are standard errors. MIC and t 50 determinations were only preformed on directed evolution mutants. Methods of determination of kinetic values are given in the Experimental procedures. Values given are the means of three determinations, and the errors are the standard deviation of the results. Mutant K m (DHF) l M Error K m (NADPH) l M Error k cat s )1 Error K d (TMP) n M Error MIC lgÆmL )1 t 50 °C Error Mutations wt 0.806 0.077 0.952 0.046 26.39 0.94 9.1 0.3 2 56.0 0.5 3-2 0.890 0.025 1.460 0.063 29.06 3.28 39.5 4.5 100 57.6 1.3 M20V, A26T, H45R, A84V, I94L, I115V 3-3 0.885 0.039 1.480 0.072 29.23 6.10 108.4 22.6 > 200 55.0 0.9 M20V, A26T, I115V, F153S 3-6 0.332 0.017 0.592 0.022 13.27 0.05 54.8 0.2 > 200 56.5 1.0 A26T, W30R, I94L, K109R 3-20 2.230 1.750 6.100 2.720 289.90 106.79 13.3 4.9 100 57.9 1.5 W30R, I94L 4-1 0.998 0.045 0.156 0.027 22.29 2.66 876.5 104.7 100 57.7 0.8 M20V, A26T, H45R, I94L, K109R, P129L, A144T, R158W 4-4 2.110 0.612 3.100 0.819 246.91 42.50 242.4 41.7 200 55.8 1.1 M20V, A26T, I94L, R159G 4-9 2.220 0.209 0.987 0.104 201.93 3.04 938.6 14.1 > 200 57.7 0.6 S3R, V10A, M20V, A26T, H45R, Q65R, I94L, K109R, E154K 4-18 1.560 0.126 0.880 0.064 431.61 35.39 776.1 63.6 200 55.8 1.1 M20V, A26T, W74C, I94L, D116Y V10A 0.494 0.021 1.860 0.033 368.81 89.73 332.8 81.0 M20V 1.180 0.077 0.523 0.022 65.04 1.04 1096.7 17.6 A26T 0.327 0.036 0.449 0.023 120.23 8.08 166.2 11.2 W30R 0.272 0.120 2.020 0.203 264.10 0.31 132.5 0.2 H45R 0.501 0.054 0.070 0.053 150.39 3.37 618.4 13.8 I94L 2.060 0.707 1.230 0.672 438.60 14.38 160.9 5.3 M. Watson et al. Directed evolution in E. coli FEBS Journal 274 (2007) 2661–2671 ª 2007 The Authors Journal compilation ª 2007 FEBS 2665 reported for clinical isolates difficult, comparisons are still possible. Other studies have shown susceptible forms of DHFR to be inhibited by TMP concentra- tions in the 1–2 lgÆmL )1 range [17], the same as deter- mined in this study for native protein in our overexpression system. It is also worth noting that TMP-resistant isolates from other studies were resist- ant to concentrations of TMP in the range of 16–32 times that of the susceptible form [17]. Some of the DHFR mutants generated in this study were resistant to TMP concentrations of more than 100 times that of the native enzyme, so that it is very likely that these would be of clinical significance. Although one would intuitively expect these increa- ses to parallel those of the mutant K i values, this is not the case. Cellular resistance appears to be depend- ant on all the kinetic properties of the enzyme, not just its affinity for TMP. This is illustrated with the increase in k cat in many mutants and single-site muta- tions, especially in the case of 3-20, where TMP resist- ance appears solely dependant on the increase in k cat noted above. Single-site mutations: structure ⁄ function correlations Many of the point mutants examined are located in close proximity to either the active site, or in the FG and M20 Loops (Fig. 2). As the role of these loops in catalysis of the reduction of DHF has been well established [8], the manner in which these residues can impact the binding and activity of the enzyme are rel- atively straightforward. The role of more distantly located residues is less easily discerned. No region of the active site remains untouched by the mutations, with the examined point mutations spread across the binding residues for both DHF and NADPH, as well as affecting the M20 loop. Of the single-site mutants examined in this study, four have been identified previously as mutation sites in clinically isolated TMP-resistant genes. These four are V10A, M20V, W30R and I94L [2,18]. Two of these, M20V and I94L, become very common in later generations of this evolution, while V10A maintains a steady presence and W30R starts out strong, but is eventually ousted by M20V, which it appears to be incompatible with. Val10Ala Although located distant to the active site, potential exists for this mutation to have an effect on the binding of substrates due to the movement of the M20 and FG loops during catalysis [8]. Alteration of the conformation of these loops at any stage in the catalytic cycle could account for the observed differ- ences in kinetics. Met20Val This mutation falls on the highly studied M20 loop mentioned above, and is known to play an import- ant role in the catalytic cycle of DHFR [8]. Although this mutation gives the greatest improve- ment in TMP resistance of all the point mutants studied, it is also the only point mutant to have a lower k cat than the wild-type enzyme. This pair of effects match well with the frequency data shown in Table 1, as the concentration of TMP used in the selection process increases, so too does the frequency of M20V, as the trade off between resistance and activity shifts to favour resistance. GH F AEBCD Fig. 2. Line representation of E. coli DHFR. b sheets are shown as arrows, a helices are shown as rectangles. Locations of those mutations listed in Table 1 are indicated as grey discs. The binding sites for NADPH and DHF ⁄ TMP are indicated. Directed evolution in E. coli M. Watson et al. 2666 FEBS Journal 274 (2007) 2661–2671 ª 2007 The Authors Journal compilation ª 2007 FEBS Ala26Thr Although located near the M20 loop, this mutation has a markedly different effect to M20V. Although it confers an unremarkable level of resistance, it improves the binding of both DHF and NADPH. The k cat of the A26T point mutant is also relatively high compared with other point mutants. It is likely that the primary role of this mutation is not to pro- vide resistance through reduced affinity for TMP, but to help negate some of the negative effects other mutations have on the activity of DHFR. Trp30Arg The substitution of arginine for tryptophan at resi- due 30 introduces an additional -NH 3 - moiety into the DHF-binding site (while maintaining the existing -NH 2 - group already present), in proximity to a dou- ble-bonded oxygen residue possessed by DHF but lacking in TMP (as shown in Fig. 1). This allows for the formation of an additional hydrogen bond with DHF, stabilizing its binding, while destabilizing the binding of TMP. The net result of this is a kin- etic profile similar to that of A26T. Unlike A26T, W30R would appear to be incompatible with M20V, never occurring in the same mutant, and eventually being lost as the frequency of M20V increased. The reason for this incompatibility appears to lie in the binding of DHF ⁄ TMP. Both mutations have the potential to directly affect binding, and may do so in a way that prohibits the other mutation. His45Arg As expected from its location within the NADPH- binding pocket, this mutation has a marked effect on the binding of NADPH. The cause of the accom- panying increase in TMP resistance is unclear, parti- cularly as DHF binding is relatively unaffected. The likely explanation is that the binding conformation of NADPH is altered in such a way to favour DHF binding over TMP. Ile943Leu These residues form part of the DHF ⁄ TMP-binding pocket, and although they have no effect on the polarity of the pocket, both cause steric changes cap- able of favouring DHF over TMP due to the observed difference in binding conformations of the two ligands [7] (Fig. 3). This change has only a mediocre effect on TMP resistance, combined with the loss of DHF and NADPH binding means that this mutation, like M20V, is only favoured at high concentrations of TMP. Lys109Arg Unfortunately, the insolubility of this point mutant prevents kinetic data from being collected, however, previous work [8] has shown that the two DHFR sub- units move relative to each other during the catalytic cycle. Residue 109 is located on the ‘hinge’ between the two subunits and it is likely that the effect of any mutation in this region will be due to an effect on this movement. The insolubility caused by this mutation is a significant evolutionary cost, and may serve to explain why it is only observed in later rounds. Other mutations acquired in the directed evolution process must be responsible for restoring the solubility of the enzyme. Concluding remarks The initial aim of this study was to identify residues that could be mutated to reduce the affinity of E. coli DHFR for TMP. We did not investigate the mecha- nisms by which mutations could arise in the clinical environment, our aim was to better understanding of how the active site could mutate in response to an anti- biotic while still maintaining activity. Such information would aid in the design of new drugs. Unfortunately, the picture that emerges in the case of DHFR is that, not only can mutations occur to overcome the effects Fig. 3. Binding of DHF and TMP by DHFR. This illustrates the dif- ferences in crystallographically observed binding of the substrate and inhibitor. Native residues are shown in green, mutants in red. NADPH is shown in orange, DHF in gold and TMP in pink. M. Watson et al. Directed evolution in E. coli FEBS Journal 274 (2007) 2661–2671 ª 2007 The Authors Journal compilation ª 2007 FEBS 2667 of TMP with little loss of activity, but the ability to increase that activity is also present. Indeed, the increase in DHFR activity is one mechanism used to reduce the effect of TMP. However, it may be possible to screen mutants as well as native enzyme forms when searching for new drugs, allowing for the selec- tion of drugs effective against forms resistant to cur- rent antibiotics. The similarities between some the mutations pro- duced in this study and those found in clinical isolates of TMP-resistant DHFR illustrate the power of direc- ted evolution protocols to mirror the evolutionary pro- cesses of nature, and add weight to its use as a tool capable of predicting future developments in antibacte- rial resistance. A trend apparent in our results is that the increase in TMP resistance observed in the mutants occurs without any accompanying loss in activity. Although the improvements in activity accompanying the devel- opment of resistance run contrary to the normal bene- fit ⁄ cost trade-off expected of resistance development, it can be understood in terms of evolutionary pressure. In the situation in which the reaction catalysed by an enzyme is not a rate-limiting step in the growth and reproduction of an organism, then there is no further evolutionary pressure on that enzyme. In such a case, evolution halts even if the enzyme is still far from opti- mized. This results in an untapped pool of evolution- ary potential, which remains available for future use when the environment changes. Introduction of an antibiotic, in this case TMP, results in a change in evolutionary pressure as the target of the antibiotic (DHFR in this study) becomes the cata- lyst for a reaction that is now limiting the growth of the organism. This prompts further evolution of the previ- ously suboptimized enzyme, selecting not only for resist- ance to the antibiotic, but also for improved substrate binding and maximum activity. Enzymes (such as DHFR) possessing such a range of unused evolutionary potential will make poor choices for antibiotic targets, as it is relatively easy for the target enzyme to develop not only resistance to the antibiotic, but increased enzyme efficiency as well. Although the mechanisms involved in the spread of antibiotic resistance are not part of this study, it is logical to conclude that mutations that confer resistance without a drop in activity face fewer barriers to their propagation and transfer than genes that can only confer resistance with an associated cost. More highly evolved enzymes that are at or near their evolutionary limit would be better targets for anti- biotics. Resistant mutants of such enzymes should have lower activities and should disappear from the popula- tion once the selection pressure is removed. An interesting point to note with respect to DHFR is that bacteria are capable of synthesizing folate and have a great range of variation in DHFR genes. Mammals are incapable of synthesizing folate and rely more hea- vily on cycling of dietary folate. The increased import- ance of DHFR and other folate cycling enzymes to mammals may explain the fact that mammalian DHFRs are far more tightly conserved than bacterial ones [19]. Compounds such as the chemotherapy drug methot- rexate, possessing higher affinity for E. coli DHFR may allow for the collection of more information regarding active site mutations through further direc- ted evolution experiments. Such work would require changes to the expression system, as E. coli already possesses an innate resistance to methotrexate by means of an efflux system [20]. This study has shown the usefulness of directed evo- lution in drug design, particularly in the selection of drug targets. Along with a clear indication of the ease with which antibiotic resistance can develop and the means by which it can do so, directed evolution can also provide a pool of resistant mutant proteins that may be useful in the screening of new drugs. Experimental procedures Materials Enzymes used this research were obtained from New Eng- land Biolabs (Ipswich, MA), Roche (Basel, Switzerland) and Stratagene (La Jolla, CA). All other compounds were obtained from Sigma (St. Louis, MO). Isolation of E. coli folA The E. coli DHFR gene (folA) was PCR amplified from the chromosomal DNA of E. coli strain DH5a. The primers used for this were 5¢-CGCGCATGCCATATGATCAGTCTG ATTGCG, 3¢-CCAGGCCTGCATGCTTACCGCCGCTC CAGAATCTC. The gene was cloned into pCL476 using the restriction enzymes NdeI and SphI. pCL476 [21] is a heat- inducible vector containing an ampicillin (Amp) resistance marker and a six-histidine tag at the N-terminal end of the expressed gene. This vector was used for all rounds of direc- ted evolution. When protein was purified from the pCL476 vector, although this protein was active, it failed to crystallize under previously published conditions. The expression vector was then changed to one without the six-histidine tag, pJWL1030 [22]. This protein was eventually crystallized under condi- tions similar, though not identical to published conditions. Genes were amplified using the primers 5¢-CGCGCATGC CATATGATCAGTCTGATTGCG, 3¢-CCCAAGCTTCTG Directed evolution in E. coli M. Watson et al. 2668 FEBS Journal 274 (2007) 2661–2671 ª 2007 The Authors Journal compilation ª 2007 FEBS CAGTTACCGCCGCTCCAG, then cloned into pJWL1030 using the restriction enzymes NdeI and PstI. pJWL1030 is constructed from pJJkm and pCY476, and contains a kana- mycin (Kan) resistance marker. The inserted gene is expressed using a constitutive LacZ operon. Assays of enzyme expression levels and MIC tests were performed using pCL476 as the vector, all other assays used enzyme expressed using pJWL1030. Expression and purification All experiments were undertaken at 4 °C unless otherwise stated. The pJWL1030:folA construct was transformed in to competent E. coli DH5a cells, and grown at 37 °Ctoan optical density of 0.6–0.7. Purification is based on that used by Shaw et al. [23], and only a brief description will be given here. Cells were harvested and lysed on a French press in 0.1 mm Tris buffer (pH 7.5) containing 10 lm 2- mercaptoethanol (buffer A). The soluble faction was loaded onto a Q Sepharose HP Affinity Column (GE Healthcare, Chalfont St Giles, UK), and eluted with a similar buffer containing 0.5 m KCl (buffer B). Elution occurred at $ 0.25 m KCl, confirmed by SDS ⁄ PAGE. Factions contain- ing DHFR were loaded onto a Sephandex G75 size-exclu- sion column (GE Healthcare) and eluted with buffer A. The resulting protein was concentrated to between 20 and 50 mgÆmL )1 and stored at 4 °C. Yields were typically 30– 40 mg per 1 L of culture. Yields of mutant enzymes were lower than that of the native form, ranging between 80 and 90% of the amount of DHFR obtained per 1 L of culture. Shuffling The DNA shuffling method described by Stemmer [24] was used to introduce random mutations in to the folA gene. The folA gene was first amplified by PCR using the same primers as above. Amplification was conducted using Taq DNA polymerase to allow for the introduction of transcrip- tion errors. The PCR product was purified then digested using DNase I to produce fragments with an average length of 100 bp. Fragments between 50 and 150 bp in length were purified using gel electrophoresis. These fragments were then reassembled by primerless PCR, then amplified using the above primers for pCL476 and inserted into the expres- sion vector using NdeI and SphI. The mutagenesis rate of this protocol has been previously established at 0.7% [24]. Selection The mutant library generated was transformed into compet- ent DH5a cells and plated onto Mueller Hinton agar (MHA) plates containing Amp (50 mgÆL )1 ) and TMP. Inhi- bition of thymidine production is a major aspect of the activity of TMP, and inclusion of thymidine in the media allows bacterial growth regardless of the amount of TMP present. This necessitated the use of the specialist media MHA, as Luria–Bertani medium contains thymidine. Plates were incubated at 37 °C for 24–48 h and $ 200 colonies were selected for secondary screening, based on colony size, with the largest colonies being selected. These colonies were grown in minimal A medium (MMA) [25] containing Amp and TMP (concentrations as below) overnight. The D 595 of each was measured as an indicator of growth rate and the 20 colonies with the highest D 595 selected for DNA sequen- cing. Following sequencing, the best (as determined by the measured growth rate) 10–15 unique mutants were used to generate the next round of mutants. The first round of evo- lution was selected using media containing 2 mgÆL )1 TMP, the second with 10 mg ÆL )1 TMP, the third with 50 mgÆL )1 TMP and the fourth with media containing 100 mgÆL )1 TMP. The TMP concentrations used in the third and fourth rounds are comparable with MIC values of clinically isolated TMP-resistant strains of E. coli [26]. A number of amino acids were selected for site-specific mutagenesis based on trends seen in the characterization of round three and four directed evolution mutants, and in mutation frequency as seen in Table 1. Point mutant generation Single-site mutants were generated using point mutagenesis. Primers 33 bp in length were designed to be homologous to the section of the folA gene containing the base to be mutated, excepting the centre three amino acids that code for the new base. The folA gene inserted in the pJWL1030 vector was subjected to PCR using these primers and then digested with DpnI, removing the original template. DpnIis used for this purpose as it will only digest DNA that has been methylated. The template DNA, having been isolated in plasmid form from E. coli, is methylated, but the newly synthesized (and shuffled) DNA is not. Kinetic assays Due to the low concentrations of DHF required to avoid substrate inhibition (first noted by Stone et al. [16]) in these assays, NADPH fluorescence (ex 340, em 465) was used to increase sensitivity. This substrate inhibition is not expected to be an issue under normal physiological conditions, as it is only observed for concentrations of DHF in excess of 1 lm and normal intracellular concentrations of DHF are <28 nm [27]. All fluorescence measurements were made on a Varian Cary Eclipse Fluorescence Spectrometer. The reac- tion was monitored by measuring the drop in NADPH fluorescence as the reaction progressed. DHFR (3.7 nm) was preincubated with DHF (0.2–0.8 lm) for 30 s in reac- tion buffer (0.1 m KHPO 4 pH 7.0, 100 mm 2-mercaptoetha- nol) based on that originally described by Baccanari et al. M. Watson et al. Directed evolution in E. coli FEBS Journal 274 (2007) 2661–2671 ª 2007 The Authors Journal compilation ª 2007 FEBS 2669 [14]. The preincubation was required to avoid the hysteretic behaviour of E. coli DHFR [28]. The reaction was initiated by the addition of NADPH (0.2–1.0 lm) and monitored to completion. Initial rates were recorded and used to calcu- late the Michaelis–Menton constants. Binding assays Binding affinity of TMP for the enzymes was measured by monitoring the quenching of tryptophan absorbance of the enzyme (ex 280 nm, em 345 nm) as increasing amounts of TMP were titrated in. Measurements were made in reaction buffer (0.1 m KHPO 4 pH 7.0, 100 mm 2-mercaptoethanol) with DHFR (50–200 nm). TMP was titrated at concentra- tions to ensure that no more than 5 lL was added at a time. The reaction was allowed 2 min to equilibrate after each addition. Fluorescence of TMP was measured by use of a parallel reaction in which the DHFR was replaced by enough Trp to give an equivalent fluorescence and used to correct the final readings. Binding constants were calculated by fitting data to equations 1 and 2 as according to Stone et al. [16]. F ¼½F 0 E t À F 1 ðELÞ=E t ð1Þ K d ¼ðE t À ELÞðL t À ELÞ=ðELÞð2Þ where F, F 0 , and F ¥ are the observed florescence, the flores- cence of free enzyme and the florescence of the enzyme ligand complex, respectively; L t , EL, and E t are the concen- trations of total ligand, the enzyme–ligand complex, and the total enzyme, respectively. kaleidagraph was used to fit the data using nonlinear regression, in all cases giving a good fit with R-values in excess of 95%. Stability assays Heat stability of the enzyme was determined by incubating aliquots of the enzyme at (45–65 °C) for 30 min, then assay- ing for activity as described above at concentrations of 0.8 nm DHF and 0.8 nm NADPH. Residual activity was measured by calculating the proportion of initial velocity remaining after heating as a proportion of the initial velo- city of the nonincubated enzyme. MIC assays To determine the MIC for TMP for each mutant evolved, transformants were grown overnight on MHA plates con- taining amounts of TMP varying from 0 to 200 mgÆmL )1 in steps of 50 mgÆmL )1 . Acknowledgements The authors thank Cameron McRae of the Bimolecu- lar Resource Facility for DNA sequencing. References 1 Hartman PG (1993) Molecular aspects and mechanism of action of dihydrofolate reductase inhibitors. J Chem- other 5, 369–376. 2 Maskell JP, Sefton AM & Hall LM (2001) Multiple mutations modulate the function of dihydrofolate reduc- tase in trimethoprim-resistant Streptococcus pneumoniae. Antimicrob Agents Chemother 45, 1104–1108. 3 Strader MB, Smiley RD, Stinnett LG, VerBerkmoes NC & Howell EE (2001) Role of S65, Q67, I68, and Y69 residues in homotetrameric R67 dihydrofolate reductase. Biochemistry 40, 11344–11352. 4 Anderson AC (2005) Targeting DHFR in parasitic pro- tozoa. Drug Discov Today 10, 121–128. 5 Bokma E, Koronakis E, Lobedanz S, Hughes C & Koronakis V (2006) Directed evolution of a bacterial efflux pump: adaptation of the E. coli TolC exit duct to the Pseudomonas MexAB translocase. FEBS Lett 580, 5339–5343. 6 Venkitakrishnan RP, Zaborowski E, McElheny D, Benkovic SJ, Dyson HJ & Wright PE (2004) Conforma- tional changes in the active site loops of dihydrofolate reductase during the catalytic cycle. Biochemistry 43, 16046–16055. 7 Matthews DA, Bolin JT, Burridge JM, Filman DJ, Volz KW, Kaufman BT, Beddell CR, Champness JN, Stammers DK & Kraut J (1985) Refined crystal struc- tures of Escherichia coli and chicken liver dihydrofolate reductase containing bound trimethoprim. J Biol Chem 260, 381–391. 8 Sawaya MR & Kraut J (1997) Loop and subdomain movements in the mechanism of Escherichia coli dihy- drofolate reductase: crystallographic evidence. Biochem- istry 36, 586–603. 9 Fierke CA, Johnson KA & Benkovic SJ (1987) Con- struction and evaluation of the kinetic scheme asso- ciated with dihydrofolate reductase from Escherichia coli. Biochemistry 26, 4085–4092. 10 Cossins EA & Chen L (1997) Folates and one-carbon metabolism in plants and fungi. Phytochemistry 45, 437–452. 11 Kompis IM, Islam K & Then RL (2005) DNA and RNA synthesis: antifolates. Chem Rev 105, 593–620. 12 Then RL (2004) Antimicrobial dihydrofolate reductase inhibitors – achievements and future options: review. J Chemother 16, 3–12. 13 Banerjee D, Mayer-Kuckuk P, Capiaux G, Budak- Alpdogan T, Gorlick R & Bertino JR (2002) Novel aspects of resistance to drugs targeted to dihydrofolate reductase and thymidylate synthase. Biochim Biophys Acta 1587, 164–173. 14 Baccanari D, Phillips A, Smith S, Sinski D & Burchall J (1975) Purification and properties of Escherichia coli dihydrofolate reductase. Biochemistry 14, 5267–5273. Directed evolution in E. coli M. Watson et al. 2670 FEBS Journal 274 (2007) 2661–2671 ª 2007 The Authors Journal compilation ª 2007 FEBS [...]... Effects of insertions and deletions in a B-bulge region of Escherichia coli dihydrofolate reductase Protein Engineer 10, 263–272 16 Stone SR & Morrison JF (1982) Kinetic mechanism of the reaction catalyzed by dyhyrofolate redustase from Escherichia coli Biochemistry 21, 3757–3765 17 Adrian PV & Klugman KP (1997) Mutations in the dihydrofolate reductase gene of trimethoprim- resistant isolates of Streptococcus... (1999) Characterization of dihydrofolate reductase genes from trimethoprim- susceptible and trimethoprim- resistant strains of Enterococcus faecalis Antimicrob Agents Chemother 43, 141–147 19 Elvin CM, Liyou NE, Pearson R, Kemp DH & Dixon NE (2003) Molecular cloning and expression of the dihydrofolate reductase (DHFR) gene from adult buffalo fly (Haematobia irritans exigua): effects of antifolates Insect... Ollis DL (2006) Improving protein solubility: the use of the Escherichia coli dihydrofolate reductase gene as a fusion reporter Protein Express Purif 47, 258–263 23 Shaw D, Odom JD & Dunlap RB (1999) High expression and steady-state kinetic characterization of methionine site -directed mutants of Escherichia coli methionyland selenomethionyl-dihydrofolate reductase Biochim Biophys Acta 1429, 401–410... Kopytek SJ, Dyer JCD, Knapp GS & Hu JC (2000) Resistance to methotrexate due to AcrAB-dependant export from Escherichia coli Anitmicrob Agents Chemother 44, 3210–3212 21 Love CA, Lilley PE & Dixon NE (1996) Stable highcopy-number bacteriophage c promoter vectors for overproduction of proteins in Escherichia coli Gene 176, 49–53 Directed evolution in E coli 22 Liu J-W, Boucher Y, Stokes HW & Ollis DL... in vitro recombination for molecular evolution Proc Natl Acad Sci USA 91, 10747–10751 25 Miller JH (1972) Experiments in Molecular Genetics Cold Spring Harbour Laboratory Press, Cold Spring Habour, NY 26 Then RL (1993) History and future of antimicrobial diaminopyrimidines J Chemother 5, 361–368 27 Nijhout HF, Reed MC, Budu P & Ulrich CM (2004) A mathematical model of the folate cycle: new insights into... homeostasis J Biol Chem 279, 55008–55016 28 Appleman JR, Beard WA, Delcamp TJ, Prendergast JN, Freisheim JH & Blakley RL (1989) Atypical transient state kinetics of recombinant human dihydrofolate reductase produced by hysteretic behavior Comparison with dihydrofolate reductases from other sources J Biol Chem 264, 2625–2633 FEBS Journal 274 (2007) 2661–2671 ª 2007 The Authors Journal compilation ª 2007 FEBS 2671 . Directed evolution of trimethoprim resistance in Escherichia coli Morgan Watson, Jian-Wei Liu and David Ollis Research School of Chemistry,. ability of directed evolution to aid us in understanding and overcoming the rise of resistance to enzyme inhibitors. In this study, we used directed evolution