Complete reconstitution of an ATP-binding cassette transporter LolCDE complex from separately isolated subunits Kyoko Kanamaru* , , Naohiro Taniguchi, Shigehiko Miyamoto, Shin-ichiro Narita and Hajime Tokuda Institute of Molecular and Cellular Biosciences, University of Tokyo, Japan Escherichia coli has at least 90 species of lipoproteins [1], which have the N-terminal Cys modified with thio- ether-linked diacylglycerol and an amino-linked acyl chain [2]. Most lipoproteins are present in the outer membrane, but there are some in the inner membrane. Sorting of lipoproteins depends on the species of the residue at position 2 [3–5], and is catalyzed by the Lol system, composed of five Lol proteins [6]. The LolCDE complex in the inner membrane belongs to the ATP-binding cassette (ABC) transporter super- family, and mediates detachment of lipoproteins from the inner membrane [7]. This results in the formation of a complex between lipoprotein and LolA [8], a peri- plasmic molecular chaperone for lipoproteins. LolB in the outer membrane then accepts lipoproteins from LolA and incorporates them into the outer membrane [9]. Inner membrane-specific lipoproteins, which have Asp at position 2, avoid the action of LolCDE, thereby remaining in the inner membrane [10]. Such a LolCDE avoidance function of Asp depends on Keywords ABC transporter; lipoprotein; LolCDE; reconstitution Correspondence H. Tokuda, Institute of Molecular and Cellular Biosciences, University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-0032, Japan Fax: +81 3 5841 8464 Tel: +81 3 5841 7830 E-mail: htokuda@iam.u-tokyo.ac.jp *Present address Department of Biological Mechanisms and Functions, Graduate School of Bioagricultu- ral Sciences, Nagoya University, Nagoya, Japan † These authors contributed equally to this work (Received 6 November 2006, revised 11 April 2007, accepted 17 April 2007) doi:10.1111/j.1742-4658.2007.05832.x The LolCDE complex of Escherichia coli belongs to the ATP-binding cas- sette transporter superfamily and mediates the detachment of lipoproteins from the inner membrane, thereby initiating lipoprotein sorting to the outer membrane. The complex is composed of one copy each of membrane subunits LolC and LolE, and two copies of ATPase subunit LolD. To establish the conditions for reconstituting the LolCDE complex from sepa- rately isolated subunits, the ATPase activities of LolD and LolCDE were examined under various conditions. We found that both LolD and LolCDE were inactivated on incubation at 30 °C in a detergent solution. ATP and phospholipids protected LolCDE, but not LolD. Furthermore, phospholipids reactivated LolCDE even after its near complete inactiva- tion. LolD was also protected from inactivation when membrane subunits and phospholipids were present together, suggesting the phospholipid- dependent reassembly of LolCDE subunits. Indeed, the functional lipo- protein-releasing machinery was reconstituted into proteoliposomes with E. coli phospholipids and separately purified LolC, LolD and LolE. Prein- cubation with phospholipids at 30 °C was essential for the reconstitution of the functional machinery from subunits. Strikingly, the lipoprotein- releasing activity was also reconstituted from LolE and LolD without LolC, suggesting the intriguing possibility that the minimum lipoprotein- releasing machinery can be formed from LolD and LolE. We report here the complete reconstitution of a functional ATP-binding cassette transpor- ter from separately purified subunits. Abbreviations ABC, ATP-binding cassette; BN, blue native; DDM, n-dodecyl-b- D-maltopyranoside; His-tag, hexahistidine tag. 3034 FEBS Journal 274 (2007) 3034–3043 ª 2007 The Authors Journal compilation ª 2007 FEBS phosphatidylethanolamine in the inner membrane [11]. It has been proposed that a steric and electrostatic interaction between Asp at position 2 and phosphatidyl- ethanolamine is responsible for the LolCDE avoidance mechanism [11]. ABC transporters have four domains, two mem- brane domains and two nucleotide-binding domains. These domains are frequently present in separate sub- units in bacteria, whereas eukaryotic ABC transporters generally have these domains in a single polypeptide chain [12]. The LolCDE complex of E. coli is com- posed of one copy each of membrane subunits LolC and LolE, and two copies of ATPase subunit LolD [7]. Both LolC and LolE are assumed to span the mem- brane four times and to have a periplasmic region comprising  200 amino acids. The two proteins are similar to each other, the sequence identity being 26%. However, both LolC and LolE are required for the growth of E. coli [13]. As lipoproteins are present on the outer leaflet of the inner membrane, LolC and ⁄ or LolE, but not LolD, are responsible for the recogni- tion of lipoproteins. It is of great interest how the membrane and ATP-binding subunits communicate with each other, as this is essential for the transfer of substrate-binding information from LolC ⁄ LolE to LolD, and that of ATP energy from LolD to LolC ⁄ LolE. We recently reported the isolation of several LolC and LolE mutants that suppress dominant negative mutants of LolD [14]. Interestingly, the suppressor mutations of LolE were mostly located in the cytoplas- mic and transmembrane regions, whereas those of LolC were found in the periplasmic domain, suggesting that LolC and LolE interact differently with LolD and play different roles in the LolCDE complex. To under- stand the mechanism of LolCDE, the mode of commu- nication between the respective membrane subunits and LolD needs to be clarified. It is therefore import- ant to establish conditions for the complete reconstitu- tion of the LolCDE complex from separately isolated subunits. However, this has been reported only for OpuA of Lactococcus lactis [15] and Bacillus subtilis [16], although the functional reassembly of an ABC transporter from a membrane complex comprising two subunits and an ATPase subunit has been reported [17,18]. L. lactis OpuA is composed of two copies of a translocator subunit with a substrate-binding domain and two copies of an ATPase subunit. The L. lactis OpuA complex disassembles and reassembles upon a decrease and increase, respectively, in the glycerol con- centration of the buffer [15]. To investigate the role of two substrate-binding domains, hetero-oligomeric OpuA complexes were formed by decreasing and then increasing the glycerol concentration of a solution con- taining OpuA mixtures. The hetero-oligomeric OpuA thus formed was then reconstituted into proteolipo- somes [15]. As this method was not adaptable to B. subtilis OpuA, all subunits of the B. subtilis OpuA were separately isolated and then successfully reassoci- ated in detergent solution [16]. Here, we report that a functional LolCDE complex could be reconstituted from separately purified LolC, LolD and LolE. Moreover, we found that the lipo- protein release activity could be reconstituted from LolD and LolE without LolC. Results ATPase activities of LolCDE and LolD LolD possessing a hexahistidine tag (His-tag) at the C- terminus and the LolCDE complex containing LolC with a His-tag at the C-terminus were overproduced and purified using a TALON metal affinity resin. LolD was purified from the cytosol as a soluble protein, and LolCDE was purified after solubilization of membranes with 1% n-dodecyl-b-d-maltopyranoside (DDM). The initial rates of ATP hydrolysis were then determined in a DDM solution containing various concentrations of ATP. The K m values thus determined were 0.11 ± 0.02 mm (n ¼ 4) and 0.43 ± 0.02 mm (n ¼ 3) for LolCDE and LolD, respectively, where n represents the number of determinations. The V max values were 0.38 ± 0.03 (n ¼ 4) and 0.43 ± 0.05 (n ¼ 3) lmol ATP hydrolyzedÆmin )1 Æmg )1 LolCDE and LolD, respectively. The reported ATPase activities of ABC transporters vary significantly between 0.01 and 20 lmolÆmin )1 Æmg )1 protein [19]. Turnover num- bers were 0.9 ± 0.08 and 0.19 ± 0.02 mol ATP hydrolyzedÆs )1 Æmol )1 LolCDE and LolD, respectively. The LolCDE complex contained two molecules of LolD. However, the turnover numbers were still higher with LolCDE than with LolD, even after correction for LolD molecules. The ATPase activity of the LolCDE complex was essentially the same whether or not a His-tag was attached to LolD [20] or LolC. LolD was monomeric (see below) and did not exhibit cooperativity in the hydrolysis of ATP in a DDM solution (data not shown). Inactivation and reactivation of the ATPase activity of LolCDE It was previously found that the LolCDE complex in n-octyl-b-d-glucopyranoside was quickly inacti- vated even when ATP or phospholipid was added. We K. Kanamaru et al. Reconstitution of the LolCDE complex from subunits FEBS Journal 274 (2007) 3034–3043 ª 2007 The Authors Journal compilation ª 2007 FEBS 3035 therefore used sucrose monocaprate for purification and reconstitution of LolCDE [7]. However, ATP was required for the stabilization of LolCDE in this deter- gent. We then found that the LolCDE complex could be stably purified with 1% DDM not only in the pres- ence but also in the absence of ATP, leading to the isolation of a unique liganded LolCDE complex [20]. Purified LolCDE could be stored frozen in 0.01% DDM without generation of precipitates. LolCDE was reconstituted by incubation with phospholipids in a solution containing 1.2% sucrose monocaprate, followed by dialysis and dilution [20]. Similarly, the maltose transporter complex MalFGK 2 was solubilized with 1% DDM, purified in 0.01% DDM, and then reconstituted into proteoliposomes by the octylgluco- side dilution method [21]. To construct the complete reconstitution system of the LolCDE complex from isolated subunits, it seemed important to examine in detail the stability of LolD and LolCDE in a DDM solution. The ATPase activity of LolCDE in a DDM solution was stable on ice for at least 2 h even in the absence of ATP. However, incubation at 30 °C was found to cause a rapid decrease in the ATPase activity of LolCDE (Fig. 1A). In contrast, no inactivation occurred when ATP or E. coli phospholipids were present during incubation. Blue native (BN)-PAGE revealed that LolCDE, which has a molecular mass of  140 kDa, migrated to a position corresponding to a molecular mass of  180 kDa (lane 1), whereas no material was detected at this position when LolCDE was incubated at 30 °C for 60 min (lane 2). It seems likely that the major frac- tion of LolCDE did not enter the gel because of disas- sembly and ⁄ or denaturation induced by incubation with detergent. On the other hand, when ATP was pre- sent during incubation, LolCDE migrated to a position corresponding to a slightly lower molecular mass ( 170 kDa) (lane 3) than in the case of the nonincu- bated sample (lane 1). ATP binding to LolD seemed to cause differences in the migration position of LolCDE. When LolCDE was incubated in a DDM solution at 30 °C for 60 min, the rate of ATP hydrolysis decreased to only about 15% of that determined before incuba- tion (compare the open and closed circles in Fig. 1C). This decreased ATPase activity may represent the acti- vity of LolD alone because of the disassembly of LolCDE. The inactivated LolCDE was then mixed with E. coli phospholipids and further incubated for the specified times. The incubation with phospholipids caused recovery of the activity of LolCDE to about 50% and 80% of the original level after 10 min (squares) and 120 min (closed triangles), respectively, suggesting that disassembled LolCDE was reassembled. A C B Fig. 1. Inactivation and reactivation of LolCDE. The LolCDE com- plex was overproduced from plasmids pNASCH and pKM501. LolD was overproduced from pKM202. (A) LolCDE (3 lg) was incubated at 30 °C for the specified times in 105 lLof50m M Tris ⁄ HCl (pH 7.5) containing 10% glycerol and 0.3% DDM. Where specified, 8 mg mL )1 E. coli phospholipids (PL) or 2 mM ATP were also present during the incubation. ATP hydrolysis was examined by the addition of 2 m M ATP and 2 mM MgSO 4 , as described under Experimental procedures. (B) LolCDE (3 lg) was analyzed by BN-PAGE as described under Experimental procedures. Lane 1: LolCDE before incubation. Lane 2: LolCDE after incubation with no supplementation. Lane 3: LolCDE after incubation with 2 m M ATP. The migration positions of molecular mass markers (M) are indicated in kDa. (C) ATPase activity was examined with LolCDE incubated at 30 °C for 60 min as in (A) (closed circles) or not incu- bated (open circles). After 60 min of incubation at 30 °C, LolCDE was further incubated with E. coli phospholipids (8 mgÆmL )1 ) for 10 min (open squares), 20 min (open reverse triangles), 30 min (closed reverse triangles), 40 min (open triangles), or 60 min (closed triangles), and then subjected to ATPase assay at the indi- cated times. Reconstitution of the LolCDE complex from subunits K. Kanamaru et al. 3036 FEBS Journal 274 (2007) 3034–3043 ª 2007 The Authors Journal compilation ª 2007 FEBS LolD purified as a soluble protein from the cytoplas- mic fraction was also inactivated when incubated in the DDM solution (compare the open and closed cir- cles in Fig. 2A,C,E). Unlike in the case of LolCDE, the presence of phospholipids alone did not protect LolD (compare the open and closed circles in Fig. 2B,D,F). Neither the addition of LolC or LolE, nor the addition of both in the absence of phospho- lipids, protected the ATPase activity of LolD (compare the open and closed triangles in Fig. 2A.,C,E). On the other hand, the addition of LolC (Fig. 2B) or LolC ⁄ LolE (Fig. 2F) in the presence of phospholipids pre- vented inactivation of LolD to some extent (compare the open and closed triangles). Taken together, these results suggest that the mem- brane subunits stabilize the ATPase subunit LolD in the presence of phospholipids. It was also strongly sug- gested that the membrane subunits interact with LolD in the presence of phospholipids even when they are added separately. Reconstitution of the functional lipoprotein-releasing machinery from subunits The four domains of bacterial ABC transporters are frequently located in different subunits. Complete reconstitution of ABC transporters from separate sub- units has been reported only for OpuA [15,16], although reassembly of an ATPase homodimer with a heterodimer of the membrane subunit has been repor- ted [17,18]. The results shown in Figs 1 and 2 sugges- ted a functional interaction between LolC ⁄ LolE and LolD. We therefore examined the reconstitution of lipoprotein-releasing activity from the three subunits (Fig. 3). The efficiency of lipoprotein release from pro- teoliposomes is usually low even with the LolCDE complex, presumably because the orientation of the reconstituted proteins is random, thereby leaving a major fraction of lipoproteins incompetent with regard to release [7,10]. Nevertheless, reconstitution of LolCDE revealed important aspects of the lipoprotein release reaction [10,11,20]. When the LolCDE complex was used, lipoprotein-releasing activity was reconstitu- ted whether incubation with phospholipids was per- formed on ice or at 30 °C (Fig. 3A). In marked contrast, incubation at 30 °C was absolutely essential for reconstituting the activity from separately purified LolC, LolD and LolE. To our surprise, the lipo- protein-releasing activity was also reconstituted from LolD and LolE without LolC. The reconstituted lipo- protein-releasing activity was dependent on LolA. On the other hand, the activity was hardly reconstituted from LolC and LolD. The Ala fi Pro mutation at position 40 of LolC causes the outer membrane localization of lipoproteins possessing the inner membrane retention signal [22]. This may indicate the importance of LolC for lipopro- tein sorting. The two Asp residues at positions 2 and 3 of lipoproteins function as typical inner membrane retention signals, and are found in native inner mem- brane lipoproteins [5]. We examined whether or not the active machinery lacking LolC releases Pal with Fig. 2. Protection of LolD by membrane subunits. His-tagged LolD, LolC and LolE were overproduced from pKM202, pNASCH and pNASEH, respectively. The ATPase activity of LolD (4.5 lg) before incubation (open circles) or after incubation at 30 °C for 60 min (closed circles) was determined in 50 m M Tris ⁄ HCl (pH 7.5) contain- ing 10% glycerol and 0.3% DDM as described under Experimental procedures. Where specified (closed triangles), incubation was car- ried out in the presence of LolC (A, B) or LolE (C, D), or both (E, F) with (B, D, F) or without (A, C, E) 8 mgÆmL )1 E. coli phospholipids (PL). The open triangles in each panel represent the activity deter- mined before incubation in the presence of the specified mem- brane subunits with or without phospholipids. K. Kanamaru et al. Reconstitution of the LolCDE complex from subunits FEBS Journal 274 (2007) 3034–3043 ª 2007 The Authors Journal compilation ª 2007 FEBS 3037 this signal (Fig. 3B). The signal remained inner mem- brane-specific, and Pal(DD) was not released from any of the three machineries, i.e. LolD ⁄ E, LolC ⁄ D ⁄ E and LolCDE. The release of lipoproteins from these machi- neries was sensitive to orthovanadate (Fig. 3C), which is a specific inhibitor of LolCDE [7]. Taken together, these results indicate that the minimum lipoprotein- releasing machinery can be reconstituted with LolD and LolE without LolC. Assembly of the LolCDE complex from separately isolated subunits To examine the formation of lipoprotein-releasing Lol complexes, separately isolated Lol proteins were mixed as indicated, incubated on ice or at 30 °C with or with- out phospholipids, and then subjected to analysis by gel filtration chromatography (Fig. 4). When LolC, LolE and LolD were separately examined, they were eluted at positions corresponding to respective mono- mers even after incubation at 30 °C with phospholipids (Fig. 4A,B,C). The LolCDE complex was eluted at a position corresponding to  160 kDa (Fig. 4D). When LolC, LolD and LolE were mixed and incubated at 30 °C in the absence of phospholipids, the three Lol proteins remained at the respective monomer positions (Fig. 4E). Incubation of LolC, LolD, LolE and phos- pholipids together on ice caused the formation of a small amount of the LolCDE complex, which was elu- ted at a position corresponding to the intact LolCDE complex (Fig. 4F). In contrast, incubation of these three Lol proteins with phospholipids at 30 °C caused the formation of substantial amounts of the LolCDE complex (Fig. 4G). Incubation of LolD with either LolC (Fig. 4I) or LolE (Fig. 4J) at 30 °C in the presence of phospho- lipids also caused elution of a small amount of Lol proteins at fractions corresponding to  160 kDa, indicating that LolCD and LolDE complexes are formed. These results suggest that both LolC and LolE can directly interact with LolD, although the formation of LolCD (Fig. 4I) and LolDE (Fig. 4J) complexes was significantly less efficient than that of the LolCDE complex (Fig. 4G). The LolDE complex exhibited a low Pal-releasing activity, whereas the activity of the LolCD complex was not detected (Fig. 3). These results suggest that the two membrane subunits play different roles in the lipoprotein release reaction. To determine the subunit stoichiometry of com- plexes formed in vitro, the amounts of Lol proteins were quantitated and corrected with regard to the respective molecular masses. The LolCDE complex formed in vitro (Fig. 4F,G) had essentially the same subunit stoichiometry as the intact LolCDE complex (Fig. 4D). LolD contents in LolCD (Fig. 4I) and LolDE (Fig. 4J) complexes were slightly higher than expected. It is not clear at present whether these com- plexes are composed of two copies of the membrane subunit and three copies of LolD (molecular mass ¼ 164–168 kDa) or two copies each of the membrane subunit and LolD (molecular mass ¼ 138–142 kDa), although an ABC transporter is generally composed of two membrane domains and two nucleotide-binding domains. Discussion Bacterial ABC transporters frequently have four domains in separate subunits [12]. It was previously suggested that LolC and LolE interact differently with LolD and play different roles in the LolCDE complex A B C Fig. 3. Reconstitution of the lipoprotein-releasing machinery from isolated subunits. (A) LolD (177 pmol), LolC (88 pmol), and LolE (88 pmol) were mixed in various combinations, and then incubated with 2 lg of Pal and 0.8 mg of E. coli phospholipids for 60 min either on ice or at 30 °C in 1.2% sucrose monocaprate solution. To reconstitute proteoliposomes, the mixtures were then subjected to dilution and dialysis as described under Experimental procedures. As a control, the LolCDE complex was also reconstituted. Reconsti- tuted proteoliposomes were collected and subjected to the release reaction in the presence of LolA and ATP as described under Experimental procedures. (B) Pal(DD) was also reconstituted as in (A), and the ability of proteoliposomes to release Pal(DD) was examined. (C) Proteoliposomes were reconstituted with the indica- ted Lol proteins and Pal as in (A). The release of Pal was then examined in the presence and absence of 1 m M orthovanadate. Reconstitution of the LolCDE complex from subunits K. Kanamaru et al. 3038 FEBS Journal 274 (2007) 3034–3043 ª 2007 The Authors Journal compilation ª 2007 FEBS [14]. Moreover, several mutants have been isolated for each subunit [7,10,14,20]. We therefore wanted to establish the conditions for reconstituting the func- tional complex from separately isolated subunits. How- ever, so far, only OpuA has been reported to be reconstituted from separate subunits. Our previous attempt to reconstitute the LolCDE complex from sub- units was also unsuccessful. Here, we found a rather simple method; incubation of subunits at 30 °C in the presence of phospholipids leads to the reconstitution of the functional LolCDE complex (Figs 3 and 4). On the other hand, various membrane apparatuses, including ABC transporters such as maltose permease [21,23], histidine permease [24] and the LolCDE complex [7], and a Sec protein translocase [25,26], have been reconstituted at low temperature. This tem- perature-dependent reconstitution is caused by tem- perature-dependent assembly of Lol subunits in the presence of phospholipids (Fig. 4). It has been repor- ted that the components of maltose permease aggre- gate upon separate overproduction [27], whereas the three subunits of the LolCDE complex could be A B C D E F G H I J Fig. 4. In vitro assembly of Lol subunits. LolC (88 pmol), LolD (176 pmol) and LolE (88 pmol) were incubated on ice or at 30 °C for 60 min in 100 lLof20m M Tris ⁄ HCl (pH 7.5) containing 10% glycerol, 5 m M MgCl 2 ,2mM ATP, 0.8 mg E. coli phospholi- pids (PL) and 0.01% DDM as described under Experimental procedures. Where spe- cified, phospholipids (D, E), ATP (H), LolC (J) or LolE (I) were omitted. The reaction mix- ture was then subjected to gel filtration chromatography (Superose 6, 10 ⁄ 300 GL), on a column that had been equilibrated with 20 m M Tris ⁄ HCl (pH 7.5) containing 10% glycerol and 0.01% DDM. The column was developed with the same buffer at a rate of 0.5 mLÆmin )1 . Aliquots of fractions (0.5 mL) were analyzed by SDS ⁄ PAGE and CBB staining after precipitation with trichloro- acetic acid. The amounts of the respective Lol proteins were densitometrically deter- mined in the specified fractions and correc- ted with regard to the respective molecular masses. The molecular amounts of LolD and LolE are indicated, taking the amount of LolC as 1. The elution positions of molecular mass markers are indicated above the gel. As controls, isolated LolC, LolE, LolD and LolCDE were also analyzed (A–D), and their elution positions are indicated by open arrowheads. K. Kanamaru et al. Reconstitution of the LolCDE complex from subunits FEBS Journal 274 (2007) 3034–3043 ª 2007 The Authors Journal compilation ª 2007 FEBS 3039 separately overproduced and reassembled to form the functional complex. The temperature-dependent assem- bly of subunits may be characteristic of the LolCDE complex. The integrity of the LolCDE complex at 30 °C was found to be strictly dependent on phospholipids. The complex rapidly lost its activity when incubated at 30 °C in a DDM solution (Fig. 1). This inactivation was completely prevented by the addition of phospho- lipids or ATP. BN-PAGE suggested that the LolCDE complex disassembles and denatures in the absence of protective agents upon incubation. Phospholipids reac- tivated LolCDE, presumably by mediating the reas- sembly of the three subunits. ATP did not reactivate LolCDE, suggesting that phospholipids and ATP protect LolCDE through different mechanisms. ATP binding to the nucleotide-binding domains of ABC transporters has been proposed to yield the closed dimer [28,29], which is likely to be more resistant to inactivation. Inactivation of LolD on incubation in the DDM solution was also prevented when both phos- pholipids and membrane subunits were present (Fig. 2). Overproduced LolD was isolated from the cytosol as a soluble protein, and remained active unless it was incu- bated in the DDM solution. It seems possible that DDM at 30 °C has a weak denaturing effect, which is prevented by the phospholipid-dependent interaction with membrane subunits. It has been proposed that LolCDE recognizes the N-terminal Cys of lipoproteins together with attached diacylglycerol and an N-linked acyl chain [11]. There- fore, the structure recognized by LolCDE resembles that of phospholipid. This may be related to the strong phospholipid dependence of LolCDE, although LolCDE does not export phospholipids. LolC was found to be dispensable for the reconsti- tution of the minimum lipoprotein-releasing machin- ery (Fig. 3). This was unexpected, because both LolC and LolE are required for the growth of E. coli [13]. The isolation of defective mutants of various Lol pro- teins revealed that efficient lipoprotein sorting to the outer membrane is essential for the growth of E. coli [20,30,31], which possesses more than 80 species of outer membrane-specific lipoproteins [1]. On the other hand, only Pal was reconstituted into proteolipo- somes. This may be the reason why the lack of LolC caused a marginal defect in the release activity of proteoliposomes. It is likely that both LolC and LolE are essential in vivo, because a large amount of lipo- proteins should be rapidly sorted to the outer mem- brane. Our data suggest that the lack of LolC decreases the affinity for lipoproteins (unpublished results). These seem to be unfavorable for the efficient outer membrane sorting of lipoproteins in vivo, whereas the defect was only marginal in the reconsti- tuted proteoliposomes. Both the membrane topology and amino acid sequence (26% identity) are similar between LolC and LolE, whereas the two proteins seem to play different roles [14]. The results shown here suggest that the lipo- protein-binding site is present in LolE, which is cur- rently under investigation. Lol proteins are highly conserved in various Gram-negative bacteria. How- ever, some bacteria, such as Bordetella pertussis and Neisseria meningitidis, possess a single species of mem- brane subunit [32], suggesting that the lipoprotein- releasing apparatus is composed of a homodimer of the membrane subunit and a homodimer of LolD in these bacteria. Experimental procedures Materials Escherichia coli phospholipids were obtained from Avanti Polar Lipids (Alabaster, AL) and washed with acetone as previously reported [33]. b-d-Fructopyranosyl-a-d-glucopyr- anoside monodecanoate (sucrose monocaprate) and DDM were purchased from Dojindo Laboratories (Kumamoto, Japan). Overproduction of Lol proteins Lol proteins were overproduced in E. coli JC7752 (supE hsdS met gal lacY fhua DtolB-pal) [34] harboring the specified plasmids listed in Table 1. When the culture absorbance at 660 nm reached 0.5, the expression of Lol proteins from Ptac and the araBAD operon promoter (P BAD ) was induced at 30 °C for 2 h by the addition of 1mm isopropyl-b-d-thiogalactopyranoside and 0.2% arabi- nose, respectively. Unless otherwise specified, the LolCDE complex was purified from cells harboring pNASCH and pKM501. Table 1. Plasmids used in this study. ‘-his’ represents a hexahisti- dine tag attached to the C-terminus of the respective Lol protein. Plasmid Protein Promoter Reference pKM202 LolD-his Ptac [14] pKM301 LolE Ptac [10] pKM402 LolC, LolD-his P BAD [10] pKM501 LolD, LolE Ptac This study pNASC LolC P BAD This study pNASCH LolC-his P BAD This study pNASE LolE P BAD This study pNASEH LolE-his P BAD This study Reconstitution of the LolCDE complex from subunits K. Kanamaru et al. 3040 FEBS Journal 274 (2007) 3034–3043 ª 2007 The Authors Journal compilation ª 2007 FEBS Construction of plasmids To construct pKM501 carrying lolD and lolE under the control of tacPO and lacIq, the corresponding region of pJY310 [7] was amplified by PCR using a pair of oligonu- cleotides, 5¢-GAGCTCGAAGGAGATATAAATATGAAT AAGATCCTGTTGCAATGC-3¢ and 5¢-AAGCCTGCAG TTTTTGTTCCACCAATATCAAACCC-3¢. The amplified DNA was digested with SacI and PstI, and then inserted into the same restriction site of pTTQ18 [35]. To construct pNASC carrying lolC under P BAD ,a 1.2 kbp EcoRI–PstI fragment of pKM101 [10] was cloned into the same site of pMAN885EH [36]. To construct pNASCH carrying a gene that encodes LolC with a His-tag at its C-terminus, PCR was performed with pJY310 as a template and a pair of oligonucleotides, 5¢-GATGAATTCGGAGGTTTAAATTTATGTACCAAC CTGTCGCTCTATTTA-3¢ and 5¢-CAATTCAAGCTTAA TGATGATGATGATGATGCTCCAGTTCATAACGTAA AGCCTCAGCGG-3¢. The amplified DNA was digested with Eco RI and HindIII, and then cloned into the same site of pMAN885EH. To construct pNASE carrying lolE under P BAD ,a 1.3 kbp EcoRI–PstI fragment of pKM301 [10] was cloned into the same site of pMAN885EH. To construct pNASEH carrying a gene that encodes LolE with a His-tag at its C-terminus, PCR was performed with pJY310 as a template and a pair of oligonucleotides, 5¢-GATGAATTCGGAGGTTTAAATTTATGGCGATGC CTTTATCGTTATTAA-3¢ and 5¢-CAATTCAAGCTTAA TGATGATGATGATGATGCTCCAGCTGGCCGCTAAG GACTCGCGCAG-3¢. The amplified DNA was digested with Eco RI and HindIII, and then cloned into the same site of pMAN885EH. Isolation of Lol proteins JC7752 cells overproducing Lol proteins were converted into spheroplasts, and then disrupted by passage through a French pressure cell (10 000 lbÆin )1 ). Lysates were fract- ionated into total membrane fractions and supernatants by centrifugation at 100 000 g for 60 min using a rotor type 50.2 Ti in Optima L-60 ultracentrifuge (Beckman Coulter, Fulleston, CA). To purify Lol proteins and Lol protein complexes, total membranes at 5 mgÆmL )1 were solubilized on ice for 30 min with 50 mm Tris ⁄ HCl (pH 7.5) containing 10% glycerol, 5 mm MgCl 2 and 1% DDM. A solubilized supernatant was obtained by centrif- ugation at 100 000 g for 30 min using rotor type 50.2 Ti in Optima L-60, and then applied to a 1 mL TALON col- umn (Clontech Laboratories, Mountain View, CA) that had been equilibrated with 50 mm Tris ⁄ HCl (pH 7.5) con- taining 10% glycerol, 100 mm NaCl, and 0.01% DDM. Lol proteins and their complexes were eluted with a linear gradient of imidazole (0–250 mm). His-tagged LolD was purified from supernatants of cell lysates and then purified on a TALON column as described above, except for the absence of DDM. ATPase activity ATP hydrolysis by LolCDE (3 lg) or LolD (4.5 lg) was determined in 105 lLof50mm Tris ⁄ HCl (pH 7 .5) con- taining 10% glycerol and 0.3% DDM. The assay was started at 30 °C by the addition of 2 mm ATP and 2 mm MgCl 2 . Aliquots (15 lL) of the reaction mixture were withdrawn at the indicated time points, and then mixed with the same volume of 12% SDS to stop the hydrolysis. The amounts of inorganic phosphate were determined according to a previously reported method [37]. In some experiments, ATP hydrolysis by LolCDE and LolDE was examined after their reconstitution into proteoliposomes with or without Pal. Page SDS ⁄ PAGE was performed according to Laemmli [38]. Immunoblotting [39] was performed as described. BN-PAGE was carried out according to a previously reported method [40]. The cathode buffer contained 0.002% Coomassie Bril- liant Blue G-250 and 0.01% DDM was included in the sample buffer. Reconstitution of the LolCDE complex from its subunits Reconstitution of the LolCDE complex into proteolipo- somes was performed as described previously [20]. To form the complex from isolated subunits, specified Lol proteins were incubated for 1 h on ice or at 30 °C with 0.8 mg of E. coli phospholipids and 2 lg of Pal in 100 lL of 50 mm Tris ⁄ HCl (pH 7.5) containing 2 mm MgSO 4 , 100 mm NaCl and 1.2% sucrose monocaprate. The mix- ture was diluted with 900 lLof50mm Tris ⁄ HCl (pH 7.5) containing 2 mm MgSO 4 and 100 mm NaCl, and then dia- lyzed against 1000 mL of the same buffer at 4 °C over- night. Reconstituted proteoliposomes were collected by centrifugation at 100 000 g for 2 h using a TLA55 rotor in a Beckman ultracentrifuge Optima MAX, and then sub- jected to the Pal release assay at 30 °C for 15 min in the presence of 4 lg of LolA and 2 mm ATP as previously reported [7]. The reaction mixtures were fractionated into proteoliposomes and supernatants by centrifugation at 100 000 g for 2 h using a TLA55 rotor in a Beckman ultracentrifuge Optima MAX. Pal in the pellets and sup- ernatants was analyzed by SDS ⁄ PAGE and immunoblot- ting with antibodies to Pal. Unless otherwise specified, 1 ⁄ 50 of the pellet material and 1 ⁄ 3 of the supernatant material were applied to the gel. K. Kanamaru et al. Reconstitution of the LolCDE complex from subunits FEBS Journal 274 (2007) 3034–3043 ª 2007 The Authors Journal compilation ª 2007 FEBS 3041 In vitro assembly of Lol subunits The complete reaction mixture contained 88 pmol of LolC, 176 pmol of LolD and 88 pmol of LolE in 100 lLof 20 mm Tris ⁄ HCl (pH 7.5) containing 10% glycerol, 5 mm MgCl 2 ,2mm ATP, 0.8 mg of E. coli phospholipids, and 0.01% DDM. Where specified, LolC or LolE was omitted or incubation was carried out in the absence of phospholipids or ATP. The reaction mixture was incubated on ice or at 30 °C for 60 min, and then subjected to gel fil- tration chromatography (Superose 6, 10 ⁄ 300GL, GE Healthcare, Chalfont St Giles, UK) on a column that had been equilibrated with 20 mm Tris ⁄ HCl (pH 7.5) containing 10% glycerol and 0.01% DDM. The column was developed with the same buffer at a rate of 0.5 mLÆmin )1 . Fractions of 0.5 mL were collected, and aliquots [1 ⁄ 3] was analyzed by SDS ⁄ PAGE and Coomassie Brilliant Blue staining after precipitation with trichloroacetic acid. The amounts of Lol proteins were densitometrically determined in specified gel filtration chromatography fractions and corrected with regard to the respective molecular masses. Acknowledgements We wish to thank Rika Ishihara for technical support. This work was supported by grants to H. Tokuda from the Ministry of Education, Science, Sports and Culture of Japan. References 1 Miyadai H, Tanaka-Masuda K, Matsuyama S & Tokuda H (2004) Effects of lipoprotein overproduction on the induction of DegP (HtrA) involved in quality control in the Escherichia coli periplasm. J Biol Chem 279, 39807–39813. 2 Sankaran K & Wu HC (1994) Lipid modification of bacterial prolipoprotein. Transfer of diacylglyceryl moiety from phosphatidylglycerol. J Biol Chem 269, 19701–19706. 3 Yamaguchi K, Yu F & Inouye M (1988) A single amino acid determinant of the membrane localization of lipo- proteins in E. coli. Cell 53, 423–432. 4 Seydel A, Gounon P & Pugsley AP (1999) Testing the ‘2 rule’ for lipoprotein sorting in the Escherichia coli cell envelope with a new genetic selection. Mol Microbiol 34, 810–821. 5 Terada M, Kuroda T, Matsuyama S & Tokuda H (2001) Lipoprotein sorting signals evaluated as the LolA-dependent release of lipoproteins from the inner membrane of Escherichia coli. J Biol Chem 276, 47690–47694. 6 Tokuda H & Matsuyama S (2004) Sorting of lipo- proteins to the outer membrane in E. coli. Biochim Biophys Acta 1693, 5–13. 7 Yakushi T, Masuda K, Narita S, Matsuyama S & Tokuda H (2000) A new ABC transporter mediating the detachment of lipid-modified proteins from membranes. Nat Cell Biol 2, 212–218. 8 Matsuyama S, Tajima T & Tokuda H (1995) A novel periplasmic carrier protein involved in the sorting and transport of Escherichia coli lipoproteins destined for the outer membrane. EMBO J 14, 3365–3372. 9 Matsuyama S, Yokota N & Tokuda H (1997) A novel outer membrane lipoprotein, LolB (HemM), involved in the LolA (p20)-dependent localization of lipoproteins to the outer membrane of Escherichia coli. EMBO J 16, 6947–6955. 10 Masuda K, Matsuyama S & Tokuda H (2002) Elucida- tion of the function of lipoprotein-sorting signals that determine membrane localization. Proc Natl Acad Sci USA 99, 7390–7395. 11 Hara T, Matsuyama S & Tokuda H (2003) Mechanism underlying the inner membrane retention of E. coli lipo- proteins caused by Lol avoidance signals. J Biol Chem 278, 40408–40414. 12 Holland IB & Blight MA (1999) ABC-ATPases, adapta- ble energy generators fuelling transmembrane movement of a variety of molecules in organisms from bacteria to humans. J Mol Biol 293, 381–399. 13 Narita S, Tanaka K, Matsuyama S & Tokuda H (2002) Disruption of lolCDE, encoding an ATP-binding- cassette transporter, is lethal for Escherichia coli and prevents the release of lipoproteins from the inner mem- brane. J Bacteriol 184, 1417–1422. 14 Ito Y, Matsuzawa H, Matsuyama S, Narita S & Tokuda H (2006) Genetic analysis of the mode of inter- play between an ATPase subunit and membrane sub- units of the lipoprotein-releasing ATP-binding cassette transporter LolCDE. J Bacteriol 188, 2856–2864. 15 Biemans-Oldehinkel E & Poolman B (2003) On the role of the two extracytoplasmic substrate-binding domains in the ABC transporter OpuA. EMBO J 22, 5983–5993. 16 Horn C, Bremer E & Schmitt L (2005) Functional over- expression and in vitro reassociation of OpuA, as osmo- tically regulated ABC-transport complex from Bacillus subtilis. FEBS Lett 579, 5765–5768. 17 Liu PQ & Ames GF (1998) In vitro disassembly and reassembly of an ABC transporter, the histidine per- mease. Proc Natl Acad Sci USA 95, 34595–33500. 18 Sharma S, Davis JA, Ayvaz T, Traxler B & Davidson A (2005) Functional reassembly of the Escherichia coli maltose transporter following purification of a MalF– MalG subassembly. J Bacteriol 187, 2908–2911. 19 Schneider E & Hunke S (1998) ATP-binding-cassette (ABC) transporter systems: functional and structural aspects of the ATP-hydrolyzing subunits ⁄ domains. FEMS Microbiol Rev 22, 1–20. 20 Ito Y, Kanamaru K, Taniguchi N, Miyamoto S & Tokuda H (2006) A novel ligand bound ABC Reconstitution of the LolCDE complex from subunits K. Kanamaru et al. 3042 FEBS Journal 274 (2007) 3034–3043 ª 2007 The Authors Journal compilation ª 2007 FEBS transporter, LolCDE, provides insights into the molecu- lar mechanisms underlying membrane detachment of bacterial lipoproteins. Mol Microbiol 62, 1064–1075. 21 Davidson AL & Nikaido H (1991) Purification and characterization of the membrane-associated compo- nents of the maltose transport system from Escherichia coli. J Biol Chem 266, 8946–8951. 22 Narita S, Kanamaru K, Matsuyama S & Tokuda H (2003) A mutation in the membrane subunit of an ABC transporter LolCDE complex causing outer membrane localization of lipoproteins against their inner mem- brane-specific signals. Mol Microbiol 49, 167–177. 23 Davidson AL & Nikaido H (1990) Overproduction, solubilization, and reconstitution of the maltose trans- port system from Escherichia coli. J Biol Chem 265, 4254–4260. 24 Panagiotidis CH, Reyes M, Sievertsen A, Boos W & Shuman HA (1993) Characterization of the structural requirements for assembly and nucleotide binding of an ATP-binding cassette transporter. The maltose trans- port system of Escherichia coli. J Biol Chem 268, 23685–23696. 25 Akimaru J, Matsuyama S, Tokuda H & Mizushima S (1991) Reconstitution of a protein translocation system containing purified SecY, SecE, and SecA from Escheri- chia coli. Proc Natl Acad Sci USA 88, 6545–6549. 26 Brundage L, Hendrick J, Schiebel E, Driessen AJM & Wickner W (1990) The purified E. coli integral mem- brane protein SecY ⁄ E is sufficient for reconstitution of SecA-dependent precursor protein translocation. Cell 62, 649–657. 27 Liu CE & Ames GF (1997) Characterization of trans- port through the periplasmic histidine permease using proteoliposomes reconstituted by dialysis. J Biol Chem 272, 859–866. 28 Davidson AL & Chen J (2004) ATP-binding cassette transporters in bacteria. Annu Rev Biochem 73, 241–268. 29 Higgins CF & Linton KJ (2004) The ATP switch model for ABC transporters. Nat Struct Mol Biol 11, 918–926. 30 Miyamoto A, Matsuyama S & Tokuda H (2001) Mutant of LolA, a lipoprotein-specific molecular cha- perone of Escherichia coli, defective in the transfer of lipoproteins to LolB. Biochem Biophys Res Commun 287, 1125–1128. 31 Wada R, Matsuyama S & Tokuda H (2004) Targeted mutagenesis of five conserved tryptophan residues of LolB involved in membrane localization of Escherichia coli lipoproteins. Biochim Biophys Res Commun 323, 1069–1074. 32 Narita S & Tokuda H (2006) An ABC transporter mediating the membrane detachment of bacterial lipo- proteins depending on their sorting signals. FEBS Lett 580, 1164–1170. 33 Tokuda H, Shiozuka K & Mizushima S (1990) Recon- stitution of translocation activity for secretory proteins from solubilized components of Escherichia coli. Eur J Biochem 192, 583–589. 34 Bouveret E, Derouiche R, Rigal A, Lloubes R, Lazdunski C & Benedetti H (1995) Peptidoglycan- associated lipoprotein–TolB interaction. A possible key to explaining the formation of contact sites between the inner and outer membranes of Escherichia coli. J Biol Chem 270, 11071–11077. 35 Stark MJ (1987) Multicopy expression vectors carrying the lac repressor gene for regulated high-level expression of genes in Escherichia coli. Gene 51, 255–267. 36 Yakushi T, Tajima T, Matsuyama S & Tokuda H (1997) Lethality of the covalent linkage between mislo- calized major outer membrane lipoprotein and the peptidoglycan of Escherichia coli. J Bacteriol 179, 2857–2862. 37 Chifflet S, Torriglia A, Chiesa R & Tolosa S (1988) A method for the determination of inorganic phosphate in the presence of labile organic phosphate and high con- centrations of protein: application to lens ATPases. Anal Biochem 168, 1–4. 38 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685. 39 Matsuyama S, Fujita Y & Mizushima S (1993) SecD is involved in the release of translocated secretory proteins from the cytoplasmic membrane of Escherichia coli. EMBO J 12, 265–270. 40 Scha ¨ gger H, Cramer WA & von Jagow G (1994) Analysis of molecular masses and oligomeric states of protein complexes by blue native electrophoresis and isolation of membrane protein complexes by two- dimensional native electrophoresis. Anal Biochem 217, 220–230. K. Kanamaru et al. Reconstitution of the LolCDE complex from subunits FEBS Journal 274 (2007) 3034–3043 ª 2007 The Authors Journal compilation ª 2007 FEBS 3043 . Complete reconstitution of an ATP-binding cassette transporter LolCDE complex from separately isolated subunits Kyoko Kanamaru* , , Naohiro Taniguchi,. the complete reconstitution system of the LolCDE complex from isolated subunits, it seemed important to examine in detail the stability of LolD and LolCDE