0
  1. Trang chủ >
  2. Y Tế - Sức Khỏe >
  3. Y học thưởng thức >

Báo cáo y học: "Cell Cycle Arrest by a Natural Product via G2/M Checkpoint"

Tài liệu Báo cáo Y học: Oxidation of phenols by laccase and laccase-mediator systems doc

Tài liệu Báo cáo Y học: Oxidation of phenols by laccase and laccase-mediator systems doc

... that can specifically interact with target func-tional groups, through reaction pathways that are differentfrom those directly accessible to laccase. A foreseeablestrategy for any laccase-catalysed ... in a 10-mmquartz cuvette. Spectra were recorded in the 220–320 nmrange, and the absorbance at 280 nm was plotted againstconcentration.Oxidations catalysed by laccase and laccase/mediatorsystemsIn ... Oxidation of phenols by laccase and laccase-mediator systemsSolubility and steric issuesFrancesca d’Acunzo, Carlo Galli and Bernardo MasciDipartimento di Chimica and Centro CNR Meccanismi...
  • 6
  • 539
  • 0
Tài liệu Báo cáo Y học: Tissue factor pathway inhibitor A possible mechanism of action doc

Tài liệu Báo cáo Y học: Tissue factor pathway inhibitor A possible mechanism of action doc

... Veronica I. Zarnitsina and Fazoil I. AtaullakhanovNational Research Center for Hematology, Russian Academy of Medical Sciences, Moscow, RussiaWe have analyzed several mathematical models that describeinhibition ... VIIa–TF-dependent factor X activation by TFPI. We have comparedexperimental data obtained by Baugh et al. [8] with severalmathematical models of the process and have shown that: (a) the mechanism ... correlation:½VIIa À TF0/ KXaÀVIIaÀTFD¼kXaÀVIIaÀTFdkVIIaÀTF;Xa a A2 2ÞIn a similar fashion, the analysis of VIIa–TF inhibition by Xa–TFPI or with the help of hypothetical reaction...
  • 16
  • 415
  • 0
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

... primer 5¢-d(TATTTGCATGGCCAGCCCAATCTATTTGAG)-3¢; Gly262 to Ala, upperprimer 5¢-d(ATAGATTGGGGTGCCCATGCAAATAATGCA)-3¢, lower primer 5¢-d(ATTATTTGCATGGGCACCCCAATCTATTTG)-3¢; Tyr269 to Ala, upper ... primer5¢-d(TAATGCATCCGCTTTAATTTCTGAAATTAATG)-3¢, lower primer 5¢-d(TCAGAAATTAAAGCGGATGCATTATTTGCATG)-3¢.The upstream primer containing the NdeI restriction site(underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAAAAAATTG)-3¢ ... wereresidues Gly261 and Gly262. The replacement of Gly262 by Ala resulted in an inactive enzyme. Substitution of Gly261 by Ala resulted to an enzyme with lower stability andincreased energy of activation....
  • 6
  • 488
  • 0

Xem thêm

Từ khóa: báo cáo khoa học y họcbáo cáo y họcbáo cáo y học cổ truyềnbáo cáo y tế học đườngmẫu báo cáo y tế học đườngNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Chuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP