Báo cáo y học: "omparative Efficacy and Tolerability of 5-Loxin® and Aflapin® Against Osteoarthritis of the Knee: A Double Blind, Randomized, Placebo Controlled Clinical Study"
Báo cáo y học: "omparative Efficacy and Tolerability of 5-Loxin® and Aflapin® Against Osteoarthritis of the Knee: A Double Blind, Randomized, Placebo Controlled Clinical Study"
... Tolerability of 5-Loxin® and Aflapin® Against Osteoarthritis of the Knee: A Double Blind, Randomized, Placebo Controlled Clinical Study Krishanu Sengupta1, Alluri V. Krishnaraju1, Amar A. Vishal2, ... a y , double- blind, randomized, placebo- controlled study was conducted to evaluate the com-parative efficacy and tolerability of 5-Loxin® and Aflapin® in the treatment of osteoarthritis (OA) ... K, Alluri KV, Satish AR, Mishra S, Golakoti T, Sarma KV, Dey D, Raychaudhuri SP. A double blind, randomized, placebo controlled study of the efficacy and safety of 5-Loxin® for treatment of osteoarthritis...
- 12
- 606
- 0
Báo cáo y học: "Oral Rehydration Therapy for Preoperative Fluid and Electrolyte Management"
... grade III of the ASA physical status classification and, basically, was not the patient ap-propriate for the ORT treatment, and it was probable that hyperinflation of the lung was ... Toshio Sasaki2, Hisae Fujita2 1. School of Nutrition & Dietetics, Kanagawa University of Human Services, Yokosuka, Kanagawa 238-8522, Japan 2. Department of Anesthesiology, Kanagawa Cancer ... to secure the airway. After the airway was secured, sys-temic anesthesia was maintained with propofol at 4 mg/kg per h. Blood, urine, and esophage-al-pharyngeal fluid and gastric fluid...
- 9
- 489
- 0
Báo cáo y học: " Helicobacter pylori induces mitochondrial DNA mutation and reactive oxygen species level in AGS cells"
... (5’→3’) Anticipated length (bp) D-Loop ATTCTAACCTGAATCGGAGG GATGCTTGCATGTGTAATCT 1528 ATPase8 CCCGGACGTCTAAACCAAACC GGGGATCAATAGAGGGGGAAATA 512 ATPase6 AATTACCCCCATACTCCTTACACT GGGTCATGGGCTGGGTTTTACTAT ... GGGTCATGGGCTGGGTTTTACTAT 857 COX-I CCTCGGAGCTGGTAAAAA GGGGGTTCGATTCCTTC 1654 COX-II ACTACCCCGATGCATACACCACA GGGCAATGAATGAAGCGAACAG 1333 COX-III GCCGTACGCCTAACCGCTAACA TCGTAAGGGGTGGTTTTTCTATG 1177 Cyt ... viability. Both the pathogenic factors of Hp (VacA and CagA), especially the VacA, play an important role in the Hp induced mtDNA mutation. We speculate that the accumulation of...
- 12
- 557
- 2
Báo cáo y học: " Carotid Intima-media thickness in childhood and adolescent obesity relations to abdominal obesity, high triglyceride level and insulin resistance"
... by the direct assay method, alanine aminotransferase (ALT) and aspartate aminotransfe-rase (AST) were tested by enzyme-linked immuno-sorbent assay method. Fasting plasma glucose (FPG) was measured ... for qualitative items by χ2 test and for quantitative items by One-Way ANOVA. Thereafter, associations were examined by Pearson correlation analysis for continuous variables, and by Spearman correlation ... measured by glucose oxidase method; fasting plasma insulin (FINS) was measured by radioim-munity assay (Modula Analytics PP, Roche). Both intra-assay and inter-assay coefficient of variations were...
- 6
- 478
- 0
Báo cáo y học: "Maitake Mushroom Extracts Ameliorate Progressive Hypertension and Other Chronic Metabolic Perturbations in Aging Female Rats"
... FAPGG is hydro-lyzed by ACE to furylacryloylphenylalanine (FAP) and glycylglycine. Hydrolysis of FAPGG results in a decreased absorbency at 340 nm. Serum ACE activity was determined by comparing ... at 10 days but a significant lowering of average SBP by day 30 and throughout the re-mainder of the study. The entire BP profile and heart rate were as-sessed near the end of the study as shown ... Sucrose was added in the present investigation to assure that the regular feed of the SD contained a virtually similar portion of refined CHO calories as the normal Amer-ican Diet [24] and may have...
- 12
- 468
- 0
Báo cáo y học: "980 nm diode lasers in oral and facial practice: current state of the science and art"
... literature on the advantages of the compactness, reliability, ease of use and affordability of the 980 nm Diode Lasers, we evaluated the efficacy and safety of one such Laser for the treatment of pathological ... machines" can replace " ;the brain and hand, skill and experience" of the specialist. The aim of this study was to verify the reliability and efficacy of one of these compact portable diode ... treated after an accurate diagnosis and only after the major deep re-fluxes have been eliminated by surgery and sclero-therapy [26]. Purple-red angiectasias with a size of 1-3mm are arterial and/ or...
- 7
- 567
- 1
Báo cáo y học: "introduction to special issue on Eye and Zoonosis – from the guest editors"
... on Eye and Zoonosis – from the guest editors Jelka G. ORSONI and Paolo MORA Inflammatory and Autoimmune Ocular Diseases Service - Institute of Ophthalmology - University of Parma - Italy ... Paolo MORA, Inflammatory and Autoimmune Ocular Diseases Service - Institute of Ophthal-mology - University of Parma – Italy. E-mail: paolo.mora@unipr.it Published: 2009.03.19 Abstract Papers of ... Parma (Italy). They in-clude: • Incidence of ocular Zoonoses referred to the In-flammatory and Autoimmune Ocular Diseases Service of the University of Parma (Italy) • Introduction into Pathology...
- 2
- 617
- 0
Báo cáo Y học: Baboon cytochrome P450 17a-hydroxylase/17,20-lyase (CYP17) Characterization of the adrenal microsomal and cloned enzymes docx
... activity of CYP17 and the differential regulationthereof have been the subject of many studies. It is apparentthat the normal expression and dual hydroxylase and lyaseactivities of this key enzyme ... formation of 1 6a- hydroxyprogesterone. Both expressed enzymes had nolyase activity towards PROG or 17-OHPROG.Understanding of the complexity of hydroxylase and lyase activity of CYP17 by way of primary ... guinea pig CYP17 favours the D4-steroid pathway, the enzyme being incapable of meta-bolizing 17-OHPREG to DHEA [13]. Rat, porcine and hamster CYP17 catalyse the D4 and D5hydroxylase and lyase...
- 9
- 420
- 0
Báo cáo Y học: High affinity binding between laminin and laminin binding protein of Leishmania is stimulated by zinc and may involve laminin zinc-finger like sequences doc
... High affinity binding between laminin and laminin binding protein of Leishmaniais stimulated by zinc and may involve lamininzinc-finger like sequencesKeya Bandyopadhyay, Sudipan Karmakar, Abhijit ... using anti-LBP Ig and secondary antibody also resulted in a 67-kDa band(lane 5) confirming the a uthenticity of the protein. Finally, the parasitic origin of the protein was demonstrated byimmunoprecipitating ... transmembrane glyco-protein on the surface o f Leishmania donovani that binds tolaminin, the major glycoprotein of ECM and BM [5].Detailed characterization has revealed that it may a ct as anadhesin...
- 8
- 420
- 0
Báo cáo Y học: Cellular stresses profoundly inhibit protein synthesis and modulate the states of phosphorylation of multiple translation factors potx
... mRNAtranslation; S6 kinase. The control of mRNA translation in mammalian cellsinvolves the regulation of a range of components of the translational machinery, principally by changes in theirphosphorylation, ... branches of this pathway [19]. p70 S6k is activatedby insulin and growth factors (reviewed in [20]) and appearsto play a role in up-regulating the translation of mRNAsthat are characterized by possessing ... purified eEF2 as substrate. Samples were analysed by SDS/PAGE and autoradiography. The position of the radiolabelled eEF2 on the autoradiograph is indicated. Similar data were obtained in four...
- 10
- 443
- 0
Từ khóa: báo cáo khoa học y họcbáo cáo y họcbáo cáo y học cổ truyềnbáo cáo y tế học đườngmẫu báo cáo y tế học đườngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam