Báo cáo y học: "Utility of routine chest radiographs in a medical–surgical intensive care unit: a quality assurance survey"
Báo cáo y học: "Utility of routine chest radiographs in a medical–surgical intensive care unit: a quality assurance survey"
... commentaryreviewreportsresearchAvailable online http://ccforum.com/content/5/5/271Research articleUtility of routine chest radiographs in a medical–surgicalintensive care unit: a quality assurance ... prospectivelyevaluate their utility in our medical–surgical ICU as part of aquality assurance survey. The goals of this study were todetermine the percentage of routine and non -routine radio-graphs that ... in guiding management decisions in the ICU. DailyCXRs may not, however, be necessary for all patients.Keywords chest radiograph, intensive care unit, quality assurance, routine radiographyReceived:...
- 5
- 506
- 0
Báo cáo y học: "Replacement of cisplatin with nedaplatin in a definitive 5-fluorouracil/ cisplatin-based chemoradiotherapy in Japanese patients with esophageal squamous cell carcinoma"
... cell carcinoma Akiko Kuwahara 1, Motohiro Yamamori 2, Kohshi Nishiguchi 3,4, Tatsuya Okuno 3, Naoko Chayahara 3, Ikuya Miki 3, Takao Tamura 3, Tsubasa Inokuma 2, Yoshiji Takemoto 2, Tsutomu Nakamura ... Nakamura 3, Kazusaburo Kataoka 1 and Toshiyuki Sakaeda 2,3 1. School of Pharmacy and Pharmaceutical Sciences, Mukogawa Women’s University, Nishinomiya, Japan; 2. Graduate School of Pharmaceutical ... toxicity of nedaplatin and 5-FU with radiation treatment for advanced esophageal carcinomas. Anticancer Res. 2003; 23: 3493-8. 15. Yamada H, Maki H, Takeda Y, et al. Evaluation of combined nedaplatin...
- 7
- 531
- 0
Báo cáo y học: " Role of Dietary Soy Protein in Obesity"
... that soy protein intake stimulates skeletal muscle fatty acid oxidation by activating PPAR path-ways leading to reduced accumulation of body fat. Soy protein may reduce adiposity by modulating ... plasma levels of alanine transaminase and aspartate transaminase [55]. These effects were accompanied by increased activities of mitochondrial and peroxisomal beta-oxidation, ace-tyl-CoA carboxylase, ... en-ergy as fat and 28% as protein); and carbohydrate diet (28% of energy as fat and 11% as protein) and were administered for 4 days in a 3-way crossover design. After 4 days of each dietary intervention,...
- 11
- 670
- 2
Báo cáo y học: "Treatment of Chronic HCV Infection in Special Populations."
... reduction in viral RNA was seen to be less in African Americans than Caucasians by 50%. This indicates a larger population of slow responders in African Americans which may explain a low SVR in this ... particularly in genotype 1 patients [10]. A study by Sanchez-Tapias et al [7] treated patients with a pegylated alpha 2a plus ribavirin (1000 or 1200 mg ) for 4 weeks. Preliminary data in abstract form showed ... hydrostatic balance into the peritoneal cavity and the use of the serum to ascites albumin gradient (SAAG) in the differential diagnosis of ascites. Much of his research and clinical effort has...
- 6
- 389
- 0
Báo cáo Y học: Regulation of a1,3galactosyltransferase expression in pig endothelial cells Implications for xenotransplantation doc
... a1 ,3GalT-5¢ -A p12 CCTGTCAAAAGAATAAACAGCGGTT Exon 3 a1 ,3GalT-5¢ -A p13 CACTGTTCCCTCAGCCGAGGAC Exon 1 a1 ,3GalT-5¢-B and -Ep14 CCAACTCCTGATCGGCAGAAGC Exon 1 a1 ,3GalT-5¢B and Ep15 ACTTCTGAAGCCTAAAGGATGCGA ... ACTTCTGAAGCCTAAAGGATGCGA Exon 2 a1 ,3GalT-5¢-Cp16 AGGCAGGGCTGGGAGGAA Exon 3 a1 ,3GalT-5¢-Cp17 TTGCTGTCGGAAGATACATTGAG Exon 8 a1 ,3GalT-coding regionp18 CTTTGTGGCCAACCATGAAGTA Exon 9 a1 ,3GalT-coding regionÓ ... TGTCCCTGCTAGTTGTCATTTGG Intron 2 Promoter A p7 ACGACCACTTTGTCAAGCTCATT GAPDHp8 TGAGGTCCACCACCCTGTTG GAPDHp9 TCCTGAAACGCCTTCGGAAGAG E-selectinp10 CCATTGGGTTGAAGGCATTCG E-selectinp11 ACAAGGCCCCTGGCTGCT...
- 10
- 444
- 0
Báo cáo Y học: Role of critical charged residues in reduction potential modulation of ferredoxin-NADP+ reductase Differential stabilization of FAD redox forms doc
... andEsq/rd.Previous characterization of the reactivity of this E30 1A FNR mutant in complex formation and ET to its substrateshad already indicated that the lack of its semiquinonestabilization was the cause ... Stankovich2and Milagros Medina11Departamento de Bioquı´mica y Biologı´ a Molecular y Celular, Facultad de Ciencias, Universidad de Zaragoza, Spain;2Department of Chemistry, University ... not involved in any intraproteininteraction, but is situated at the entrance of a watercavity, at the bottom of which are the pyrophosphate andthe ribose from the FAD. Therefore, K75 cannot...
- 6
- 437
- 0
Báo cáo Y học: Oxidation of propionate to pyruvate in Escherichia coli Involvement of methylcitrate dehydratase and aconitase pot
... primerAcs 5¢-TAATACGACTCACTATAGGGA*5¢-AACACACCATTCCTGCCAAC-3¢CCACCACAGGTCGCGCC-3¢AcnB 5¢-TAATACGACTCACTATAGGGA*5¢-CTCACACGCTGCTGATGTTC-3¢CGTGGTTACGCACTTCACC-3¢PrpD 5¢-TAATACGACTCACTATAGGGA*5¢-AACATCGGCGCGATGATCC-3¢TCGCTGCTTCAACTGCCG-3PrpE ... threo-2-methylisocitrate and erythro-2-methylisoci-trate, trans-aconitate,D-malate andL-malate, fumarate, maleate,D-tartrate and meso-tartrate,D-citramalate andL-citramalate,mesaconate, citraconate, ... of 2-methylisocitrate dehydratase were analysed by SDS/PAGE. The apparent molecular mass of the 2-methylisoci-trate dehydratase subunit was determined by measuring themobility by SDS/PAGE (15% acrylamide)...
- 11
- 615
- 0
Báo cáo Y học: Regulation of peptide-chain elongation in mammalian cells pptx
... The available evidencesuggests that phosphorylation of eEF 1A/ B and of valyl-tRNA synthetase by PKC increases their activities in translation elongation and amino acylation, respectively.The increased ... activity of eEF2kinase from ventricular myocytes, suggesting that these cellsmay contain a distinct isoform of eEF2 kinase, asmentioned above. In heart cells, increasing the maximalactivity of ... phosphorylation and inactiva-tion of eEF2. Activation of adenylate cyclase, either by b-adrenergicagonists or by forskolin, increases cAMP levels and activates cyclicAMP-dependent protein kinase...
- 9
- 469
- 0
Báo cáo Y học: Expression of uncoupling protein-3 in subsarcolemmal and intermyofibrillar mitochondria of various mouse muscle types and its modulation by fasting docx
... orhuman UCP3.Figure 2A shows that the UCP3 signal of humanrecombinant protein interacting with the antibody tohuman UCP3 increases linearly as a function of increasingamounts of the protein ... chemiluminescenceusing a standard ECL kit and developed Hyperfilm ECLfilm. They were quantified by scanning photodensitometryusing ImageQuant Software 3.3 (Molecular Dynamics,Sunnyvale, CA, USA). COX protein was ... Patrick Keller, Aaron Russell, Franc¸oise Kuhne,Pierre Flandin, Jean-Paul Giacobino and Patrick MuzzinDepartment of Medical Biochemistry, Faculty of Medicine, University of Geneva, SwitzerlandUncoupling...
- 7
- 535
- 0
Báo cáo Y học: Inhibition of glycosyl-phosphatidylinositol biosynthesis in Plasmodium falciparum by C-2 substituted mannose analogues pot
... nonmannosylated GPtdInsglucosamine-phosphatidylinositol (GlcN–PtdIns) and glu-cosamine-acylphosphatidylinositol (GlcN-acyl–PtdIns)(Fig. 2). These data imply that mannosamine wasincorporated into ... nornonmannosylated intermediates accumulated in the pre-sence of mannosamine. The absence of new mannosamine-containing GPtdIns and the inhibition of incorporation of tritiated glucosamine into GPtdIns ... biosynthesis in a variety of cell-types and organisms. In all systems investigated so far,mannosamine was able to inhibit GPtdIns biosynthesis. In T. brucei, mannosamine inhibits the incorporation...
- 8
- 334
- 0
Từ khóa: báo cáo khoa học y họcbáo cáo y họcbáo cáo y học cổ truyềnbáo cáo y tế học đườngmẫu báo cáo y tế học đườngchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI