Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"
Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"
... the draft. JG made substantial contributions to thedata analysis. GB was substantially involved in the analysis,interpretation and drafting the manuscript.AcknowledgementsTo the Medical Statistics ... Open AccessAvailable online http://ccforum.com/content/9/5/R516R516Vol 9 No 5ResearchMedication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive ... JI, Bates DW: Pharmacist participation on physician roundsand adverse drug events in the intensive care unit. JAMA1999, 282:267-270.16. British Medical Association and the Royal Pharmaceutical...
- 6
- 525
- 0
Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation pptx
... protein and increase its DNA-binding and transactivating func-tions. The SAF-1 DNA-binding and transcriptionalactivity is significantly increased in response to media-tors of signal transduction ... cacctcagGGTCACGCC1C 87 CCATTCCAGgtgagtag 84 ctccgcagGCCGCGCCG2 851 CTTCTCCCGgtgtgcac 403 gtccccagGCCGGATCA364AATGTGAGgtaggaag 277 ctcctcagAAATGTGAG4 172 CAACAAAGgtacatgc 1335 ctgtgcagGTACTGGTG5 ... compilation ª 2009 FEBSSAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1family, is expressed during in ammationAlpana Ray1, Srijita Dhar1, Arvind Shakya1, Papiya Ray1, Yasunori Okada2and...
- 11
- 439
- 0
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx
... disRAS1fwd5¢-TTCACGATTGAACAGGTAAACAAAATTTTCCCTTTTTAGAACGACATGCAGCTGAAGCTTCGTACGC-3¢ and disRAS1rev CAAAACCATGTCATATCAAGAGAGCAGGATCATTTTCAACAAATTATGCATAGGCCACTAGGGATCTG-3¢. YEp351-SUT2 wasconstructed to contain SUT2 as the only open readingframe present in the plasmid in ... (S1278b) the kanMX cassette from plasmidpUG6 [12] was amplified by polymerase chain reaction(PCR) using the primers disRAS2fwd 5¢-TAACCGTTTTCGAATTGAAAGGAGATATACAGAAAAAAAACAGCTGAAGCTTCGTACGC-3¢ and ... 5¢-GACTGTCGATGATTATGGTTGCCCGCTGGCTTCCAAACCCTTATCGATACCGTCGACCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACAGGAAACAGCTATGACCATGATTACGCTATAGGGCGAATTGGGTA-3¢, respectively. YEp351-SUT2was linearized...
- 8
- 485
- 0
Báo cáo khoa học: DYNLL/LC8: a light chain subunit of the dynein motor complex and beyond pptx
... major group of pro-teins present at the PSD and two of them are LC8binding partners.Gephyrin is critical for glycine- and GABA-receptorclustering and also interacts with many other proteins,including ... excitatorysynapses. Only the DYNLL2 paralog was identified asan interactor of GKAP in vivo, and it was suggestedthat this interaction is involved in recruiting nNOS to the PSD [88] and in the trafficking ... results,LC8 together with the other two classes of lightchains is involved in regulating dynein complexassembly and hence indirectly affecting cargo binding.Detailed studies of Barbar and colleagues...
- 17
- 573
- 0
Báo cáo khoa học: Fission yeast decaprenyl diphosphate synthase consists of Dps1 and the newly characterized Dlp1 protein in a novel heterotetrameric structure doc
... Hideyuki Matsuda and Makoto KawamukaiDepartment of Applied Bioscience and Biotechnology, Faculty of Life and Environmental Science, Shimane University, Matsue, Japan The analysis of the structure and ... example, S. cerevisiae has ubiquinone-6,E. coli has ubiquinone-8, rats and Arabidopsis thalianahave ubiquinone-9, and humans and S. pombe haveubiquinone-10. The length of the side chain appears ... mitochondrial transit sequences were amplifiedby PCR using the oligonucleotides 5¢-AGGTCGACAGATTAGCATGTAAATAG-3¢ (creates a SalIsite )and 5¢-CGAAGCTTGGGGGTTACAGAGTTTGA-3¢ (cre-ates a HindIII site). The...
- 9
- 337
- 0
Báo cáo khoa học: "Paradigmatic Cascades: a Linguistically Sound Model of Pronunciation by Analogy" docx
... paradigmatic mappings in the graphemic domain, and pairs them statistically with their corre- late(s) in the phonemic domain. These mappings are used to search and retrieve in the lexical ... records the changes in the phone- mic domain when the Mternation applies in the graphemic domain. At the end of the learning stage, we have in hand a set A = {Ai} of functions exchanging suffixes ... tionships in lexical databases. A paradigmatic re- lationship involves four lexical entries a, b, c, d, and expresses that these forms are involved in an ana- logical (in the Saussurian (de Saussure,...
- 8
- 311
- 0
Tài liệu Báo cáo khoa học: 1. Signal Transduction 1.1 Integration of Metabolism and Survival pdf
... transcription of genes involved in hepatic,renal, and intestinal detoxification and genes of the innate and adaptive immune system. REV-ERBalpha, a nuclear orphanreceptor acts as a strong transcriptional ... IKKb, as a way to inhibit activation of most NF-jB forms. While in ammation is a major factor thatcontributes to the development and progression of CAC and other in ammation-linked cancers and ... ligands, and calls for considering a more complex mechan-ism for MHCp-TCR interaction. Indeed, an in- depth analysis of kinetic data obtained by SPR as well as an independent, FRETbased study of...
- 6
- 524
- 0
Tài liệu Báo cáo khoa học: "Multilingual Pseudo-Relevance Feedback: Performance Study of Assisting Languages" doc
... sampra (sampras), 6, champion, steffi, verteidigt (defendending), martina, jovotna, navratilovaGERMAN '01: TOPIC 91ESAI in LateinamerikaLa gripe aviar en América LatinaAI in Latin ... languageL1, the query is automatically translated into the assisting language L2 and PRF performed in the assisting language. The resultant termsare translated back into L1using a probabilisticbi-lingual ... varying the assisting language. Besides, we also study the inter and intra familial behaviour of source-assisting language pairs. In order to ensure that the results are comparable across languages,...
- 11
- 327
- 0
Báo cáo khoa học: "Word classification based on combined measures of distributional and semantic similarity" docx
... would be the case with a thesaurus of a realisticsize, proves to be much more challenging. For ex-ample, Alfonseca and Manandhar (2002) attain the learning accuracy' of 38% when assigning ... the original class of a test nounwas tested. Their performance was evaluated in terms of precision and in terms of learning accu-racy (Hahn and Schattinger, 1998). The latter is a measure designed ... distributional similarity of the new word to the target class and (2) the strength of the semantic relatedness of the target class toother likely candidates. Thus, using the thesaurus asbackground...
- 4
- 345
- 0
Báo cáo khoa học: Etoposide upregulates Bax-enhancing tumour necrosis factor-related apoptosis inducing ligand-mediated apoptosis in the human hepatocellular carcinoma cell line QGY-7703 pdf
... Smac/DIABLO promotes the activation of caspases, such as procaspase-9 and caspase-3,by binding to the inhibitor of apoptosis proteins and thusdisrupts linkage of the caspase–inhibitor of apoptosisproteins ... forward,5¢-CGGAATTCGGAGGGGACCCCAAGTGCAT-3¢;DR4 reverse, 5¢-CGGGATCCTCACTCCAAGGACACGGCA-3¢;DR5forward,5¢-CGGAATTCTGCAAGTCTTTACTGTGGAA-3¢; DR5 reverse, 5¢-CGGATCCTTAGGACATGGCAGAG-3¢;DcR2forward,5¢-CGGAATTCCGCGGAAGAAATTCATTTCT-3¢;DcR2 ... contain an intracel-lular Ôdeath domainÕ that recruits effector molecules, such asFas-associated death domain protein (FADD) [15] and death-associated protein 3 (DAP-3) [16] to activate initiatorcaspase-8...
- 11
- 409
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ