Báo cáo y học: " Introduction of Medical Emergency Teams in Australia and New Zealand: a multi-centre study"
Báo cáo y học: " Introduction of Medical Emergency Teams in Australia and New Zealand: a multi-centre study"
... incidence of in- hospital CAs in anumber of single-centre before -and- after studies [5-9]. AANZ = Australia and New Zealand; ANZICS = Australian and New Zealand Intensive Care Society; ANZICS-APD ... = Australian and New Zealand Intensive Care Society Adult Patient Database; APD = Adult Patient Database; ARCCCR = Australian and New Zealand Intensive Care Society Research Centre for Critical ... hospitals in Australian and New Zealand with intensive care unitsFlow diagram of the Medical Emergency Team (MET) status of 172 hospitals in Australian and New Zealand with intensive care units....
- 8
- 639
- 0
Báo cáo Y học: Expression of uncoupling protein-3 in subsarcolemmal and intermyofibrillar mitochondria of various mouse muscle types and its modulation by fasting docx
... Patrick Keller, Aaron Russell, Franc¸oise Kuhne,Pierre Flandin, Jean-Paul Giacobino and Patrick MuzzinDepartment of Medical Biochemistry, Faculty of Medicine, University of Geneva, SwitzerlandUncoupling ... orhuman UCP3.Figure 2A shows that the UCP3 signal of humanrecombinant protein interacting with the antibody tohuman UCP3 increases linearly as a function of increasingamounts of the protein ... chemiluminescenceusing a standard ECL kit and developed Hyperfilm ECLfilm. They were quantified by scanning photodensitometryusing ImageQuant Software 3.3 (Molecular Dynamics,Sunnyvale, CA, USA). COX protein was...
- 7
- 535
- 0
Báo cáo y học: "Management of chest pain: exploring the views and experiences of chiropractors and medical practitioners in a focus group interview"
... episodes of unexplainedretrosternal pain in patients lacking a cardiac abnormalityafter a reasonable evaluation, is associated with repeatedemergency room utilization [73] and may be treatedempirically ... equiva-lent to medical residencies in family practice. They usuallyrequire approximately 360 additional hours of didactictraining, with only part of that training in a clinical set-ting. There are efforts ... sometimes dynamic interplay between 'diag-nosis' and 'treatment' whether in managing a givenpatient in actual practice or in attempting to define anappropriate evidence-based professional...
- 10
- 788
- 0
Báo cáo y học: "Utility of routine chest radiographs in a medical–surgical intensive care unit: a quality assurance survey"
... surveyNatalie Chahine-Malus, Thomas Stewart, Stephen E Lapinsky, Ted Marras, David Dancey, Richard Leung and Sangeeta MehtaMount Sinai Hospital, Toronto, Ontario, CanadaCorrespondence: S Mehta, ... prospectivelyevaluate their utility in our medical surgical ICU as part of aquality assurance survey. The goals of this study were todetermine the percentage of routine and non-routine radio-graphs that ... treated, lung or pleural biopsy,thoracentesis, or other.AnalysisGiven that medical and surgical patients often have differentcomplications and varying lengths of stay, the data for eachwere analyzed...
- 5
- 506
- 0
Báo cáo y học: "Prevalence of Overactive Bladder, its Under-Diagnosis, and Risk Factors in a Male Urologic Veterans Population"
... Borawski1, William Tran1, Martin H Bluth2 1. SUNY Downstate Medical School, Department of Urology, Brooklyn, NY, USA 2. Wayne State University School of Medicine, Department of Pathology , ... there was a statistically signif-icant association between OAB and hepatitis (p=0.03, OR=2.2). See Table 3. Table 2. Prevalence of OAB, LUTS and OAB subtypes. DISCUSSION The prevalence of OAB in ... results of the EPIC study. Eur Urol 2006; 50:1306. 3. Herschorn S, Gajewski J, Schulz J and Corcos J. A popula-tion-based study of urinary symptoms and incontinence: the Canadian Urinary Bladder...
- 4
- 520
- 0
Báo cáo y học: "Replacement of cisplatin with nedaplatin in a definitive 5-fluorouracil/ cisplatin-based chemoradiotherapy in Japanese patients with esophageal squamous cell carcinoma"
... Nakamura 3, Kazusaburo Kataoka 1 and Toshiyuki Sakaeda 2,3 1. School of Pharmacy and Pharmaceutical Sciences, Mukogawa Women’s University, Nishinomiya, Japan; 2. Graduate School of Pharmaceutical ... toxicity of nedaplatin and 5-FU with radiation treatment for advanced esophageal carcinomas. Anticancer Res. 2003; 23: 3493-8. 15. Yamada H, Maki H, Takeda Y, et al. Evaluation of combined nedaplatin ... cell carcinoma Akiko Kuwahara 1, Motohiro Yamamori 2, Kohshi Nishiguchi 3,4, Tatsuya Okuno 3, Naoko Chayahara 3, Ikuya Miki 3, Takao Tamura 3, Tsubasa Inokuma 2, Yoshiji Takemoto 2, Tsutomu Nakamura...
- 7
- 531
- 0
Báo cáo y học: " Role of Dietary Soy Protein in Obesity"
... en-ergy as fat and 28% as protein); and carbohydrate diet (28% of energy as fat and 11% as protein) and were administered for 4 days in a 3-way crossover design. After 4 days of each dietary intervention, ... plasma levels of alanine transaminase and aspartate transaminase [55]. These effects were accompanied by increased activities of mitochondrial and peroxisomal beta-oxidation, ace-tyl-CoA carboxylase, ... that soy protein intake stimulates skeletal muscle fatty acid oxidation by activating PPAR path-ways leading to reduced accumulation of body fat. Soy protein may reduce adiposity by modulating...
- 11
- 670
- 2
Báo cáo y học: "Treatment of Chronic HCV Infection in Special Populations."
... reduction in viral RNA was seen to be less in African Americans than Caucasians by 50%. This indicates a larger population of slow responders in African Americans which may explain a low SVR in this ... hydrostatic balance into the peritoneal cavity and the use of the serum to ascites albumin gradient (SAAG) in the differential diagnosis of ascites. Much of his research and clinical effort has ... 2003;38(1) :A6 26. 27. Bruno R, Sacchi P et al. Viral dynamics and pharmacokinetics of peginterferonalpha- 2a and peginterferon alpha-2b in naùve patients with chronic hepatitis C: a randomized,...
- 6
- 389
- 0
Tài liệu Báo cáo Y học: Control of p70 ribosomal protein S6 kinase and acetyl-CoA carboxylase by AMP-activated protein kinase and protein phosphatases in isolated hepatocytes pot
... between 5 and 10 min of incubation. In contrast, the inactivation of p70S6K by AICAr was slower and was half-maximal only at 7 min, whereas the inactiva-tion of ACC by AICAr was half-maximal at about ... glutamine and leucine, inducean anabolic response in liver. They activate p70 riboso-mal protein S6 kinase (p70S6K) and acetyl-CoA car-boxylase (ACC) involved in protein and fatty acidssynthesis, ... amino-acid-induced accu-mulation of glutamate and is inhibited by calyculin A [17].Activation of AMPK inactivates ACC by direct phospho-rylation of Ser79. An additional inactivation of the gluta-mate-sensitive...
- 9
- 455
- 0
Báo cáo Y học: Regulation of a1,3galactosyltransferase expression in pig endothelial cells Implications for xenotransplantation doc
... a1 ,3GalT-5¢ -A p12 CCTGTCAAAAGAATAAACAGCGGTT Exon 3 a1 ,3GalT-5¢ -A p13 CACTGTTCCCTCAGCCGAGGAC Exon 1 a1 ,3GalT-5¢-B and -Ep14 CCAACTCCTGATCGGCAGAAGC Exon 1 a1 ,3GalT-5¢B and Ep15 ACTTCTGAAGCCTAAAGGATGCGA ... ACTTCTGAAGCCTAAAGGATGCGA Exon 2 a1 ,3GalT-5¢-Cp16 AGGCAGGGCTGGGAGGAA Exon 3 a1 ,3GalT-5¢-Cp17 TTGCTGTCGGAAGATACATTGAG Exon 8 a1 ,3GalT-coding regionp18 CTTTGTGGCCAACCATGAAGTA Exon 9 a1 ,3GalT-coding regionÓ ... TGTCCCTGCTAGTTGTCATTTGG Intron 2 Promoter A p7 ACGACCACTTTGTCAAGCTCATT GAPDHp8 TGAGGTCCACCACCCTGTTG GAPDHp9 TCCTGAAACGCCTTCGGAAGAG E-selectinp10 CCATTGGGTTGAAGGCATTCG E-selectinp11 ACAAGGCCCCTGGCTGCT...
- 10
- 444
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyentours of australia and new zealand from canadamap of australia and new zealand showing citiessheep breeding in colonial canterbury new zealand a practical response to the challenges of disease and economic change 1850 1914báo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam